ID: 908609552 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:65841988-65842010 |
| Sequence | TAATATTTCTAATTAGATAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 660 | |||
| Summary | {0: 1, 1: 1, 2: 5, 3: 55, 4: 598} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 908609552_908609553 | 12 | Left | 908609552 | 1:65841988-65842010 | CCATTATCTAATTAGAAATATTA | 0: 1 1: 1 2: 5 3: 55 4: 598 |
||
| Right | 908609553 | 1:65842023-65842045 | CTTTCCCTTCGATGTAGTCATGG | 0: 1 1: 0 2: 1 3: 5 4: 80 |
||||
| 908609552_908609554 | 15 | Left | 908609552 | 1:65841988-65842010 | CCATTATCTAATTAGAAATATTA | 0: 1 1: 1 2: 5 3: 55 4: 598 |
||
| Right | 908609554 | 1:65842026-65842048 | TCCCTTCGATGTAGTCATGGAGG | 0: 1 1: 0 2: 0 3: 7 4: 70 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 908609552 | Original CRISPR | TAATATTTCTAATTAGATAA TGG (reversed) | Intronic | ||