ID: 908607919

View in Genome Browser
Species Human (GRCh38)
Location 1:65820701-65820723
Sequence TCATCTACAAAGTAGAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 315}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908607911_908607919 30 Left 908607911 1:65820648-65820670 CCTTAATAGCAGTGAGTCAATGG No data
Right 908607919 1:65820701-65820723 TCATCTACAAAGTAGAGATATGG 0: 1
1: 0
2: 3
3: 26
4: 315
908607916_908607919 -3 Left 908607916 1:65820681-65820703 CCCTTGGGTTCTTCCTTTCTTCA No data
Right 908607919 1:65820701-65820723 TCATCTACAAAGTAGAGATATGG 0: 1
1: 0
2: 3
3: 26
4: 315
908607917_908607919 -4 Left 908607917 1:65820682-65820704 CCTTGGGTTCTTCCTTTCTTCAT No data
Right 908607919 1:65820701-65820723 TCATCTACAAAGTAGAGATATGG 0: 1
1: 0
2: 3
3: 26
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908607919 Original CRISPR TCATCTACAAAGTAGAGATA TGG Intronic
901208634 1:7511829-7511851 TCCTCTACAAAGTGGAGTTTGGG - Intronic
903101295 1:21032491-21032513 TCATCTTCAAGGTAGATATGAGG - Intronic
908305966 1:62816556-62816578 TCATCTAAAAAATAAACATACGG - Exonic
908526013 1:64988275-64988297 TCATCTGTAAAGTAGGAATATGG - Intergenic
908607919 1:65820701-65820723 TCATCTACAAAGTAGAGATATGG + Intronic
908655050 1:66379825-66379847 GCATGTACAAAGTAGAGAATGGG + Intergenic
908792842 1:67800275-67800297 TCATCAGCAAAGTCGAAATATGG + Intronic
910169763 1:84365747-84365769 GCATTTACAAAGCAGGGATATGG - Intronic
912601576 1:110939828-110939850 TCATATACAAAGTAGACTAAAGG + Intergenic
912695301 1:111837115-111837137 TTATCTTCAAAATACAGATAAGG - Intronic
913181192 1:116323519-116323541 TCATCTACTAAATACAGACATGG + Intergenic
913433714 1:118825223-118825245 ATATAAACAAAGTAGAGATATGG + Intergenic
915457843 1:156052622-156052644 TCATCTTTAAAATGGAGATACGG - Intronic
916024475 1:160821940-160821962 TCATCTACAAAAAATAAATACGG + Intronic
916041165 1:160962807-160962829 TCACCTGTTAAGTAGAGATAAGG + Intergenic
916232697 1:162556141-162556163 TCATCTACAAAATTGAAATATGG - Intergenic
916347773 1:163813444-163813466 TAAACTACAAAGTACATATAAGG + Intergenic
916538544 1:165728922-165728944 TCTACTAAAAAGTAGAGATGGGG - Intronic
919018798 1:192076436-192076458 TAAGTTACAAAGTAGATATAAGG + Intergenic
920525752 1:206664653-206664675 TCATCTCCAAATTACAGATATGG - Intronic
920553099 1:206881528-206881550 TCAACTAAAAAGTGGAGATGGGG - Intergenic
921014071 1:211170853-211170875 TCATCTATAAATAAGAGTTAAGG + Intergenic
922006810 1:221539456-221539478 CCATCTCAAAAGTAGAGATGGGG + Intergenic
922385536 1:225077631-225077653 TGATCTCCAAAGTACAGATGAGG + Intronic
923943654 1:238858343-238858365 TGATTTACGAAGTAGAGATCAGG - Intergenic
924487194 1:244496638-244496660 TCCTCTACAACATAAAGATACGG + Intronic
1063661954 10:8040777-8040799 TAATCTGGAAAGCAGAGATAAGG + Intergenic
1063983870 10:11480179-11480201 TCATCTACATTGTGCAGATAGGG - Intronic
1064608220 10:17067287-17067309 TCATGTGTAAAGTAGAGACATGG + Intronic
1064921533 10:20524688-20524710 TCAACTATAAAGTAAAGAGAGGG - Intergenic
1066812500 10:39358258-39358280 TCATATAAAAAGTAGACAGAAGG - Intergenic
1066932536 10:41782162-41782184 TCAGATACAAAGTAGAAAGATGG + Intergenic
