ID: 908609554

View in Genome Browser
Species Human (GRCh38)
Location 1:65842026-65842048
Sequence TCCCTTCGATGTAGTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908609552_908609554 15 Left 908609552 1:65841988-65842010 CCATTATCTAATTAGAAATATTA 0: 1
1: 1
2: 5
3: 55
4: 598
Right 908609554 1:65842026-65842048 TCCCTTCGATGTAGTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908609554 Original CRISPR TCCCTTCGATGTAGTCATGG AGG Intronic