ID: 908621525

View in Genome Browser
Species Human (GRCh38)
Location 1:65986582-65986604
Sequence CAGAATAAGACAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 763
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 707}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908621525 Original CRISPR CAGAATAAGACAAAGGAGGA GGG (reversed) Intronic
900369737 1:2326351-2326373 CAGCCTAAGAGAAAGGAGGCAGG + Intronic
901320320 1:8335940-8335962 CAGAGCAAGACAAAGTTGGAAGG - Intronic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902731528 1:18373098-18373120 CTGAAAATGACAATGGAGGAGGG - Intronic
902907808 1:19571834-19571856 CATAAGAAGACACAGGAAGAGGG + Intergenic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903352488 1:22726188-22726210 GAGAAGGAGAAAAAGGAGGAAGG - Intronic
903414713 1:23174291-23174313 CAGAACAAAAAAGAGGAGGAAGG - Intronic
904273474 1:29365359-29365381 AAGAAAAAGAAAAAGAAGGAAGG - Intergenic
904583477 1:31565050-31565072 CAGAAGAAAACACAGGAGAATGG + Intergenic
904693265 1:32310902-32310924 GAGAGAAAGACAAAGAAGGAAGG + Intronic
905702374 1:40027226-40027248 CAGACTAAGACAGAGGTGGCAGG + Intergenic
905970292 1:42136753-42136775 GAGAAGGAGAAAAAGGAGGAGGG - Intergenic
906462337 1:46044480-46044502 AAGAATAATAAAAAGAAGGAAGG - Intronic
907231270 1:53001272-53001294 GAGAAAAAGGGAAAGGAGGATGG + Intronic
907288443 1:53397029-53397051 ATGAATAAGACAAAGGAGCCGGG + Intergenic
907812544 1:57885947-57885969 AAGAATAAGATTAAGCAGGAGGG - Intronic
908273377 1:62443086-62443108 GAGACAAAGACAAAGGGGGAAGG + Intronic
908400528 1:63768763-63768785 CAGAGTGAGACAAAGAAGGAGGG - Intergenic
908621525 1:65986582-65986604 CAGAATAAGACAAAGGAGGAGGG - Intronic
908742290 1:67341400-67341422 CAGAGCAAGACAAAGAAGGAAGG + Intronic
909107612 1:71432199-71432221 CAGATTAAGTTAAAGGAAGATGG + Intronic
909176872 1:72371872-72371894 CAGGATAAATCAAAGCAGGAGGG - Intergenic
909192259 1:72568889-72568911 CAGGAAAATACAAAGTAGGAGGG - Intergenic
909591261 1:77351801-77351823 TAGAAGAAGACAAAGGAGAAAGG + Intronic
909799614 1:79789788-79789810 CAGAATGACATAATGGAGGAGGG + Intergenic
909980533 1:82094988-82095010 CAGAAAGAGACAAAGAGGGAAGG + Intergenic
910553833 1:88507597-88507619 CAGCATGGGACAAAGGAGGCAGG - Intergenic
911254139 1:95614825-95614847 AAGAATGAGAGAAGGGAGGAAGG - Intergenic
911384645 1:97159917-97159939 GAGAAGAAGACAAGGAAGGAGGG - Intronic
911557038 1:99356990-99357012 CAGAACAGGAGAAAGGAGCAGGG - Intergenic
911788845 1:101985154-101985176 CAGAATCAGAAAAAGAAGCAAGG - Intronic
912176766 1:107168183-107168205 AAGAAAAAGAGAAAGAAGGAAGG - Intronic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912623117 1:111185731-111185753 CAGAGCAGGACAAAGGAGGAAGG + Intergenic
913944243 1:125142776-125142798 AAGAATGAAAGAAAGGAGGAAGG + Intergenic
915106803 1:153539917-153539939 CAGACAGAGACAAAGGAAGATGG - Intronic
915645589 1:157269757-157269779 CAGAACAAGAGAAGGGAGTATGG + Intergenic
915650545 1:157307403-157307425 CAGGATAGGACAAGAGAGGATGG + Intergenic
915804799 1:158834717-158834739 CAGAATAAAACAAAAGGGAAAGG - Intronic