1068867206 10:61906857-61906879 TCATCTGTAAAGTGGAAATACGG + Intronic
1069758105 10:70786037-70786059 TCATCTCCATTTTAGAGATATGG - Intergenic
1070998600 10:80809023-80809045 TCATCAACTAAGTGAAGATAGGG - Intergenic
1071819147 10:89263075-89263097 TCACATACAAAATAGATATAGGG + Intronic
1072160616 10:92762760-92762782 TAATCTCCAAAGTAGATAAATGG - Intergenic
1073767738 10:106701801-106701823 CAATCTACAAAATAGAGACAAGG + Intronic
1073973240 10:109069231-109069253 TCATCTACAAAGCAGAAAGCAGG - Intergenic
1074470801 10:113725055-113725077 TGATCTTCAATGTACAGATAAGG + Intronic
1074700268 10:116086428-116086450 TCACCTACAAAGCACATATATGG - Intronic
1078058328 11:8026099-8026121 ACTTCTCCAAAGAAGAGATATGG - Intronic
1078846523 11:15123739-15123761 TGGTCTACAAACCAGAGATAAGG - Intronic
1079168815 11:18072350-18072372 TCATCTATAGAGTAGAGATGAGG - Intronic
1079493659 11:21016737-21016759 TCATGTACCAAGTAGAGATGTGG - Intronic
1079552723 11:21720158-21720180 TCCACTACATAGTAGAGATGAGG - Intergenic
1080161088 11:29177310-29177332 GCATATGCAAACTAGAGATAGGG - Intergenic
1080268836 11:30428950-30428972 ACATCTGAAAAGTAGAGAAAAGG - Intronic
1080335783 11:31194547-31194569 TTAACTAAAAAGTAGAGTTATGG - Intronic
1080831433 11:35896719-35896741 TCCTCTACAATGTAGACAGAGGG - Intergenic
1082874606 11:57975264-57975286 TCCTCCAAAAAGTAGAGAAATGG + Intergenic
1084464573 11:69314525-69314547 TCATCTGAAAAGTGGGGATAAGG + Intronic
1084673498 11:70621280-70621302 TCATCTGCAAAATAGTGATCAGG - Intronic
1085719669 11:78902169-78902191 TCATCTACAGTTTAGAGAAAGGG + Intronic
1086517032 11:87624754-87624776 TCATGTAAAAAATAGAGATAAGG - Intergenic
1086834786 11:91607473-91607495 TCATCTTCTTAGTAGAGATGGGG + Intergenic
1087506226 11:99025753-99025775 TCATATAAATAGTAGAGAAATGG + Intronic
1090045618 11:123330105-123330127 TCATCTGTACAGTAGGGATAAGG - Intergenic
1090617737 11:128531253-128531275 TCATCTACAGAATGGAGATGCGG + Intronic
1092299375 12:7230908-7230930 TTATTTAGAAAATAGAGATAGGG - Intergenic
1092654808 12:10673515-10673537 TCATCTGCAAAGCATAAATACGG - Intronic
1093814874 12:23533634-23533656 CCATCTTTAAAGTAGAGAGATGG + Exonic
1094173195 12:27516073-27516095 TCATCTGCAAAGTGGAAACAGGG + Intergenic
1095756967 12:45779011-45779033 TTATCTAAAAACTAAAGATATGG - Intronic
1096823406 12:54255252-54255274 TTATCTTCAAAATAGAGACAGGG - Intronic
1097045666 12:56186237-56186259 TGATCTACAAAATCAAGATACGG + Exonic
1097465316 12:59916204-59916226 TCATCCATAAAATAGAGATAGGG + Intergenic
1101483180 12:105123012-105123034 TCATATCAAAAGTAGAGATAGGG + Intronic
1101945048 12:109130278-109130300 TCATCTGCAAAATGGGGATAAGG - Intronic
1103148010 12:118611937-118611959 TCACGTGCAAAGTGGAGATAAGG + Intergenic
1108911586 13:55559126-55559148 TGATCTATAAAGTAGAGAATGGG + Intergenic
1109079754 13:57883972-57883994 TCAAGTACAAACTAGAGAAATGG + Intergenic
1110292452 13:73823054-73823076 TCATCTGCAATGTACAGAGAAGG + Intronic
1112073935 13:95887355-95887377 TGATCCACAAAGAAGAGAAAGGG + Intronic
1112631379 13:101164549-101164571 TCATTCAAAAAGTAGAAATATGG - Intronic
1114824471 14:26060112-26060134 TCATCTACACAATGGAGAGAAGG + Intergenic
