ID: 908609554

View in Genome Browser
Species Human (GRCh38)
Location 1:65842026-65842048
Sequence TCCCTTCGATGTAGTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908609552_908609554 15 Left 908609552 1:65841988-65842010 CCATTATCTAATTAGAAATATTA 0: 1
1: 1
2: 5
3: 55
4: 598
Right 908609554 1:65842026-65842048 TCCCTTCGATGTAGTCATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908609554 Original CRISPR TCCCTTCGATGTAGTCATGG AGG Intronic
908609554 1:65842026-65842048 TCCCTTCGATGTAGTCATGGAGG + Intronic
913597743 1:120394474-120394496 TGCCTTAGATCTAGTCATGTTGG + Intergenic
916312995 1:163417513-163417535 TCCCTGTGAAGAAGTCATGGGGG + Intergenic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
922233418 1:223705369-223705391 TTCCGAGGATGTAGTCATGGTGG - Intronic
1065173678 10:23056447-23056469 TCCCATGGCTGGAGTCATGGCGG + Intergenic
1068539477 10:58274784-58274806 TCCCTTGGATTTTGTGATGGTGG - Intronic
1069569773 10:69487265-69487287 TCCTATCAATGGAGTCATGGAGG + Intronic
1069847161 10:71380267-71380289 TCCCTGCGATGTAGGAATGATGG + Intergenic
1074861592 10:117514244-117514266 TCCCTTCAATGTGGGCATGGCGG + Intergenic
1080099350 11:28441379-28441401 TCCATTCAATGTTGTCATAGAGG - Intergenic
1081620056 11:44614163-44614185 CTCCCTCTATGTAGTCATGGTGG - Intronic
1082005910 11:47418885-47418907 TGCCTTCCATGTAGTCCTCGTGG + Exonic
1085475674 11:76787387-76787409 TCCCTGCGATCATGTCATGGAGG + Intronic
1086431710 11:86742686-86742708 TCCCTTAGAGGGAGGCATGGAGG - Intergenic
1087138535 11:94743452-94743474 TCCCTTGGAAAGAGTCATGGTGG + Intronic
1087273979 11:96141808-96141830 GCCCATCGATGTGGACATGGAGG - Intronic
1087329962 11:96768591-96768613 TCCATTCAATGTAGTACTGGAGG - Intergenic
1091405957 12:209744-209766 TCACTTTGAGGTAGGCATGGTGG - Intronic
1095339784 12:41075770-41075792 TCCACTCCATCTAGTCATGGTGG - Intergenic
1095885826 12:47187401-47187423 TCCCCTTGATGTAGAGATGGGGG - Intronic
1099020574 12:77398984-77399006 TCCCTGAGATGTGGTAATGGTGG + Intergenic
1101264874 12:103073764-103073786 TCCTTTCCATGTAGTCAGGTTGG - Intergenic
1106596829 13:31149883-31149905 TCCACTGGATGTCGTCATGGTGG - Intronic
1112761727 13:102699548-102699570 TCCCTTATAAGTAGGCATGGTGG - Intergenic
1118346255 14:64943292-64943314 TCCCTTTGATTTTGTCCTGGTGG - Intronic
1121731108 14:96187784-96187806 TCCCTCCCATGGAGTCCTGGAGG - Intergenic
1132543134 16:520767-520789 TCCTGTCGATGTAGTCCTGCAGG - Exonic
1133534310 16:6686172-6686194 TCCCTTCGATGTAATCAGACAGG + Intronic
1148235644 17:45967274-45967296 TCCCTTGGAAGTAGTGAAGGAGG - Intronic
1148740061 17:49887642-49887664 TCCCTTTGTGGTAGTGATGGGGG + Intergenic
1155981431 18:32184360-32184382 TGCCTTTGATGTAATCATGAGGG + Intronic
927186291 2:20484873-20484895 TCACTTAGATGGAGTCATGAGGG + Intergenic
927280521 2:21301336-21301358 CTCCTGAGATGTAGTCATGGTGG - Intergenic
933536334 2:83579626-83579648 CCCCTTCTATGTAGTGATAGAGG - Intergenic
934558264 2:95298905-95298927 TCCCATCTCTGTAGTCATGCAGG - Intronic