915864903 1:159488907-159488929 CTGAAGAAGACAAGAGAGGATGG + Intergenic
916062837 1:161112943-161112965 CACAAAAAGACAAAGGAGGGGGG + Intronic
916417221 1:164603094-164603116 CAGAAAAAGCCAAAGGGGTAGGG - Intronic
916802943 1:168231611-168231633 AAGGAAAAGACAGAGGAGGAAGG - Intronic
916821330 1:168401440-168401462 CAGAAGAAGTCAGAGGAGGAGGG - Intergenic
917240094 1:172939068-172939090 CAGAATAAGACAAAGAGGGAAGG - Intergenic
917455782 1:175184409-175184431 GAGAAGAAGACAAGGGAAGAGGG - Intronic
918074337 1:181159186-181159208 CAGAATAAGACAAGGTGGGCTGG - Intergenic
918144452 1:181743284-181743306 AAGAAAAAGATAAAAGAGGAAGG - Intronic
918469600 1:184858237-184858259 GAGAACAAGAAAAAGAAGGAAGG + Intronic
918497231 1:185154654-185154676 CAAAATAAGAGAAAGGAGCTTGG + Intronic
918690516 1:187473405-187473427 CAGATTAAGACCAAGCAGGTGGG + Intergenic
919105309 1:193142627-193142649 GAGAAAGAGAGAAAGGAGGAGGG - Intronic
919169068 1:193931021-193931043 CACAAAAAGACAAAGGAAAATGG - Intergenic
919450867 1:197771932-197771954 CACAATATGACAAAAGTGGAGGG + Intronic
919676385 1:200387718-200387740 CAGAGTAAGAAAAAGGAGATGGG + Intergenic
919851925 1:201678838-201678860 GAGAAAAAGTCGAAGGAGGAAGG + Intronic
920716751 1:208347306-208347328 TAGAATAAGAGAAAGTGGGAGGG - Intergenic
920978559 1:210809432-210809454 AAGAATAAGACAAAGATGTATGG + Intronic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922437348 1:225619579-225619601 CAAAATAAGACTAGGGAGGTGGG - Intronic
923318691 1:232806349-232806371 TAGTGTAATACAAAGGAGGAGGG - Exonic
924016548 1:239731556-239731578 AAGAACAAGAGAAAGGAAGAGGG + Intronic
924456560 1:244223375-244223397 CAGAATGAGACAAGGAAGGATGG - Intergenic
1062988571 10:1793783-1793805 TACAATAAGACAAAAAAGGAAGG - Intergenic
1062991380 10:1822373-1822395 CAGAATATGACACAGGATGAGGG + Intergenic
1063144820 10:3287482-3287504 CAGAACAACGCACAGGAGGAAGG - Intergenic
1063584284 10:7337458-7337480 CATGACAAGACCAAGGAGGATGG - Intronic
1063911648 10:10836212-10836234 AAGAAAAGGAGAAAGGAGGAGGG + Intergenic
1064494232 10:15890976-15890998 GAGACAAAGAAAAAGGAGGAAGG + Intergenic
1065699783 10:28413850-28413872 TAGAATAAAAGAAAGGAGGCCGG + Intergenic
1065794897 10:29297558-29297580 CAGTATGAGACAAAGCAGAATGG - Intronic
1065856106 10:29831672-29831694 CACAATAACACCAAGGAGCATGG + Intergenic
1067395299 10:45910497-45910519 ATGAAAAAGACAAAGGTGGAAGG - Intergenic
1067515907 10:46943366-46943388 CAGTATTAGACAAGGAAGGAAGG + Intronic
1067646343 10:48108444-48108466 CAGTATTAGACAAGGAAGGAAGG - Intergenic
1067863621 10:49879621-49879643 ATGAAAAAGACAAAGGTGGAAGG - Intronic
1068111068 10:52681404-52681426 CAAAACAAAACAAAAGAGGAGGG + Intergenic
1068695071 10:59958985-59959007 CAGATGGAAACAAAGGAGGAAGG - Exonic
1069156547 10:65037221-65037243 TAGAATAAGACAAAGGGAGCTGG + Intergenic
1069369702 10:67734127-67734149 CAGGAAAAGAGAAAAGAGGAAGG - Intergenic
1069374820 10:67783152-67783174 CAGAATAACACAGGAGAGGAGGG - Intergenic
1071033400 10:81212774-81212796 CAGTATTAAGCAAAGGAGGAGGG - Intergenic
