ID: 908609185

View in Genome Browser
Species Human (GRCh38)
Location 1:65837021-65837043
Sequence AATATAAACAGATCAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908609183_908609185 5 Left 908609183 1:65836993-65837015 CCATACTTCCTGAGTATAATTTG 0: 1
1: 0
2: 0
3: 28
4: 206
Right 908609185 1:65837021-65837043 AATATAAACAGATCAACTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 220
908609184_908609185 -3 Left 908609184 1:65837001-65837023 CCTGAGTATAATTTGCTCATAAT 0: 1
1: 0
2: 0
3: 21
4: 170
Right 908609185 1:65837021-65837043 AATATAAACAGATCAACTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 220
908609181_908609185 19 Left 908609181 1:65836979-65837001 CCTTTTTACTTCCGCCATACTTC No data
Right 908609185 1:65837021-65837043 AATATAAACAGATCAACTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 220
908609182_908609185 8 Left 908609182 1:65836990-65837012 CCGCCATACTTCCTGAGTATAAT No data
Right 908609185 1:65837021-65837043 AATATAAACAGATCAACTGCTGG 0: 1
1: 0
2: 1
3: 15
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908609185 Original CRISPR AATATAAACAGATCAACTGC TGG Intronic
904887986 1:33756140-33756162 AATATGAACAGATCCATTTCAGG + Intronic
906973381 1:50543034-50543056 AATATAAACAGAATATCTGATGG + Intronic
908609185 1:65837021-65837043 AATATAAACAGATCAACTGCTGG + Intronic
910034487 1:82774905-82774927 ACTATAAACAAATCAATTGTAGG + Intergenic
912208379 1:107532918-107532940 AATAAGAACAGAAAAACTGCAGG - Intergenic
913482933 1:119306561-119306583 AAGATAAACAGATAAACTGATGG - Intergenic
916258299 1:162813291-162813313 AATATAAACAGATACTCTGTTGG - Intergenic
919098911 1:193069563-193069585 AATATAAACAGAGAAATGGCTGG + Exonic
921111242 1:212039354-212039376 AATAAAAACAAATAAACTGGTGG - Intronic
924501320 1:244641170-244641192 AAAATAAACAGTACAAATGCTGG + Intronic
1063237329 10:4130687-4130709 TATGTCAACAGATGAACTGCAGG - Intergenic
1063277656 10:4588381-4588403 ATTATAAACACATCTACTGGAGG + Intergenic
1066658245 10:37714015-37714037 ATTAGAAAGAAATCAACTGCTGG - Intergenic
1066724744 10:38378976-38378998 AATATAAACAGATACTCTGTTGG - Intergenic
1067058466 10:43065609-43065631 AATATAAAAACATCAGATGCAGG - Intergenic
1068068318 10:52162658-52162680 AAAATCAACAGATCAAATTCTGG - Intronic
1068379921 10:56239074-56239096 AATAAAAACAGATTGAGTGCAGG - Intergenic
1068713473 10:60159384-60159406 AATATATACACACCAAATGCTGG + Intronic
1070347159 10:75555733-75555755 AATCAACAGAGATCAACTGCAGG + Intronic
1070897130 10:79994443-79994465 AATAAAAAAAGATGAACAGCTGG - Intergenic
1071362354 10:84861794-84861816 AATAAGAACTGATCAACTTCAGG + Intergenic
1072714622 10:97742172-97742194 AAAATAAACAGGTAAATTGCTGG - Intronic
1073739412 10:106389649-106389671 AATAAAATCAGATCCACTCCTGG + Intergenic
1077693408 11:4370322-4370344 AAGATAAACAGCCCAACTCCTGG - Intergenic
1079714152 11:23723583-23723605 AATATAGAGAGATAAAATGCTGG + Intergenic