1116782612 14:49252513-49252535 TCCTCAACAAAGGAGAAATAAGG + Intergenic
1117538397 14:56723327-56723349 TCTTTTACAAAATAGAGATACGG - Intronic
1117924467 14:60763432-60763454 TCATCTATAAAATAAAAATATGG - Intronic
1117943353 14:60992438-60992460 TGATCTACACAGTAGCAATAAGG - Intronic
1118296060 14:64570850-64570872 TCATCTGTAAAATAGGGATAAGG - Intronic
1118855352 14:69617321-69617343 TTAACCACAAAGTAGAGATATGG - Intronic
1119077664 14:71659488-71659510 TTATCAACAAAGTACAGATCAGG - Intronic
1119589206 14:75869438-75869460 TCATCTTCAAATTAGAGATAAGG - Intronic
1119977583 14:79042396-79042418 TCATCTCTAAGGTAGGGATAAGG - Intronic
1120451251 14:84669360-84669382 TTATCTGTAAAGTATAGATAAGG + Intergenic
1124685733 15:31780314-31780336 TCTTCTACAAAGTTAAGAAATGG + Intronic
1127238685 15:57086361-57086383 TCATCTACATTTTACAGATAAGG + Intronic
1127540120 15:59929216-59929238 TCATCTGAAAAATAGAGACATGG + Intergenic
1127547203 15:60002813-60002835 TCATCTTCAAAGTCCAGAAATGG - Intergenic
1128624992 15:69191876-69191898 AAATCTACAAAGTACAGAAAAGG - Intronic
1129448797 15:75637824-75637846 TCATCTGAAAAGTAGAGAATTGG + Intergenic
1129962716 15:79702523-79702545 TCATCACCAAAGAAGAGATGAGG + Intergenic
1130833708 15:87628982-87629004 TCATTTGCAAAATAGTGATAGGG + Intergenic
1131321576 15:91398693-91398715 TCAGAAACAAAGGAGAGATAAGG - Intergenic
1131638473 15:94262969-94262991 TCTACTACAAAGAAGAAATAAGG - Intronic
1131884318 15:96894443-96894465 TCGCCTACAATGTAGCGATATGG - Intergenic
1131908462 15:97170093-97170115 TCATCTGAAAAGTAGACAAAAGG + Intergenic
1132443064 15:101887337-101887359 TCATCTACAATGGACAGACAGGG + Intergenic
1133823273 16:9255917-9255939 TCATCTGCAAATTGCAGATAAGG - Intergenic
1134028167 16:10970573-10970595 TAATTTTCAAAGTAGAGATGAGG + Intronic
1134367738 16:13594973-13594995 TCAGCTACAAAGAAGAGACAGGG - Intergenic
1134571522 16:15295318-15295340 TCATCTGCAAAGTAAATATCTGG + Intergenic
1134730858 16:16460721-16460743 TCATCTGCAAAGTAAATATCTGG - Intergenic
1134936572 16:18251172-18251194 TCATCTGCAAAGTAAATATCTGG + Intergenic
1136422520 16:30144332-30144354 TTATCCACAAAGCAAAGATATGG + Intergenic
1137934278 16:52619101-52619123 TCAGCTAAAAAGTAGAGTTCTGG - Intergenic
1138170637 16:54846071-54846093 ACATCTGCAAAATGGAGATAAGG + Intergenic
1140579228 16:76209162-76209184 TCATCTAAGAAATAGACATAAGG + Intergenic
1141570151 16:84929226-84929248 TTATCTACAAAATGGAGAAAAGG + Intergenic
1144087253 17:11821928-11821950 TCATCATCAGAGTAGAGATCTGG - Exonic
1144315207 17:14053650-14053672 ACCTCTACATAGTAGAAATAAGG - Intergenic
1145642564 17:26033649-26033671 GAATCTGCAAAGTGGAGATATGG + Intergenic
1145647773 17:26109499-26109521 GAATCTGCAAAGTGGAGATATGG + Intergenic
1145687353 17:26685684-26685706 TCATATAAAAACTAGAGAGAAGG + Intergenic
1145973423 17:28970287-28970309 TCATCTGTAAAGTAGGGATGGGG + Intronic
1146885914 17:36470857-36470879 TCTAATACATAGTAGAGATATGG + Intergenic
1148541681 17:48485758-48485780 TCATCTATAAAGTAGACTTGAGG + Intergenic
1148919403 17:51017140-51017162 TGATCTACAAAATACAGAAAAGG + Intronic
1149029869 17:52070458-52070480 TCATCTGTAAAATGGAGATAAGG - Intronic
1150177093 17:63069552-63069574 TCATCTAAAAATGACAGATATGG + Intronic
1150923086 17:69504230-69504252 TCATCTGCAATGTAGAGAAGAGG + Intronic
1152086567 17:78223129-78223151 TCACCTGTATAGTAGAGATATGG + Intronic
1152171595 17:78753486-78753508 TTATTTATTAAGTAGAGATAAGG - Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1155169512 18:23256929-23256951 TCATCTGTAAAATAGAGATACGG + Intronic
1155898442 18:31358029-31358051 TCATAGACCAAGAAGAGATATGG + Intergenic
1156071787 18:33220191-33220213 TTTTCTACAAAGTAGAGACTGGG - Intronic
1157328285 18:46685103-46685125 TCATCTGCAAAATGGGGATAAGG - Intronic
1158452995 18:57583452-57583474 TCATCTGCAAAATAGTGATAAGG + Intronic
1158923479 18:62223532-62223554 TCTTCTAGAAATTAAAGATAAGG + Intronic
1159495720 18:69201034-69201056 TCATACACAAAGCAGAAATATGG + Intergenic
1160312682 18:77810613-77810635 TCCTAGACAAAGTGGAGATAAGG - Intergenic
1160319726 18:77878977-77878999 CCATCTACCAAGTATAGACATGG - Intergenic
1161035485 19:2082192-2082214 TCATCTGTAAAGTGGAGACAGGG - Intronic
1162469270 19:10862655-10862677 TCATATTCTTAGTAGAGATAGGG - Intronic
1167383273 19:49150478-49150500 TAAATTACAAAGTAGAGAAAAGG - Exonic
925827895 2:7868182-7868204 TCATCTGTAAAATAGAGATTAGG + Intergenic
925985270 2:9210056-9210078 TCGCCTATAAAGCAGAGATAAGG - Intronic
926931063 2:18041410-18041432 TCATCTGTGAAATAGAGATAAGG - Intronic
927246187 2:20958708-20958730 TCATCTGCAAAATGGAGATAAGG + Intergenic
929008340 2:37416920-37416942 TCTTCTAAAAATTAGAGATTTGG + Intergenic
930540115 2:52695196-52695218 TCACATAAAAAGTAGAGAGATGG - Intergenic
931080604 2:58765688-58765710 TCATCTACATATTAGGGAAAGGG - Intergenic
932366156 2:71154754-71154776 TTGTCTACAAAGAAGAAATAAGG - Intergenic
932839699 2:75070722-75070744 TTACCTGCAAAGTAGAGCTAAGG - Intronic
933276764 2:80292275-80292297 TCATCTATAAAATGGACATAGGG - Intronic
934078633 2:88449257-88449279 TTATTTATAAAATAGAGATAAGG + Intronic
934747895 2:96771530-96771552 TTGTCTAAAAAGTAGAGACAGGG - Intronic
936086938 2:109475669-109475691 GCATCCACAAAGTAGAAATTGGG - Intronic
936479910 2:112876713-112876735 TCATCTGCTAAGTAGATACAAGG - Intergenic
936663152 2:114564640-114564662 TCTTATACATAGTAGACATAAGG + Intronic
936762966 2:115808546-115808568 GCATCTACCCAGTAGAGTTATGG - Intronic
937604343 2:123779197-123779219 ACATGAACAAAGTAGAGAGATGG - Intergenic
938603102 2:132863314-132863336 TCATTTGCAACATAGAGATATGG + Intronic
939415534 2:141891584-141891606 TTATTGACAAAGTACAGATAAGG - Intronic
941823112 2:169862432-169862454 TAAACTACAAAGCAGAGAAAGGG - Intronic
942432812 2:175932577-175932599 ACATCTACAATGTAGACATCAGG + Intronic
942507167 2:176655445-176655467 TCATCTGTAAAATAGGGATAGGG - Intergenic
944638647 2:201699316-201699338 TCATCTATGATGGAGAGATAAGG - Intergenic
945218870 2:207464299-207464321 TCAGCCACAAAATAGAGAGAAGG + Intergenic
945490729 2:210451619-210451641 TCATTTGTAAAATAGAGATAAGG - Intronic
946414320 2:219531982-219532004 TCATCTGCACAGCAGAGATGGGG - Exonic
947310968 2:228801714-228801736 TCAGTTACAAGGGAGAGATATGG + Intergenic
947934821 2:233995192-233995214 TCATCTACAATGAACAGATCAGG - Intronic
1169277925 20:4246020-4246042 TTATCTATAAAATAGAGATGGGG - Intronic
1170319229 20:15076691-15076713 ACATTTAAAAAGTAGAGATGGGG + Intronic
1170396426 20:15930950-15930972 TCTTCTACAGAGTAGGGGTAGGG - Intronic
1170403725 20:16014294-16014316 TCACCTACAAAGTTGGGATTGGG + Intronic
1172425080 20:34850527-34850549 TTATCTATAAAATAGAAATAAGG + Intronic
1173309551 20:41885167-41885189 TCATCTCTATAGTAGAGATAAGG - Intergenic
1173536079 20:43814434-43814456 TCATCTATAAAGTAGAAAGTGGG + Intergenic
1175569670 20:60009293-60009315 TCATCTACAAAGGAGAGTTGGGG + Intronic
1177532020 21:22373010-22373032 TCATCAAAAATGAAGAGATAAGG + Intergenic
1177532066 21:22373399-22373421 TCATCAAAAATGAAGAGATAAGG - Intergenic
1177678201 21:24330076-24330098 TAATCTCCTAATTAGAGATAGGG + Intergenic
1178094953 21:29204767-29204789 TCATCTGTAAGGTAAAGATATGG + Intronic
1178754964 21:35340217-35340239 TCATGTACAAAGTAGAAAGCTGG - Intronic
1182101260 22:27659163-27659185 TGATCTGCAAAGTGGGGATAGGG - Intergenic
1182628653 22:31667345-31667367 TCTACTAAAAAGTAGAGACAGGG - Intergenic
1183225167 22:36544872-36544894 TCATCTGTAAGGTAGAGCTAAGG + Intergenic
1183945204 22:41321698-41321720 TCATCTGCAAAATGGAAATAAGG - Intronic
949175153 3:1052926-1052948 TCATTTACAATCCAGAGATATGG + Intergenic
950068764 3:10135401-10135423 TATTTTACAAAATAGAGATAGGG + Intergenic
950240340 3:11364382-11364404 TCATCTATAAAGTAGGAATGAGG - Intronic
951336975 3:21435127-21435149 TGACACACAAAGTAGAGATAAGG + Intronic
951579915 3:24151688-24151710 TCATCAACAAAATTCAGATAAGG - Intronic
951808210 3:26670500-26670522 TAATCTACAAAATGGAGCTAAGG + Intronic
956252732 3:67252074-67252096 TAAGCTAAAAAGTTGAGATAAGG + Intergenic
957298278 3:78359598-78359620 ACCTCTCCATAGTAGAGATAAGG - Intergenic
958559490 3:95727130-95727152 CTATCTTCAAAGTAGAGATATGG - Intergenic
961935554 3:130579003-130579025 TCATCTATAAAGTATAGCTAGGG - Intronic
962261501 3:133911713-133911735 TAATTTGCAAAGTAGGGATAGGG - Intergenic
966149394 3:176849919-176849941 TAATTTACAAAGAAGAGAAAGGG + Intergenic
966433099 3:179853435-179853457 TCATCTGCAGAGGAGAGAGAAGG - Intronic
966462620 3:180194158-180194180 TCATCTATAAAGATGAGAAAGGG - Intergenic
967674355 3:192278351-192278373 TCATCTAAAACCTAGAGAAAGGG + Intronic
968013836 3:195308262-195308284 TCATCTTCAAAATAGTGCTATGG + Intronic
969238572 4:5885283-5885305 TCATCTGCACAGTGGGGATAAGG - Intronic
970087030 4:12360957-12360979 TCCTCTAAAAATTAGAAATAGGG + Intergenic
970436452 4:16040224-16040246 TCCTCTACAACTCAGAGATATGG + Intronic
970438128 4:16055446-16055468 TCATCTACAAAATGGAAGTAGGG + Intronic
970676248 4:18453618-18453640 TCATCTGCAAAATGAAGATATGG - Intergenic
970676587 4:18457286-18457308 TTATCTCCAAAGTGGAGTTAAGG + Intergenic
971056412 4:22918176-22918198 TCATCTTCAAAGGAGAAATTTGG + Intergenic
971755595 4:30704045-30704067 TTTTCTACATAGTACAGATAAGG - Intergenic
971849967 4:31972372-31972394 TCTTTTACAAAGTAGATTTAAGG - Intergenic
972590373 4:40480275-40480297 TCATCTATAAAATGGAGATGAGG - Intronic
972733713 4:41819549-41819571 CCACCAACAAAGTAGAGATAAGG + Intergenic
973619291 4:52711641-52711663 TCATCTCCAAATTATAGATGGGG - Intergenic
973937979 4:55870003-55870025 TCATTTAGAAAATAGTGATAAGG + Intronic
974641527 4:64638573-64638595 TCCTTTACAATGTAGAGAAAAGG - Intergenic
976337178 4:83902846-83902868 TGATCAACCAAGTAGAAATAAGG - Intergenic
977654132 4:99502687-99502709 TTATCTACATTGTAGAGATTAGG - Intergenic
978144024 4:105350709-105350731 TCATCTATAAAACAAAGATAAGG - Intergenic
979304130 4:119122657-119122679 TCATCTACATTGTATAGGTAAGG - Intergenic
979403361 4:120278898-120278920 GTATCTAAAAAGTTGAGATAAGG - Intergenic
979722184 4:123913934-123913956 TGATCTACATATTAGAGATGTGG + Intergenic
981463822 4:145042567-145042589 ACATCAAAAAAGTAGAGAAAAGG - Intronic
982415282 4:155123968-155123990 TCCTCTAAAAAGGAGAGGTAAGG - Intergenic
983084039 4:163422363-163422385 TCATCTACAAAATGAAGAAATGG + Intergenic
983697725 4:170553406-170553428 TCATCGACTAAGGAGAGCTATGG + Intergenic
983765347 4:171474206-171474228 TCATCTATAGAGTAGTAATAGGG + Intergenic
987765346 5:22220944-22220966 TCATCTACTGTGTAGAGTTATGG + Intronic
988320602 5:29690364-29690386 TCATCTGCAAAGTCCAAATAAGG - Intergenic
989011918 5:36881529-36881551 TTATCTACAATGTACAGATGAGG + Intronic
989647945 5:43656265-43656287 TTTTATAAAAAGTAGAGATAGGG - Intronic
989649843 5:43675026-43675048 TCATCAAGAAAATAGAAATATGG - Intronic
989896840 5:47100495-47100517 TCACCTAAAAAGTAGACAGAAGG - Intergenic
989937871 5:50052634-50052656 TCATATAAAAACTAGACATAAGG + Intergenic
990122525 5:52472356-52472378 TCATGTACATAGTAGACACATGG + Intergenic
991624519 5:68586198-68586220 TCATGTAAAAAGTAGAGATCTGG + Intergenic
991732413 5:69602602-69602624 TCATCTCCATATTACAGATAAGG - Intergenic
991808845 5:70457746-70457768 TCATCTCCATATTACAGATAAGG - Intergenic
991862541 5:71025250-71025272 TCATCTCCATATTACAGATAAGG + Intergenic
993431176 5:87833431-87833453 TCATTTGCAAAGTTGAGATTTGG - Intergenic
993606891 5:90001961-90001983 TCATAAATGAAGTAGAGATAAGG + Intergenic
994132906 5:96250934-96250956 TCATGTACAAGGTACAGAAAAGG + Intergenic
996485429 5:124027963-124027985 TCAACTACAAAGTAGTTACACGG + Intergenic
996513408 5:124343123-124343145 TAATCTTGAAAGTAGAGAAAAGG + Intergenic
996515623 5:124366195-124366217 TCAACTCTAAATTAGAGATAAGG + Intergenic
997650668 5:135515936-135515958 TCTCCTCCAAAGAAGAGATAAGG - Intergenic
998621516 5:143799744-143799766 TCAGCTACAAAATTGAGATGTGG + Intergenic
999325233 5:150639628-150639650 TTATCTACAAAATGGGGATAAGG + Intronic
1000487169 5:161861583-161861605 TCAGCTACTAAGTCTAGATATGG - Intronic
1001526644 5:172433747-172433769 TTATCTGAAAAATAGAGATAAGG + Intronic
1002131163 5:177082513-177082535 TCACCTACAAATCAGAGCTAAGG + Intergenic
1003261446 6:4520075-4520097 GCATCTACCTAATAGAGATAGGG - Intergenic
1003327611 6:5104634-5104656 TTTTCTTCAAAGTAGAGAAAGGG - Intronic
1003684448 6:8287427-8287449 TCAAATACAAAATAGAGAGAAGG - Intergenic
1004978719 6:20998005-20998027 TCATCTATAAAATGGAGAGAAGG - Intronic
1005239023 6:23802797-23802819 CCATCTTCTAAGTGGAGATAGGG + Intergenic
1005912635 6:30324857-30324879 TCTACTAAAAAGTAGAGACAGGG + Intergenic
1006443117 6:34064324-34064346 TCATTTATAAATTGGAGATATGG - Intronic
1006858850 6:37156010-37156032 TCATCTGTAAAATAGAGATTAGG + Intergenic
1007112567 6:39321392-39321414 CCATCTACAAAGTGGAGATAGGG + Intronic
1007407224 6:41642079-41642101 CTATCTACAAAGGGGAGATACGG - Intronic
1007541770 6:42652987-42653009 TCAACTACAAAATAAGGATATGG - Intronic
1008619978 6:53262398-53262420 TCAACTATAAAAAAGAGATACGG - Intergenic
1009252699 6:61326797-61326819 TCACCTAAAAAGTAGACAGAGGG + Intergenic
1009257385 6:61428618-61428640 TCACCTAAAAAGTAGACAGAGGG + Intergenic
1010924984 6:81734141-81734163 TTATCAACAAAATAGAAATAAGG - Intronic
1011933787 6:92748447-92748469 ACACCTACGAATTAGAGATATGG + Intergenic
1012154623 6:95802422-95802444 TCATGTAAAAATTAGAGAGAGGG + Intergenic
1012503222 6:99913985-99914007 TCATCTTCAATTTACAGATAAGG + Intergenic
1012651995 6:101765826-101765848 TCATCTAGAAATTAGAAACATGG + Intronic
1012671861 6:102061338-102061360 TCATCTATATAGTACAGATGAGG + Intronic
1012838423 6:104298382-104298404 TATTCTATTAAGTAGAGATAGGG + Intergenic
1013700113 6:112756937-112756959 TCATCTGCAAACTAGAGACTAGG - Intergenic
1014573075 6:123035533-123035555 TATTCTAAAAAGTAGAGATTAGG + Intronic
1015092031 6:129369770-129369792 TCACCTTCAAAGAAAAGATAAGG - Intronic
1015839148 6:137457620-137457642 TCATGTAAAAAGTAGAAATTTGG - Intergenic
1017033644 6:150247530-150247552 TCATTTACAAAGTAATGCTAGGG - Intronic
1017316630 6:153038459-153038481 TCACTTACAAAGTAGCAATACGG - Intronic
1017421110 6:154274203-154274225 TCATCATCAAAGTGGAGAGAAGG - Intronic
1017491098 6:154945613-154945635 TCATCTATAAAATGGAGGTAAGG + Intronic
1017518975 6:155185090-155185112 TCCTGTAGAAAGTAGAGAAAGGG + Intronic
1018368633 6:163147971-163147993 TCTTCTACACAGTAGACATTTGG + Intronic
1022566744 7:31411303-31411325 TCATCTAAAAAATAGATTTAAGG + Intergenic
1022622755 7:32001645-32001667 TCATCTGCAAAATGGAGATAAGG - Intronic
1024017198 7:45327918-45327940 TTATTCTCAAAGTAGAGATAAGG + Intergenic
1024190281 7:46999796-46999818 TCAACTCCAAAGTAGAGATCTGG - Intergenic
1025546908 7:62186230-62186252 TCAGTTAAAAAGTAGAGAGAAGG - Intergenic
1025575710 7:62638654-62638676 TCATATACAAACTAGAAAGAAGG - Intergenic
1026767642 7:73170599-73170621 TCATCTTTAAAATAGGGATAAGG + Intergenic
1027044110 7:74980307-74980329 TCATCTTTAAAATAGGGATAAGG + Intronic
1027079535 7:75222051-75222073 TCATCTTTAAAATAGGGATAAGG - Intergenic
1027191382 7:75997665-75997687 TCATCTTCAAACCAGAGGTAAGG - Intronic
1027299534 7:76816678-76816700 TCATAAACAAAGGAGAAATAAGG - Intergenic
1027441733 7:78226423-78226445 TCAGCTATAAAGTTGAAATAAGG - Intronic
1027927465 7:84485227-84485249 TCATGTACAAAGTAGATATTTGG + Intronic
1029208129 7:98881676-98881698 TTCTCTACAAGGTAGAGAAAAGG - Intronic
1031639691 7:124146028-124146050 TCATCTAGAATGTAAAGATCTGG - Intergenic
1031900495 7:127404533-127404555 TCATATACAGAGTAAAGAAAAGG + Intronic
1032734944 7:134683629-134683651 TCATATACTTAGTAGAGACAGGG - Intergenic
1034564587 7:151903038-151903060 TCTTCTACAGAATAGTGATAAGG - Intergenic
1035521947 8:281888-281910 TCATCTGCAAGGCAGAGATCCGG - Intergenic
1036748772 8:11429834-11429856 TCATCTACAGAAAAGAGATAAGG + Intronic
1041223266 8:55673009-55673031 TCATCTCCAATGTACAGATAGGG + Intergenic
1042011927 8:64256240-64256262 TCATTTACAAGATAGAAATATGG + Intergenic
1043685418 8:83079496-83079518 TCATCTTAAAAGTATAAATAAGG - Intergenic
