ID: 908599613

View in Genome Browser
Species Human (GRCh38)
Location 1:65724799-65724821
Sequence AGCGTGGATCATAGCTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908599613_908599621 25 Left 908599613 1:65724799-65724821 CCATCTCAGCTATGATCCACGCT No data
Right 908599621 1:65724847-65724869 CCTCTTGACACCACAAAGCCAGG No data
908599613_908599622 26 Left 908599613 1:65724799-65724821 CCATCTCAGCTATGATCCACGCT No data
Right 908599622 1:65724848-65724870 CTCTTGACACCACAAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908599613 Original CRISPR AGCGTGGATCATAGCTGAGA TGG (reversed) Intergenic