1071519519 10:86320488-86320510 CAGAAGGAGAGAAAGGAGAATGG + Intronic
1071663636 10:87531167-87531189 GAGCATGAGACAAAGCAGGACGG - Intronic
1072798840 10:98377797-98377819 CAGAATATGACAAAGGTGAAAGG - Intergenic
1073271230 10:102265935-102265957 CAGTGTAAGACTAAGGTGGAGGG + Intronic
1073609993 10:104933809-104933831 CAGAGTAAGACAAAAAAGGAAGG - Intronic
1074058098 10:109940876-109940898 CAGAATTAGATAGAAGAGGAGGG - Intergenic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1075166390 10:120071731-120071753 CAGACTAATACAGAGGATGAGGG - Intergenic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1076068069 10:127464588-127464610 CAGCAGAAGACAAAAAAGGAAGG + Intergenic
1076182657 10:128422597-128422619 AAGAAGATGACAAAGGGGGATGG + Intergenic
1076547703 10:131256897-131256919 GAGAGAAAGACAAAGAAGGAAGG + Intronic
1077166796 11:1145746-1145768 GTGAATAAGACAAAAGAGGCTGG + Intergenic
1077676102 11:4194060-4194082 CAGAATAAAACAGAGGAGGGAGG - Intergenic
1077955778 11:7019097-7019119 AAGAGGAACACAAAGGAGGAAGG - Intronic
1078127201 11:8579067-8579089 CAGAATAAGAAAAAAGAAAAAGG - Intronic
1078735220 11:14013462-14013484 GGGAATAAAAGAAAGGAGGAGGG + Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079749060 11:24172498-24172520 TAAAACAAGACAAATGAGGATGG - Intergenic
1080474247 11:32574978-32575000 AAGAACAAGAGAAAGGAAGAAGG + Intergenic
1080997506 11:37621797-37621819 TTGAATAAAACAAAGAAGGAAGG - Intergenic
1081353624 11:42086427-42086449 AAGAATAATACAAAGAAGCAAGG - Intergenic
1084790478 11:71472625-71472647 CTGAAACAGACAAAGGAGGCAGG + Intronic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1085498549 11:76995408-76995430 CAGGATAACACAGAGAAGGATGG - Intronic
1085529425 11:77182732-77182754 CACAAGTAGACAAAGGAGGGTGG - Intronic
1085633371 11:78138641-78138663 GAGAAAAAGAAAAAAGAGGAAGG + Intronic
1085807717 11:79651498-79651520 CACAATAAGACAAAGAAGCTGGG - Intergenic
1085879533 11:80449544-80449566 CAGAAAAATACAAACGAGAAAGG - Intergenic
1086364809 11:86098137-86098159 CAGATTAGGAAAAAAGAGGAAGG + Intergenic
1086560099 11:88157419-88157441 CAGTATCAGACAAATGAGCAAGG + Intronic
1086654671 11:89338895-89338917 CAGGTTAGGACAAAGAAGGAAGG - Intronic
1086734967 11:90294863-90294885 CAGAACAAGACAAGGATGGAAGG - Intergenic
1087324885 11:96709679-96709701 AAGAAGAAAAGAAAGGAGGAAGG - Intergenic
1087725947 11:101716682-101716704 CAGACTAAGTCAGAGGGGGAAGG - Intronic
1088581099 11:111317733-111317755 AAGAATTACACAATGGAGGAGGG - Intergenic
1089014715 11:115156605-115156627 CAAAATAAGAGAAGGAAGGAAGG - Intergenic
1089333152 11:117704092-117704114 AAGTATGAGACAAAGAAGGAAGG + Intronic
1089718632 11:120390100-120390122 GCGAATAAAACAAAGGAGTAGGG - Intronic
1089946182 11:122476465-122476487 TAAAATAAAATAAAGGAGGAAGG + Intergenic
1090484096 11:127096646-127096668 CAGAATGAGGGAAAAGAGGAAGG + Intergenic
1090981182 11:131724052-131724074 CAGAACAAGTCAGAGGAGGGAGG + Intronic
1091182637 11:133620581-133620603 CAGTAAAGGAGAAAGGAGGAAGG + Intergenic
1091467527 12:698217-698239 CAGAAGAGGACAAAGGAAGGAGG - Intergenic
1091613809 12:2033928-2033950 CAGAGAAAGACAGAGGAGCATGG + Intronic
1091880333 12:3972127-3972149 ATAAATAAGACAAAGGAGGCCGG - Intergenic
1092121244 12:6045522-6045544 CAGAAGAAGACACAGAAGGATGG + Intronic
1092457199 12:8654537-8654559 CAGAGTAAGAAAAGGGAGAATGG + Intronic
1092551119 12:9501291-9501313 CCGAAAAAGAAAAAGAAGGAAGG - Intergenic
1092601805 12:10074593-10074615 GAGAATAAGAAAAATTAGGAGGG + Intronic
1092747795 12:11689821-11689843 GAGAAAAAGACAAAGGGGGGTGG - Intronic
1093161052 12:15746995-15747017 CAGAAAAAGGCAAAGAAGAAAGG - Intronic
1093521030 12:20050269-20050291 CAAAATAAAACAAAACAGGAAGG + Intergenic
1093999926 12:25684011-25684033 CAGAACCAGACAGAGGAAGAGGG - Intergenic
1094217519 12:27959947-27959969 AAGAATAACACAAAGAGGGAAGG + Intronic
1094296048 12:28906563-28906585 AATAATAACTCAAAGGAGGAAGG + Intergenic
1094520685 12:31185065-31185087 CCGAAAAAGAAAAAGAAGGAAGG + Intergenic
1095504160 12:42875063-42875085 TAGAAGAAAACAAAGGAGAAAGG - Intergenic
1096606509 12:52770092-52770114 AAGAATAAGACACAGGAAGATGG - Intronic
1096828873 12:54299554-54299576 CAGGCTAAGAGTAAGGAGGATGG - Intronic
1097008804 12:55938110-55938132 AGGAATAAGGGAAAGGAGGATGG - Intronic
1097604484 12:61735638-61735660 CAAAAGAAGGCAAAAGAGGAGGG - Intronic
1098351615 12:69568016-69568038 CAATATATGAAAAAGGAGGAGGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098855446 12:75647754-75647776 CAGAGCAAGACAAATGAGAAAGG - Intergenic
1099537817 12:83866512-83866534 CAACATAAGAAATAGGAGGATGG - Intergenic
1099619367 12:84981611-84981633 CAGAATAACACAGAGGAAGAAGG - Intergenic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1099740300 12:86626533-86626555 CAGATTAAGATAAAAGAGAATGG + Intronic
1099924644 12:89002509-89002531 AGAAATGAGACAAAGGAGGATGG + Intergenic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1100872135 12:98921154-98921176 AAGAAGAAAAGAAAGGAGGAAGG - Intronic
1102231852 12:111268091-111268113 CATTATAAGAGAAAGGAGGTTGG - Intronic
1102413792 12:112743056-112743078 CTGAATAAGACAGAGGCAGAGGG - Intronic
1103194683 12:119033139-119033161 AAAATTAAAACAAAGGAGGAAGG - Intronic
1103204787 12:119120135-119120157 GAGAAGGAGAGAAAGGAGGAAGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103995927 12:124830046-124830068 CAGAATAGGAGATAGGAGAAAGG + Intronic
1104006147 12:124893940-124893962 AAGAAAAAGAAAAAGCAGGAAGG + Intergenic
1104085180 12:125467760-125467782 GAGAATATGAGAAAGGAGAATGG - Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104373548 12:128244762-128244784 CAGAATGAGACAAAAAAGGTAGG - Intergenic
1106225828 13:27786314-27786336 GGGATTAAGCCAAAGGAGGAGGG - Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1107174482 13:37384642-37384664 CAGAAGATGAGAAAGGAGGTTGG + Intergenic
1107411929 13:40165992-40166014 AAGAAAAGGACAAAGGAGTAAGG + Intergenic
1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG + Intergenic
1107680403 13:42842833-42842855 CAGAAGACACCAAAGGAGGACGG - Intergenic
1107718820 13:43227106-43227128 TAGAACAAGTCAGAGGAGGATGG + Intronic
