ID: 908596092

View in Genome Browser
Species Human (GRCh38)
Location 1:65690252-65690274
Sequence CTGTGTCTCCAACAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908596092_908596099 15 Left 908596092 1:65690252-65690274 CCCACCTCCTGTTGGAGACACAG No data
Right 908596099 1:65690290-65690312 GTGCTGTAGAGGGATGACGAAGG No data
908596092_908596097 4 Left 908596092 1:65690252-65690274 CCCACCTCCTGTTGGAGACACAG No data
Right 908596097 1:65690279-65690301 CAGTGGTGTAAGTGCTGTAGAGG No data
908596092_908596100 24 Left 908596092 1:65690252-65690274 CCCACCTCCTGTTGGAGACACAG No data
Right 908596100 1:65690299-65690321 AGGGATGACGAAGGCTCTCTAGG No data
908596092_908596098 5 Left 908596092 1:65690252-65690274 CCCACCTCCTGTTGGAGACACAG No data
Right 908596098 1:65690280-65690302 AGTGGTGTAAGTGCTGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908596092 Original CRISPR CTGTGTCTCCAACAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr