ID: 908615355

View in Genome Browser
Species Human (GRCh38)
Location 1:65914750-65914772
Sequence ATAATCCTGATCCTCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908615350_908615355 27 Left 908615350 1:65914700-65914722 CCTTCCATACGGACAAACCATTA 0: 1
1: 0
2: 0
3: 1
4: 44
Right 908615355 1:65914750-65914772 ATAATCCTGATCCTCCCTGAGGG No data
908615352_908615355 10 Left 908615352 1:65914717-65914739 CCATTAGTTCTTTCTCATTGCAT No data
Right 908615355 1:65914750-65914772 ATAATCCTGATCCTCCCTGAGGG No data
908615351_908615355 23 Left 908615351 1:65914704-65914726 CCATACGGACAAACCATTAGTTC 0: 1
1: 0
2: 1
3: 2
4: 42
Right 908615355 1:65914750-65914772 ATAATCCTGATCCTCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908615355 Original CRISPR ATAATCCTGATCCTCCCTGA GGG Intronic
No off target data available for this crispr