1107857433 13:44629919-44629941 CAGAAGAAGACAAGGGATGTAGG + Intergenic
1107956206 13:45514532-45514554 CAGAATTAGATAAAAGAGGATGG - Intronic
1108149582 13:47519468-47519490 CAGAAGAAGTCAAATGAGAATGG - Intergenic
1108381211 13:49856294-49856316 CAGGATAAGACAATGGCTGAAGG - Intergenic
1108386313 13:49902316-49902338 CAGAATAAAAGATAGGAGAAGGG + Intergenic
1108979205 13:56489414-56489436 CAGAAAAAAAAAAAGGAGAAAGG - Intergenic
1110139301 13:72107734-72107756 CAGACTGAGACATAAGAGGATGG - Intergenic
1110150629 13:72248718-72248740 CAGAATAAGAGGAAAAAGGATGG + Intergenic
1110286563 13:73756480-73756502 AAGAGTAAGACCAAGGAGAAAGG + Intronic
1110744428 13:79036360-79036382 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1111161120 13:84396088-84396110 CAGAATCTGAAAAAGGAGGTAGG + Intergenic
1111424426 13:88060547-88060569 CAGAAGAAGAAAATGGAAGAGGG - Intergenic
1111846973 13:93522904-93522926 CTGAAGGAGACAAAGGTGGAGGG + Intronic
1112047991 13:95616792-95616814 CAGAATACGGCAAAGGTGAAGGG + Intronic
1112643175 13:101300331-101300353 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1112753552 13:102606020-102606042 TAGAATAAGACAAAGCTGGTAGG - Intronic
1113149466 13:107246054-107246076 CAGAATGAGATAGAGGAGGGTGG - Intronic
1113481521 13:110625444-110625466 CAGAATAAGACAGAGACGGCGGG + Intronic
1113598850 13:111554212-111554234 CAGAATATGTCAAAGAAGGCTGG - Intergenic
1114920083 14:27315276-27315298 AGGAATAAGACAAATGAGAAAGG + Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115261822 14:31462128-31462150 CAGAATAGGATATAGAAGGATGG + Intergenic
1115467110 14:33727623-33727645 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1116095017 14:40356634-40356656 CAAAATAAGACAAAGTGAGACGG - Intergenic
1116368143 14:44095069-44095091 CAAAAGAAGAGAAAAGAGGAAGG + Intergenic
1116529891 14:45957096-45957118 CAGGAGAAGACAAAGGATAAGGG + Intergenic
1117008024 14:51442294-51442316 AAGAGAAAGAGAAAGGAGGAGGG - Intergenic
1117149995 14:52876677-52876699 CAGAATAATACAAAACAAGAAGG - Intronic
1117419594 14:55531046-55531068 AAGATTGAGACAGAGGAGGAAGG + Intergenic
1117484616 14:56181716-56181738 CAGGCTAAGTCAAATGAGGATGG + Intronic
1118416627 14:65544127-65544149 AAGAATGAGCCAAAGGTGGAAGG + Intronic
1118621210 14:67615776-67615798 CAGAACAAGAAAAAGGCTGAAGG - Intergenic
1119031437 14:71195927-71195949 CAAAAGAAGCCACAGGAGGAAGG - Intergenic
1119431889 14:74573825-74573847 CAGAATAACACAAAGGAATGTGG - Intronic
1119965377 14:78909577-78909599 CAGAAGAAGTCAAATCAGGATGG - Intronic
1120060323 14:79975209-79975231 TCTAATAAGTCAAAGGAGGAAGG - Intergenic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120322241 14:82978778-82978800 CAGAAAGAGACACAGGTGGAGGG + Intergenic
1120771925 14:88388484-88388506 CAGAATGAGCCAAAGGGGCATGG - Intronic
1121067660 14:90983644-90983666 AAGAAAAAGAAAAAGGAAGAAGG + Intronic
1121476400 14:94210749-94210771 AAGAATAAGGCAAATGAGAAGGG + Intronic