1043788633 8:84434196-84434218 TCTTTTAAAAAGTAGAGATGAGG - Intronic
1044136271 8:88589993-88590015 TCACCTACTAAATAGAGAAATGG + Intergenic
1044573513 8:93745004-93745026 TCATTGAAAAAGTAAAGATAAGG + Intergenic
1044656049 8:94549771-94549793 TCATCTACATTTTATAGATAAGG - Intronic
1044973198 8:97639646-97639668 GCATACAAAAAGTAGAGATAAGG + Intergenic
1046095216 8:109550386-109550408 TCATCTATAAAATGGATATAAGG + Intronic
1046470358 8:114664712-114664734 TCATTTATAAAGTGAAGATAAGG + Intergenic
1047096277 8:121629500-121629522 TCATCTGCAAAACAGGGATAAGG + Intronic
1047801587 8:128315755-128315777 TGATCTACAAAGTAGAGATTTGG - Intergenic
1047948604 8:129908212-129908234 TCATGTAAAAATTAAAGATAAGG + Intronic
1048117604 8:131542859-131542881 GCACCTGCAATGTAGAGATAAGG - Intergenic
1049173342 8:141175607-141175629 TCATCTGTAAAGTAGGAATAAGG + Intronic
1051074420 9:13213973-13213995 TCACTTACAAAGTTGGGATAAGG - Intronic
1052035203 9:23672707-23672729 TCATCAAAAGAGAAGAGATACGG + Intergenic
1053715347 9:40883493-40883515 TCATATAAAAAGTAGACAAAAGG + Intergenic
1054077208 9:60547270-60547292 TCATATAAAAAGTAGACAAAAGG - Intergenic
1055456352 9:76475800-76475822 TCATCTGAAAAATGGAGATATGG - Intronic
1055922892 9:81480107-81480129 TCATCTACAATGCAGAAATGTGG + Intergenic
1056263340 9:84871683-84871705 TCATTTACAAAGTCCAGAGATGG + Intronic
1056709245 9:88977338-88977360 GCATCTGCAAAGTAGAGCAAAGG + Intergenic
1056820435 9:89837947-89837969 TGATCTATAAAGTAGGCATATGG - Intergenic
1056977084 9:91267811-91267833 GCATTTACAGAGTAGAGAAAAGG - Intronic
1057991832 9:99778493-99778515 TCATCTGCACAGCAGAGAGATGG - Intergenic
1058385850 9:104434944-104434966 TCATCAAATAAGTAGATATACGG + Intergenic
1058668018 9:107338055-107338077 TCATCTGCAAAATAGAGCTGCGG + Intergenic
1060780959 9:126412416-126412438 TCATGTACAAAGGAGAGGAATGG - Intronic
1061547418 9:131312878-131312900 TCATCTGTAAAATAGGGATAAGG - Intergenic
1185632301 X:1524130-1524152 TCATCTGCAATGTAGCGATGGGG + Intronic
1188226751 X:27609146-27609168 TCATCTGTAAAATAGAGATAAGG - Intronic
1188629690 X:32339144-32339166 TCATCTGTACAATAGAGATAAGG - Intronic
1188842117 X:35028977-35028999 TCATGAACAAATCAGAGATAGGG + Intergenic
1194151339 X:90327916-90327938 TCATATGCAAAGAAGAAATAAGG + Intergenic
1194599972 X:95908581-95908603 TCATCTAAAATGTAGAGGTAAGG + Intergenic
1194804184 X:98307012-98307034 TCATTTATAAAACAGAGATAAGG - Intergenic
1194975743 X:100394589-100394611 TTATTTACAAAGGAGAGAAAAGG + Intronic
1195550771 X:106167577-106167599 TGAACAACAAAGTAGAGAAAGGG - Intergenic
1196343895 X:114629444-114629466 TCATGTACAAAGTTGAGGTTTGG - Intronic
1196384473 X:115133926-115133948 ACATGTAGAAAGCAGAGATAGGG + Intronic
1197717728 X:129721558-129721580 TCATCTGCGAAATAGAGACAGGG - Intergenic
1198399576 X:136256101-136256123 TCATATACACAGTTGAGACAAGG + Intronic
1199159521 X:144591910-144591932 CCATCTGCACAATAGAGATAAGG + Intergenic
1199251032 X:145661718-145661740 TCATCTATAAAATAAGGATAAGG + Intergenic
1199703138 X:150400294-150400316 TGATCTAGAAAGTGGAGAAAAGG + Intronic
1200497706 Y:3904670-3904692 TCATATGCAAAGAAGAAATAAGG + Intergenic