ID: 908609552

View in Genome Browser
Species Human (GRCh38)
Location 1:65841988-65842010
Sequence TAATATTTCTAATTAGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 1, 2: 5, 3: 55, 4: 598}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908609552_908609553 12 Left 908609552 1:65841988-65842010 CCATTATCTAATTAGAAATATTA 0: 1
1: 1
2: 5
3: 55
4: 598
Right 908609553 1:65842023-65842045 CTTTCCCTTCGATGTAGTCATGG 0: 1
1: 0
2: 1
3: 5
4: 80
908609552_908609554 15 Left 908609552 1:65841988-65842010 CCATTATCTAATTAGAAATATTA 0: 1
1: 1
2: 5
3: 55
4: 598
Right 908609554 1:65842026-65842048 TCCCTTCGATGTAGTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908609552 Original CRISPR TAATATTTCTAATTAGATAA TGG (reversed) Intronic