ID: 908616289

View in Genome Browser
Species Human (GRCh38)
Location 1:65926452-65926474
Sequence TCTTAAGTTTGTGCTCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908616287_908616289 16 Left 908616287 1:65926413-65926435 CCTTTAGTACATTCTTAAACTGA 0: 1
1: 0
2: 1
3: 19
4: 219
Right 908616289 1:65926452-65926474 TCTTAAGTTTGTGCTCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908616289 Original CRISPR TCTTAAGTTTGTGCTCCTAA GGG Intronic
No off target data available for this crispr