1081044264 11:38251509-38251531 AAGATAAACAAATCTCCTGCAGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1083097159 11:60263327-60263349 AATATAAATGGATGAAGTGCAGG + Intergenic
1083648627 11:64187088-64187110 AATTTACAGAGATCAACCGCTGG + Intronic
1087148636 11:94837606-94837628 AACATAAACAGATGCCCTGCAGG - Intronic
1089577558 11:119457150-119457172 AATATACACAAGTCAACTGTGGG + Intergenic
1093899421 12:24612878-24612900 AATACAAGCAAATCAAATGCAGG - Intergenic
1094033775 12:26044491-26044513 AATATAAACAGCTCAACTGTAGG - Intronic
1097601140 12:61694625-61694647 AATAAAAACAGCTTAAGTGCTGG - Intergenic
1099401846 12:82210533-82210555 AAAATAAACAGCTTAAGTGCAGG - Intergenic
1099921887 12:88968767-88968789 AATACAAACATAGCAAATGCAGG - Intergenic
1102342224 12:112131072-112131094 AATATAATTAGAGCAACAGCTGG + Intronic
1103459223 12:121090413-121090435 AATATCAAGAGGTCAATTGCAGG + Intergenic
1105264862 13:18806911-18806933 AATATAAAGACATCCACAGCAGG + Intergenic
1105742076 13:23336992-23337014 TTTATAACCAGATCAACTGTTGG + Exonic
1106343908 13:28857721-28857743 AATATAAACAAATCAAGGTCAGG + Intronic
1106811263 13:33360502-33360524 AATTTAAAAAAATCGACTGCCGG - Intergenic
1106984464 13:35328949-35328971 AAGATAGACAGATCAACGGAAGG + Intronic
1107575309 13:41712956-41712978 AACATAAACATATCAAGTGAGGG - Intronic
1107600550 13:42008233-42008255 AATATAAACAAAAGAACTTCTGG - Intergenic
1108865152 13:54914053-54914075 AAGATAAACAGACCATTTGCTGG + Intergenic
1109322235 13:60825439-60825461 TCTACAAACAGATGAACTGCAGG + Intergenic
1110310060 13:74038532-74038554 AATATATATGGATCAACTTCAGG - Intronic
1110484917 13:76027509-76027531 AATATAAACAGATAAAAAGAAGG - Intergenic
1110636367 13:77770954-77770976 AATATATAAAGATCAAATCCAGG - Intergenic
1114339539 14:21728628-21728650 CTTATAAACAGATAAACTTCAGG + Intergenic
1114467339 14:22932523-22932545 AATATAAATAAATAAAATGCTGG - Intergenic
1116225681 14:42149035-42149057 ATTAAATACAGTTCAACTGCTGG - Intergenic
1116423619 14:44763007-44763029 TATATAAGCAGATTAACTGATGG - Intergenic
1117080355 14:52145382-52145404 CATATACAAAAATCAACTGCTGG - Intergenic
1120142395 14:80943370-80943392 GTGATAATCAGATCAACTGCAGG + Intronic
1120457056 14:84744990-84745012 GATCTAAACAGATCAATTGCAGG + Intergenic
1202833597 14_GL000009v2_random:61204-61226 AATATAAAGACATCCACAGCAGG - Intergenic
1126491177 15:49237809-49237831 AATATAAACTGATCAAACACAGG - Intronic
1127665457 15:61141799-61141821 AATACAAACAGGTCGACTGCAGG + Intronic
1127887080 15:63211049-63211071 AATATCAAAAGATAAACAGCAGG + Intronic
1130735121 15:86539925-86539947 AATATCAACAAATCAGCTTCTGG + Intronic
1131434660 15:92413315-92413337 AATGAAAACATATCAACAGCTGG - Intronic
1131704721 15:94980884-94980906 ATTATAAACAGAGCAACTAGAGG - Intergenic
1133583823 16:7172302-7172324 AGTAAAAAGAGATAAACTGCTGG - Intronic
1134288379 16:12882297-12882319 AAAAAAAAAAAATCAACTGCAGG - Intergenic
1135033539 16:19057937-19057959 AAAAAAAAAAAATCAACTGCTGG - Intronic
1137448637 16:48549922-48549944 AAAATAAACAGGGCAAATGCAGG + Intronic
