ID: 908599765

View in Genome Browser
Species Human (GRCh38)
Location 1:65726105-65726127
Sequence TAGGATGCACCACTGTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908599760_908599765 25 Left 908599760 1:65726057-65726079 CCTATCCTTGGGAAAAGAAATAA No data
Right 908599765 1:65726105-65726127 TAGGATGCACCACTGTAGCTAGG No data
908599761_908599765 20 Left 908599761 1:65726062-65726084 CCTTGGGAAAAGAAATAAGATGA No data
Right 908599765 1:65726105-65726127 TAGGATGCACCACTGTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908599765 Original CRISPR TAGGATGCACCACTGTAGCT AGG Intergenic
No off target data available for this crispr