939387566 2:141520420-141520442 TCCCTGTCATGAAGTCATGGGGG + Intronic
948609950 2:239160557-239160579 TCCCATCAGTGGAGTCATGGGGG + Intronic
1175905760 20:62378580-62378602 TCGCTTCCCTGGAGTCATGGAGG - Intergenic
951933187 3:27992941-27992963 TCCCTTAGAAGAAGGCATGGGGG + Intergenic
953129836 3:40127464-40127486 TCCCTTCTTTGTAGTCAAGTGGG + Intronic
961178979 3:124861252-124861274 TACCTTTGATGTAGTCCTGGAGG - Intronic
962756845 3:138471315-138471337 TCCCTTCTCTGTATTCATGGTGG + Intronic
965433634 3:168620084-168620106 TACCTTGGAGGTGGTCATGGTGG + Intergenic
966094322 3:176180415-176180437 CACATTTGATGTAGTCATGGAGG + Intergenic
967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG + Exonic
970704991 4:18790047-18790069 TCTCTTGGTTGTAGTCACGGAGG - Intergenic
975706953 4:77121172-77121194 TCCCTTCCAAGTGGTAATGGAGG + Intergenic
980845424 4:138318595-138318617 CCCCTTGGAGGTAGTCCTGGTGG - Intergenic
982011878 4:151113441-151113463 TCCCTTCCAGCTAGGCATGGTGG - Intronic
983280009 4:165668644-165668666 TCTCTTCAATGTAGTCACGAGGG - Intergenic
986708717 5:10471958-10471980 GCCATTCGATGAAGACATGGTGG + Intronic
987884684 5:23798889-23798911 TCCCTTGGATCTAATGATGGTGG - Intergenic
993250086 5:85510732-85510754 TCTTTTTGATGTAGTCATGTAGG + Intergenic
1000431566 5:161158807-161158829 CCCCTTCTATGTGGTCTTGGAGG + Intergenic
1005881221 6:30062236-30062258 TGCCCTCGATGTGGTCATGAAGG + Exonic
1007506604 6:42340304-42340326 TCCCTCCAAGGTAGTCTTGGGGG - Intronic
1011921033 6:92577463-92577485 TCCCTGGAATGTAGTCCTGGGGG + Intergenic
1018654702 6:166024317-166024339 TCCCTTCATTGTACTCATGAGGG + Intergenic
1019489827 7:1307135-1307157 TCTCTTCAAAGTAGTCATGGTGG - Intergenic
1026858346 7:73769383-73769405 TCCCTTAGACGTAGTCCTTGCGG + Exonic
1029973421 7:104811486-104811508 TCACTTAGAGCTAGTCATGGTGG - Intronic
1037676380 8:21054325-21054347 TCCCTTGGAAGCAGTCATGTAGG - Intergenic
1039114599 8:34078591-34078613 TCCTTGCCATGTAGTCATGGTGG + Intergenic
1041940037 8:63377082-63377104 TCCCTTAGCTGTAGTTTTGGTGG + Intergenic
1043080809 8:75762964-75762986 TCCCTTCGATGGACTCATTTTGG - Intergenic
1043168432 8:76933963-76933985 TCCCTTCACTGAAGCCATGGGGG + Intergenic
1043285040 8:78517309-78517331 TCCCTTCGCTGTAGTCACTGTGG + Intronic
1044938813 8:97319556-97319578 TCCCATCCATGGAGGCATGGAGG + Intergenic
1047192437 8:122690362-122690384 TCACTCCTTTGTAGTCATGGAGG + Intergenic
1051618378 9:19028062-19028084 TGCCTTCCATGTAGTCCTCGTGG - Intronic
1057310501 9:93940158-93940180 CCCCTACGATGTAGTCCTGAAGG + Intergenic
1057926536 9:99156513-99156535 TCTATTCAATGTTGTCATGGAGG + Intergenic
1061727369 9:132589221-132589243 TCGCTTCCATTTAGTCCTGGGGG - Exonic
1186685273 X:11918942-11918964 TCCCATCCATGTAGACATGGTGG + Intergenic
1190912862 X:54788500-54788522 TCAGTACGATGTGGTCATGGAGG - Exonic
1190918092 X:54824870-54824892 TCAGTACGATGTGGTCATGGAGG + Intergenic
1196371321 X:114982731-114982753 TCCCTTAGATGTACTCATTTGGG - Intergenic