1138774158 16:59700732-59700754 AATAAAAACAAATCTACTGATGG - Intergenic
1140071949 16:71658043-71658065 AATATAAACAGGTTGACTACTGG + Intronic
1140767860 16:78176660-78176682 AAAATAAACAAATGAAATGCAGG + Intronic
1144177811 17:12723980-12724002 AATATGAAAATATCAACTCCAGG + Intronic
1147219772 17:38921588-38921610 CATATAAAAAGATGAACTGGCGG - Exonic
1147838531 17:43353339-43353361 TACATAATCAGATAAACTGCTGG - Intergenic
1148584877 17:48770312-48770334 AAAATAAACAGATTAAGAGCTGG + Intronic
1148654481 17:49272994-49273016 AAAAAAAAAAGATCAACTCCCGG - Intergenic
1148941218 17:51213358-51213380 AATATACAGACATCAACTGAAGG + Intronic
1149051182 17:52307227-52307249 AATATATTAAGATCAACTGAAGG + Intergenic
1149772748 17:59333626-59333648 CATTTAAAAAAATCAACTGCTGG + Intronic
1151636804 17:75354868-75354890 AATAAAAACAGATCTATGGCCGG + Intronic
1156037362 18:32780249-32780271 GATATAAACAGGTCACCTGTAGG - Intergenic
1156193447 18:34746235-34746257 AATAAAAACAAATAATCTGCAGG - Intronic
1159076053 18:63683271-63683293 AGAATACACAGATCAACTGTTGG - Intronic
1159298783 18:66533862-66533884 AATATAAACAAACCACCTACTGG - Intronic
1159426414 18:68293992-68294014 AATACTAACAAATCAAATGCAGG - Intergenic
1159468365 18:68815338-68815360 AATGGACACAGATAAACTGCAGG + Intronic
1159525660 18:69585994-69586016 AATATAGAGAGATCAAGTTCTGG - Intronic
1162523556 19:11195194-11195216 AAAATAAACAGTTTCACTGCCGG + Intronic
1163647267 19:18496498-18496520 AATAAAACCAGGTCAAGTGCAGG + Intronic
1165066017 19:33228623-33228645 AAGATAAACAAATCTACTGGTGG + Intergenic
1166189290 19:41165098-41165120 AAGCTAAACAGAGCAACTGTGGG + Intergenic
1202639072 1_KI270706v1_random:66488-66510 AATATAAAGACATCCACAGCAGG + Intergenic
925662336 2:6215854-6215876 GATATAAACAGCTAAATTGCAGG + Intergenic
925702428 2:6651900-6651922 ACTATAAAGAGATCATCAGCTGG - Intergenic
926970819 2:18465629-18465651 AATATAAAAAGAAAAATTGCTGG + Intergenic
927789670 2:26000535-26000557 AATCTAAACAGAACAACAGCTGG + Intergenic
929718097 2:44334181-44334203 AATATACACAGATACACTGCAGG - Intronic
931203696 2:60126217-60126239 AAAACCAACAGATCAAATGCTGG - Intergenic
932066961 2:68573918-68573940 AATAAAAACAGATAAAAAGCCGG + Intronic
932882323 2:75515056-75515078 AACATAAACAGCTCAAATTCTGG - Intronic
934044163 2:88158109-88158131 AATAAAAACAGATAAATAGCTGG - Intergenic
935253457 2:101286571-101286593 AATATTAACAGATCATCTTGCGG + Intronic
935866839 2:107396916-107396938 AATATAAGCAAATAAACTACAGG - Intergenic
938395381 2:130942509-130942531 AACACAAAAAGATCAACTGCAGG + Intronic
939341931 2:140907569-140907591 CAAATAATCAGTTCAACTGCGGG + Intronic
941199492 2:162491271-162491293 AAAATAAACAGTTTAAGTGCAGG - Intronic
941415017 2:165209219-165209241 GATATATACAGATCAAATCCTGG - Intergenic
942502109 2:176602368-176602390 GAGATAAACAGATCAACTGAGGG - Intergenic
944699756 2:202236414-202236436 AATAAAAACAGCTAAACAGCTGG + Intronic
945180512 2:207086668-207086690 AATCCAAATACATCAACTGCTGG + Intronic
947285906 2:228513932-228513954 AATATATTCAGATCACCTGTTGG - Intergenic
1169832017 20:9835962-9835984 AACATCAACAAATCAACTGGGGG + Intronic
1169869150 20:10232920-10232942 AAAATAAAGGGATCAAGTGCTGG - Intronic
1170523669 20:17215106-17215128 AATATTCTCAGATCAATTGCTGG + Intergenic
1170997145 20:21373302-21373324 AATGAAAACAGATGAACTGCTGG - Intronic
1171885680 20:30650679-30650701 AATATAAAGACATCCACAGCAGG + Intergenic
1174934260 20:54850615-54850637 AATAGAATCAAAACAACTGCTGG - Intergenic
1177723589 21:24939075-24939097 AATGTAAACTGAGCAAATGCGGG + Intergenic
1178412142 21:32373526-32373548 AAAAGAAACAGATCAAATGAGGG + Intronic
1180362876 22:11915375-11915397 AATATAAAGACATCTACAGCAGG - Intergenic
1182390972 22:29995767-29995789 AACACAAACAGATCTATTGCTGG - Intronic
949488016 3:4559486-4559508 AATTTAAACATCTCAAATGCAGG + Intronic
949650564 3:6154232-6154254 TATATAAACAGCTAAACAGCTGG + Intergenic
950351493 3:12358040-12358062 AATATAAACAAACCAAGTACTGG + Intronic
950904045 3:16521486-16521508 AATATATACACATCAGCTCCTGG - Intergenic
951817994 3:26776625-26776647 AAAATAAACAGATGATCTACAGG + Intergenic
952086205 3:29824659-29824681 AATATCAACACATCTACTGATGG + Intronic
959078190 3:101773259-101773281 AATATAAACAAATCAATCACTGG - Intergenic
959775585 3:110158023-110158045 AATAGAAACAAGTAAACTGCAGG + Intergenic
962716682 3:138132683-138132705 AAGCTAAACTGATCAAGTGCAGG - Intergenic
966656785 3:182367574-182367596 AATATCGACAGATAAAATGCAGG + Intergenic
968052147 3:195662465-195662487 AAGATAAAAGGAGCAACTGCTGG - Intergenic
968103665 3:195985873-195985895 AAGATAAAAGGAGCAACTGCTGG + Intergenic
968113566 3:196070631-196070653 AATTTAAAAAGATCAAGGGCTGG + Intronic
968301966 3:197623466-197623488 AAGATAAAAGGAGCAACTGCTGG + Intergenic
971124337 4:23736291-23736313 AAAATAACCAGATCAAATACAGG + Intergenic
978461150 4:108953860-108953882 AATACAAACAAAACAACTGTAGG + Intronic
978560369 4:110027611-110027633 TTTAAAAAAAGATCAACTGCAGG - Intergenic
978567583 4:110100395-110100417 AAAATAAAGAGAAAAACTGCAGG + Intronic
978638831 4:110844153-110844175 AATATAAACTGAGCACCTGCTGG - Intergenic
981799852 4:148642817-148642839 AATATCGACAGATATACTGCAGG + Intergenic
982522383 4:156434768-156434790 AATATAAACAGATTAGCTAAAGG + Intergenic
982977426 4:162082684-162082706 AATATCAACACATCAACTTGTGG + Intronic
983908366 4:173208139-173208161 AATAAAAACAAAACAACTGGGGG - Intronic
984858340 4:184215080-184215102 AATAAAATGAGATGAACTGCCGG - Intronic
1202766421 4_GL000008v2_random:152346-152368 AATATAAAGACATCCACAGCAGG + Intergenic
985498356 5:224254-224276 AAGATAAAAGGAGCAACTGCTGG - Intronic
987601248 5:20074189-20074211 CATATAGACAGATATACTGCTGG + Intronic
987883285 5:23777498-23777520 AATACAATAAGGTCAACTGCAGG + Intergenic
987926434 5:24348491-24348513 AAAATAAACAGACCAAATGGAGG - Intergenic
990946333 5:61253534-61253556 AATTTAACCAGTTGAACTGCAGG + Intergenic
991447965 5:66720654-66720676 AATATAAACAGTGGAACAGCTGG - Intronic
993257555 5:85612279-85612301 AATATCAAGATATCAAGTGCTGG + Intergenic
