ID: 908599761

View in Genome Browser
Species Human (GRCh38)
Location 1:65726062-65726084
Sequence TCATCTTATTTCTTTTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908599761_908599764 1 Left 908599761 1:65726062-65726084 CCTTGGGAAAAGAAATAAGATGA No data
Right 908599764 1:65726086-65726108 TGTGGTTGGCTACACTAACTAGG No data
908599761_908599765 20 Left 908599761 1:65726062-65726084 CCTTGGGAAAAGAAATAAGATGA No data
Right 908599765 1:65726105-65726127 TAGGATGCACCACTGTAGCTAGG No data
908599761_908599766 25 Left 908599761 1:65726062-65726084 CCTTGGGAAAAGAAATAAGATGA No data
Right 908599766 1:65726110-65726132 TGCACCACTGTAGCTAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908599761 Original CRISPR TCATCTTATTTCTTTTCCCA AGG (reversed) Intergenic
No off target data available for this crispr