ID: 908607475

View in Genome Browser
Species Human (GRCh38)
Location 1:65814403-65814425
Sequence AGGTGCACAAAATAATCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908607475 Original CRISPR AGGTGCACAAAATAATCCAT TGG (reversed) Intronic
905471092 1:38192485-38192507 AGGTGCACACCATCATCCCTGGG - Intergenic
907536335 1:55162967-55162989 AGGTCCAGAAACAAATCCATTGG + Intronic
907900631 1:58738240-58738262 AGGTGCAAAAATTAATCAATAGG - Intergenic
908607475 1:65814403-65814425 AGGTGCACAAAATAATCCATTGG - Intronic
912007837 1:104926596-104926618 AGGATAATAAAATAATCCATTGG - Intergenic
913476514 1:119243772-119243794 ATTTGCTCAAAATAATCCATGGG + Intergenic
914769153 1:150668062-150668084 AGGTGCAGAACCTAATCCAGAGG - Intronic
916637321 1:166686800-166686822 AGGTACAAAAAATAATTAATGGG - Intergenic
916695306 1:167229748-167229770 AGGTGCCCCACAGAATCCATCGG - Intronic
917061442 1:171045720-171045742 ATCTGTAAAAAATAATCCATGGG + Intronic
1063918029 10:10904102-10904124 AGATGAATAAAATATTCCATGGG - Intergenic
1066099009 10:32100492-32100514 AGTTGCAAAAAATAAAACATAGG - Intergenic
1066605438 10:37162919-37162941 AGTTGAAAAAAATAAACCATTGG - Intronic
1067251314 10:44589238-44589260 AGTTGCCCAAATTAAACCATTGG - Intergenic
1068259470 10:54560186-54560208 ATGTGCACAAAATCTTCTATAGG - Intronic
1068575045 10:58675751-58675773 AGGTGTACAAAATAATGATTTGG - Intronic
1070957305 10:80472990-80473012 AGGTGCACACTAAAAACCATGGG - Intronic
1072392427 10:95000640-95000662 AAGGGAAAAAAATAATCCATAGG + Intergenic
1078038510 11:7834556-7834578 ATGTCCACATAGTAATCCATAGG - Intergenic
1078130460 11:8610094-8610116 TAGTGGATAAAATAATCCATAGG + Intergenic
1079778149 11:24560562-24560584 AGGTGCACTAAAGAACACATAGG + Intronic
1081225057 11:40511401-40511423 AGATGCAAAAGATAATTCATAGG + Intronic
1086275013 11:85116684-85116706 ATGTGCACAAAATGTTACATTGG + Intronic
1086857905 11:91888705-91888727 AGGTGCACAAACTCATTCCTGGG + Intergenic
1087120373 11:94568294-94568316 AGGTTCACAAAATAGGCCAAGGG - Intronic
1087189635 11:95239411-95239433 AGGTGCTCAAAAAAACTCATTGG + Intergenic
1087349233 11:97010098-97010120 AGGGTCACAAAGTAATACATTGG - Intergenic
1088532399 11:110825184-110825206 AGATGCACCAAATAATTCCTTGG + Intergenic
1089235912 11:117025045-117025067 AGGGACACAAACTCATCCATCGG + Intronic
1091346894 11:134860679-134860701 AGGTGCCAAGAATAAACCATGGG - Intergenic
1095085732 12:38056065-38056087 AGAGGCAGAAAATATTCCATGGG + Intergenic
1095158540 12:38888339-38888361 AGATGCATGAAATAATACATAGG + Intronic
1095572276 12:43696920-43696942 GCATGCAGAAAATAATCCATGGG + Intergenic
1099152345 12:79130373-79130395 TGGTGGACAATATAATGCATAGG - Intronic
1099448828 12:82784249-82784271 AGTTGCACAAAATAATTAACTGG - Intronic
1099599876 12:84720813-84720835 AGCTGCACAAAATTACCCCTTGG - Intergenic
1100229281 12:92590935-92590957 AGGTGTACAAAACAATCAATGGG + Intergenic
1101039390 12:100738705-100738727 AGGTGCACAACATAATGTCTTGG + Intronic
1101099644 12:101379238-101379260 AGATGAACAAAATAAGCCAATGG - Intronic
1106489860 13:30210845-30210867 AGGTGAGCAAAGTAATTCATAGG - Intronic
1111880104 13:93945195-93945217 AGGTGTACTATATAATCCTTTGG - Intronic
1112263790 13:97903537-97903559 ATGTTCACTAAATATTCCATGGG - Intergenic
1114159059 14:20142479-20142501 AGGTGCACAAGATAATCCATTGG - Intergenic
1114512219 14:23271839-23271861 AGTTGAACAAAATTATCTATTGG + Intronic
1116461892 14:45186680-45186702 AGGTTTACAATATAATCCAGTGG + Intronic
1116741566 14:48761406-48761428 AGGAGCTCAAAAAAATCAATAGG - Intergenic
1124353925 15:28980913-28980935 AGCTGCCAAAAATAAGCCATGGG + Intronic
1125070627 15:35548844-35548866 TGGTGGAAAAGATAATCCATTGG - Intergenic
1125832544 15:42727045-42727067 AGTTGCACAAAAGCAGCCATAGG + Intronic
1126562251 15:50056579-50056601 GGGTGCCCAAAAGAATCCTTTGG + Intronic
1129827595 15:78644769-78644791 AAGTTCACAAAAAAATCTATTGG - Intronic
1130323599 15:82860389-82860411 AGGTGCACAGATTAAACAATTGG + Intronic
1130521059 15:84660844-84660866 AGGTTCACAAAACAACCCATGGG + Intergenic
1133439744 16:5810994-5811016 AGGTACACAAACAAACCCATTGG - Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1138469504 16:57222130-57222152 AGATTAACAAAATAATCCAAGGG - Intronic
1144550034 17:16232339-16232361 GGATGCACAAAATAATCTTTTGG - Intronic
1144704193 17:17356584-17356606 AGGTGCCCAAAGACATCCATGGG + Intergenic
1146057324 17:29588033-29588055 TTGGGCACAAAATACTCCATAGG - Intronic
1149726988 17:58905791-58905813 AGGTGCACTAATTAATTAATAGG + Intronic
1154336088 18:13466024-13466046 CGGTGCTCAAAATAATGCCTGGG + Intronic
1164271394 19:23675170-23675192 AGGTGCTATAAAAAATCCATGGG + Intronic
927485009 2:23482507-23482529 ACTTGCACAAAAGCATCCATCGG + Intronic
928739485 2:34333174-34333196 ATGTACACAAGACAATCCATTGG + Intergenic
933327247 2:80853554-80853576 AGGTACAGAAAATAATCATTGGG - Intergenic
933977671 2:87524939-87524961 AGGAGGACAAAATAAGTCATAGG - Intergenic
934489174 2:94746970-94746992 AGATACACTAAACAATCCATGGG - Intergenic
935157225 2:100494161-100494183 AGGGGCACAGAATTATCCCTGGG + Intergenic
936262088 2:110969055-110969077 ACATGCTTAAAATAATCCATAGG + Intronic
937673344 2:124562069-124562091 AGGTGCAAAGAATAACCCAAAGG + Intronic
939423407 2:142003324-142003346 ATTTGCACAAAATTACCCATTGG - Intronic
939765916 2:146249502-146249524 AGGAGCAGAAAATAATGAATTGG + Intergenic
940759977 2:157727535-157727557 AGGTGTACAAGATGATCCACTGG + Intergenic
940928932 2:159403117-159403139 AGGTGGAAAAAATAATCCAAAGG + Intronic
941496930 2:166217085-166217107 AGGTGCAAAGAATAAACAATGGG + Intronic
942974670 2:182001071-182001093 AGGAGCTCATAATAATCCAATGG - Intronic
944298537 2:198094871-198094893 AGTTGCACAAAATACTAGATAGG - Intronic
944500968 2:200359943-200359965 GAGTGCTCAAAATAATCCTTTGG + Intronic
946087358 2:217187418-217187440 AAATGCATAAAATGATCCATAGG + Intergenic
947417928 2:229917562-229917584 AGTGGCACAGAATAATCCACTGG + Intronic
1170037561 20:12004965-12004987 AGGTGCACAGCACAAGCCATTGG - Intergenic
1172200633 20:33123731-33123753 AGTTTCACAAAATAATCAATGGG - Intergenic
1174425343 20:50428187-50428209 AGATCCACAAAATAACCCAATGG - Intergenic
1176673539 21:9755963-9755985 ACGTTCATAAAATAAACCATGGG + Intergenic
1177299409 21:19222550-19222572 AGGTGCACAAAAAATTCTCTAGG + Intergenic
1177663279 21:24116033-24116055 AGGTGAAAAAAATAAACCAAAGG + Intergenic
1178925493 21:36771460-36771482 AGGGACACAAAATAATTCAGGGG + Intronic
1183923123 22:41185238-41185260 AGGTTGCCAAAATAATCCAATGG + Intergenic
950582639 3:13872560-13872582 AGGTGCCCAAGAAAATCCTTGGG - Intronic
953362568 3:42310918-42310940 AAGTACTCAAAATAATGCATAGG + Intergenic
956928584 3:74016884-74016906 AGGAGCACAACATTATCCTTGGG + Intergenic
959652294 3:108762620-108762642 AGGTGCATAAGACAATCCATTGG + Intergenic
961529536 3:127532107-127532129 TGGAGCACAAAATAATGGATTGG + Intergenic
963594544 3:147308977-147308999 AGGTCCAAAAAATAATCCTTTGG + Intergenic
964438840 3:156682901-156682923 AAGTACAAAAAATAATTCATTGG - Intronic
964576198 3:158171315-158171337 AGGTCCACTATATAATCCAAAGG + Intronic
968383602 4:116337-116359 ACATGCTCTAAATAATCCATGGG - Intergenic
969860486 4:10032020-10032042 AGGTGCTCAATATACACCATCGG - Intronic
970468350 4:16350301-16350323 AGGTGCTCAAAAGAATCCTGTGG - Intergenic
974737647 4:65958826-65958848 AGATGCATAAAATAATTTATGGG - Intergenic
974864439 4:67562921-67562943 AGGTGTGCAAGATGATCCATTGG - Intronic
978127291 4:105149554-105149576 AGGTGCTCCAAAAATTCCATAGG + Intronic
981287238 4:143032561-143032583 AGGAGCTCAAAAAACTCCATAGG + Intergenic
983080668 4:163381579-163381601 ATGTGCACAAAATCAGCTATAGG + Intergenic
983975393 4:173927503-173927525 CAATGCACAAAACAATCCATTGG + Intergenic
984742314 4:183177053-183177075 TGGTGGACAAAATAAGTCATGGG + Intronic
987539992 5:19242279-19242301 AGGTGCATAAAATATTCTAGGGG + Intergenic
987730568 5:21765788-21765810 AGATCCAGATAATAATCCATAGG - Intronic
989586317 5:43076507-43076529 AACTGCTCAAAATAATCCATAGG - Intronic
991455728 5:66801513-66801535 TGGTGCACAATATAATCAACTGG - Intronic
991700143 5:69309735-69309757 AGGTGCACAGTGTAAGCCATGGG - Intronic
992547316 5:77826198-77826220 AGGGGTATAAAATAATCCCTAGG + Intronic
994319783 5:98380231-98380253 AAATGCACAAAATAATACAAAGG + Intergenic
995250465 5:109987198-109987220 AAGTACATAAAATAATCCAATGG - Intergenic
995541337 5:113189133-113189155 GTGTTCACAAAATAATCCAATGG + Intronic
997061877 5:130515717-130515739 ATGTTGACAAAATAAACCATGGG - Intergenic
999676847 5:154012856-154012878 AGGTTCACAAAATAATTCAATGG + Intronic
1001164229 5:169348993-169349015 AGGTGCACAAAACCCTCTATTGG + Intergenic
1008281240 6:49598883-49598905 AGGTGCACAATATAATCTCCTGG - Intergenic
1008626477 6:53321875-53321897 ATGTTCACAAATTAATCCTTAGG - Intronic
1009165539 6:60336981-60337003 AGGTGCCAAAAATAAACAATGGG - Intergenic
1011995839 6:93586878-93586900 AGTTACACAAAATAAACCACAGG + Intergenic
1012682450 6:102199101-102199123 AGGTGCAAAAAAGAATCAATTGG + Intergenic
1014522814 6:122466088-122466110 AGGTGCACAACACCATCCCTGGG - Intronic
1014745929 6:125200783-125200805 AGGTTGACAAAATAATGAATTGG - Intronic
1015286036 6:131487629-131487651 GGGTGCACCATATAATACATTGG - Intergenic
1016011856 6:139145012-139145034 AGGTACGAAAAATAAACCATAGG - Intronic
1016484668 6:144524047-144524069 GGGAGCACAGAATAATACATTGG + Intronic
1018570159 6:165201506-165201528 AGGTGGACAAAACAAGCAATGGG + Intergenic
1018582990 6:165323934-165323956 AGGTGCACAGAATAACGCAGAGG - Intergenic
1019572277 7:1718808-1718830 AGGTCCACAAACCAATCAATGGG - Intronic
1021759329 7:23888021-23888043 AGGGGCACAATTCAATCCATAGG + Intergenic
1024789928 7:52954127-52954149 AAGTGTAAAAAATAATACATGGG + Intergenic
1027708734 7:81570019-81570041 AGCTAAACAAAATAATCCTTTGG + Intergenic
1028297556 7:89154014-89154036 AGGAACACAAACAAATCCATAGG + Intronic
1031097340 7:117436117-117436139 ATGTGCACAAAATAGTCAAGGGG + Intergenic
1031404671 7:121369998-121370020 AGATGTCCAAAATCATCCATGGG + Intronic
1032530618 7:132616731-132616753 AGGTGCACAAGAGGATCCACTGG - Intronic
1033027584 7:137790971-137790993 AGGTGAAAAAAATTATCCTTTGG - Intronic
1036155419 8:6337793-6337815 AGGTGCCCAAAAGAATCGACAGG + Intergenic
1036985605 8:13526081-13526103 AGGTGCAAAGAAAATTCCATGGG - Intergenic
1036990725 8:13590560-13590582 AGCTGAACAACAAAATCCATTGG - Intergenic
1037105370 8:15100566-15100588 ATGTCTACAAAATAATCCACTGG - Intronic
1039624099 8:39029962-39029984 AGGTTCACAGAATAATCAAGAGG + Intronic
1042964497 8:74336154-74336176 AAGTCCACAAACTGATCCATTGG + Intronic
1050832478 9:10030756-10030778 ATCTTCACTAAATAATCCATGGG - Intronic
1052450745 9:28627782-28627804 ATATGCACATAATAATCCATTGG + Intronic
1053668610 9:40337362-40337384 AGATACACTAAACAATCCATGGG + Intergenic
1053918418 9:42963650-42963672 AGATACACTAAACAATCCATGGG + Intergenic
1054165964 9:61729236-61729258 ACATGCAAAAAAAAATCCATGGG - Intergenic
1054379750 9:64477414-64477436 AGATACACTAAACAATCCATGGG + Intergenic
1054516001 9:66038932-66038954 AGATACACTAAACAATCCATGGG - Intergenic
1055444054 9:76365308-76365330 AGGTGCACAATCTCATCCAGAGG + Intergenic
1059287784 9:113191116-113191138 AGGTGCACAATATGAGCTATTGG + Intronic
1059942597 9:119372029-119372051 AGATACACTAAATCATCCATTGG - Intergenic
1060620358 9:125059913-125059935 AGGTGTACAAAATAGGCCAGGGG - Intronic
1061337760 9:129952847-129952869 AGGTGCACAAAACCATTTATGGG - Intronic
1062296666 9:135833537-135833559 AGGTGCCAAAAATACACCATGGG + Intronic
1185716015 X:2342797-2342819 AGTTGAAAAAAACAATCCATTGG - Intronic
1186119439 X:6343486-6343508 AGGTGAAGTAAATAATTCATTGG + Intergenic
1186386644 X:9116574-9116596 GGGTGCACAAGAAAATCCACTGG + Intronic
1187000833 X:15175715-15175737 AGGCCCTAAAAATAATCCATAGG - Intergenic
1187968792 X:24639296-24639318 AAGTGCACACAATAATTCAATGG + Intronic
1190157068 X:48003132-48003154 AGGTGTACAAAAAAATCCTAAGG + Intronic
1192232112 X:69272524-69272546 AGCTGCACATTATAATCCCTTGG - Intergenic
1195453202 X:105038664-105038686 AGGATCAAAAAATAATCTATAGG - Intronic
1196057753 X:111374362-111374384 TGGAGAACAAATTAATCCATGGG + Intronic
1196552207 X:117042422-117042444 AGGTGCACAAACAACACCATAGG + Intergenic
1198150380 X:133902901-133902923 ATATTCACAAAATAATACATGGG - Intronic
1198882587 X:141297029-141297051 AGGTGCTCAAACAACTCCATAGG + Intergenic
1201535219 Y:15039813-15039835 ACTTGGACAAAATAAGCCATGGG + Intergenic