994018223 5:94993518-94993540 AATATAAACAAATCATCTCTTGG - Intronic
995575958 5:113534227-113534249 AATATAATCACATTAAATGCTGG - Intronic
996490532 5:124089476-124089498 TATATAAACAGATAAAAAGCTGG + Intergenic
996551747 5:124737793-124737815 ATTACAAACAGCCCAACTGCTGG + Intronic
996644091 5:125793765-125793787 AATACAATTAAATCAACTGCAGG + Intergenic
996877873 5:128259884-128259906 ACTAGAAAGAGATCAGCTGCAGG + Intronic
997290738 5:132732113-132732135 AATATACAAAAATCAACTGTGGG + Intronic
998030775 5:138865777-138865799 GATATAAAAAGATCAAAAGCAGG - Intronic
999117730 5:149178424-149178446 AATATAAACAGTGGAACTTCTGG - Intronic
999245803 5:150154063-150154085 AACATAAACAGATCACCAACAGG + Intronic
999819218 5:155208333-155208355 AATAAAAACAGATAAATAGCTGG + Intergenic
1000731873 5:164844782-164844804 AATAAAAACAGTTCTACTACAGG + Intergenic
1000761238 5:165227348-165227370 GATACAATCAGATCAACAGCTGG - Intergenic
1000822081 5:165997394-165997416 AATACAAACAAAACAACTTCAGG - Intergenic
1001683556 5:173576190-173576212 AAGATCAACAGGTAAACTGCAGG + Intergenic
1002381679 5:178833990-178834012 AATATAAATAGATCTACAGAAGG - Intergenic
1003495408 6:6659139-6659161 TATCTCAACAGTTCAACTGCAGG + Intergenic
1004421562 6:15475043-15475065 AATAAATACAGATCAAATGTTGG + Intronic
1005627270 6:27674968-27674990 AATATAAACAGATGTTCTGTTGG - Intergenic
1012901476 6:105011857-105011879 AAAATAAACAAATAAACTGCCGG + Intronic
1013190166 6:107795998-107796020 AATAAAAAGAAATGAACTGCTGG - Intronic
1013721104 6:113028777-113028799 AATAAAAACAGATAAATAGCTGG + Intergenic
1014823645 6:126022373-126022395 TATAAAAACAAATCAAATGCAGG - Intronic
1015021651 6:128483103-128483125 AAAATAAATAGATAAATTGCTGG - Intronic
1017648903 6:156563347-156563369 AAAAAAAACAGATCCACAGCCGG + Intergenic
1018386899 6:163312603-163312625 AATATAAACAGAAAAACCGGTGG + Intronic
1019808071 7:3143400-3143422 AATATAAAAACATGAAATGCTGG + Intronic
1021396248 7:20152165-20152187 AAGCGAAACAGCTCAACTGCAGG + Intronic
1021554068 7:21901967-21901989 AAGATAGATAGATCAAGTGCAGG + Exonic
1024116858 7:46202553-46202575 AATTCAATCAGATAAACTGCGGG + Intergenic
1028192832 7:87872659-87872681 AAGATAAACAAATTAAATGCAGG + Intronic
1028912215 7:96221380-96221402 AATAAAATCAAATCTACTGCAGG + Intronic
1029515738 7:101021920-101021942 AATATAACCAGGTGATCTGCAGG - Intronic
1029778988 7:102711470-102711492 AATATAACCAGAAGAATTGCTGG - Intergenic
1030081219 7:105780167-105780189 AAAATAAAAAGAACAATTGCAGG + Intronic
1030543263 7:110860120-110860142 AGAATAAACAAATCAACTGTGGG + Intronic
1031412864 7:121460856-121460878 AATAAAAACAGATCTACTCCCGG - Intergenic
1032099949 7:128966985-128967007 AATATAGACAGATCTCCTGACGG + Intronic
1033896591 7:146079086-146079108 AAAATAAATAGATCAACAGAAGG + Intergenic
1035406605 7:158602719-158602741 AATATAACCAGAGCAACTCCAGG + Intergenic
1038137063 8:24798274-24798296 AATATAAACAAATCTACTCCAGG - Intergenic
1041157402 8:55002785-55002807 TTTATAAACAGATCATCTGAAGG + Intergenic
