ID: 908599613 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:65724799-65724821 |
Sequence | AGCGTGGATCATAGCTGAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908599613_908599621 | 25 | Left | 908599613 | 1:65724799-65724821 | CCATCTCAGCTATGATCCACGCT | No data | ||
Right | 908599621 | 1:65724847-65724869 | CCTCTTGACACCACAAAGCCAGG | No data | ||||
908599613_908599622 | 26 | Left | 908599613 | 1:65724799-65724821 | CCATCTCAGCTATGATCCACGCT | No data | ||
Right | 908599622 | 1:65724848-65724870 | CTCTTGACACCACAAAGCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908599613 | Original CRISPR | AGCGTGGATCATAGCTGAGA TGG (reversed) | Intergenic | ||