1042697352 8:71569868-71569890 AAGACAAACAGATCCACTGAAGG + Intronic
1043415826 8:80048082-80048104 AATATAAGCATATCACCTGAGGG + Intronic
1043920456 8:85977047-85977069 AATATACACTGATTCACTGCAGG + Intergenic
1045794950 8:106031965-106031987 AATAAAAACAGAACATTTGCAGG + Intergenic
1046178404 8:110609908-110609930 ACTAGAAACAGATGAACTGAGGG + Intergenic
1046219735 8:111198549-111198571 ATTAGAAACTGATCAACTGGGGG + Intergenic
1047024924 8:120813891-120813913 AATCAAAACAGATCCACTCCTGG + Intergenic
1048752111 8:137690293-137690315 AATAAAAAAAGTTCAACTACTGG - Intergenic
1048815546 8:138330492-138330514 AATAAAAATAGTACAACTGCTGG + Intronic
1050272859 9:3964598-3964620 AATATAGAAATATCATCTGCTGG - Intronic
1051038967 9:12783330-12783352 CATATAAACAGACCTACAGCTGG - Intronic
1051541072 9:18217995-18218017 AATATTAACAGATTAATAGCTGG - Intergenic
1051848391 9:21479041-21479063 AAGGTAAACAGATCAACCCCTGG + Intergenic
1052180163 9:25516857-25516879 AATTTAATCAGATCATCTGCAGG + Intergenic
1053410525 9:37913643-37913665 CATGTAAACAGATAAACGGCAGG - Intronic
1053498608 9:38567016-38567038 AATATAAAGACATCCACAGCAGG + Intronic
1055685107 9:78764812-78764834 ATTTTAAAAAGATCAAATGCTGG + Intergenic
1056485363 9:87051600-87051622 AATATAAACAAGTCAAGTGGTGG + Intergenic
1056772545 9:89490283-89490305 AATAAAAAGACATCAAGTGCCGG + Intronic
1057161667 9:92893311-92893333 AATATAAAGACATCCACAGCAGG + Intergenic
1057499827 9:95587965-95587987 AAAATAAACATAGCAACTGAAGG - Intergenic
1058188381 9:101883415-101883437 AATATATACAGATAGACTGGAGG + Intergenic
1058369521 9:104248908-104248930 AATATAAACAGCTCACATCCAGG + Intergenic
1059056893 9:110992651-110992673 AATAAAAACAAATGAACTACTGG + Intronic
1060965435 9:127709969-127709991 AATATATACAGTCCAGCTGCTGG + Intronic
1203547177 Un_KI270743v1:137236-137258 AATATAAAGACATCCACAGCAGG + Intergenic
1186565019 X:10653026-10653048 AATATAAACTGAACAAGGGCAGG + Intronic
1186577564 X:10782635-10782657 AATATAATCAGAACAAATGTGGG - Intronic
1186635409 X:11398821-11398843 CATAAAACCAGATTAACTGCAGG + Intronic
1188891760 X:35619878-35619900 AATATAAAAAAATCAGTTGCCGG - Intergenic
1190623912 X:52317512-52317534 AATATAAACTGAACAAAGGCAGG - Intergenic
1191183824 X:57589453-57589475 AATATACAAACATCAATTGCAGG + Intergenic
1193011798 X:76684289-76684311 AATATGAAGAGATAATCTGCAGG - Intergenic
1193254234 X:79327328-79327350 AAAATAAACAGATCAAAAGGTGG - Intergenic
1193305993 X:79952443-79952465 AATATATACACATCCAATGCTGG + Intergenic
1195403890 X:104491974-104491996 AATATAAACAGATGCACTGGAGG - Intergenic
1198700010 X:139386561-139386583 AATTGAAACATATCAATTGCTGG - Intergenic
1199107351 X:143885869-143885891 AATATAAAAAAATCTATTGCTGG - Intergenic
1199178616 X:144824415-144824437 AATACATACAGATCAACTTTAGG + Intergenic
1200626613 Y:5525085-5525107 AGTATAATCAGATAAACTGAAGG + Intronic
1201334651 Y:12867865-12867887 AAAATAAACTGATAAACTGATGG - Intergenic
1201556581 Y:15269339-15269361 AATAAAAACAGGTGAACTCCTGG + Intergenic