1122570170 14:102692748-102692770 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1123894590 15:24816006-24816028 GGGAATAAGGCAAAGGAGAAGGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1125057654 15:35381419-35381441 AAGAAAAAGAAAAAAGAGGAAGG + Intronic
1125543024 15:40482569-40482591 AAGAAGAAAACATAGGAGGAAGG - Intergenic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126392628 15:48176486-48176508 CAGGAAAAGAGAAAGGAGAAAGG - Intronic
1126402134 15:48282849-48282871 AATAATAAGCCACAGGAGGAAGG + Intronic
1126421343 15:48476465-48476487 CAGAAGAAGACAAAGAAGTTGGG + Intronic
1127267530 15:57374110-57374132 AAGAAAAAGAGAAAGGAGGGAGG - Intergenic
1127534981 15:59881735-59881757 CAGAATCGGGCAAAGGAGAAAGG - Intergenic
1127852530 15:62926396-62926418 CAGAAGAAGACAAAGGCAGTAGG - Intergenic
1128593133 15:68920456-68920478 CAGAGTAAGAGTAAGGAGTAAGG + Intronic
1128629373 15:69248133-69248155 CACAATAAGGCAAAACAGGAAGG - Intronic
1129009845 15:72405606-72405628 CAGAATAAAAAAAAAGTGGAGGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130551449 15:84892215-84892237 TAAAAAAAGAAAAAGGAGGATGG + Intronic
1130735028 15:86538903-86538925 TAGAATGGGACCAAGGAGGAAGG + Intronic
1130813519 15:87406717-87406739 GAGAATAAAACAAAGAGGGAGGG + Intergenic
1132023509 15:98384954-98384976 AAGAATGAGAGAAAGAAGGAAGG + Intergenic
1132334980 15:101042519-101042541 CAGTAAAAGCCACAGGAGGATGG - Intronic
1133084808 16:3353800-3353822 CAAAAAAAGAGAAAGAAGGAAGG + Intergenic
1133440908 16:5820252-5820274 CTGAATAAGACAATGTAGCATGG - Intergenic
1134188762 16:12105240-12105262 CAGAGTGAGACAATGAAGGAAGG - Intronic
1134291726 16:12907069-12907091 AAGGAAAAAACAAAGGAGGAAGG - Intronic
1134316956 16:13127402-13127424 GAGAAGGAGACAGAGGAGGAGGG + Intronic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1134671246 16:16056742-16056764 GTGAATAAAACAAAGGAGAATGG - Intronic
1135485337 16:22860094-22860116 CAGACTAATACAAGGGAAGAGGG - Intronic
1135622941 16:23971437-23971459 CAGAGTAGGACAAAGAAGGCAGG - Intronic
1135850704 16:25960486-25960508 CTCAATAAAACAAATGAGGAAGG + Intronic
1135888067 16:26331141-26331163 AACAATAAGACAATGGAGAAAGG + Intergenic
1137417906 16:48301924-48301946 CAGAAGAAGACTAATCAGGAGGG - Intronic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1138101645 16:54256661-54256683 GAGGATTAGAGAAAGGAGGAGGG - Intronic
1138367379 16:56491416-56491438 CAGAAAAGGTCAAAGGAGAAGGG - Intronic
1138943869 16:61823589-61823611 CAGAAAAAAACATTGGAGGAAGG + Intronic
1139263827 16:65621492-65621514 AAGAATCAGACTAAGAAGGAAGG + Intergenic
1139275855 16:65727049-65727071 CAGAGAAAGATAAAGGAGAAAGG - Intergenic
1139362514 16:66409596-66409618 CAGAAGAAAAGAAAGAAGGAAGG + Intergenic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140300412 16:73752063-73752085 GAGAAAGAGAGAAAGGAGGATGG + Intergenic
1140422202 16:74829545-74829567 AATAATGACACAAAGGAGGAAGG + Intergenic
1140805722 16:78530418-78530440 AAAAAGAAGACAAAGCAGGAAGG + Intronic
1140903589 16:79392214-79392236 AAGAAAAAGAGAAAGAAGGAGGG + Intergenic
1141078685 16:81032077-81032099 AAGAATAAGACAAGGTTGGAGGG - Intronic
1141325569 16:83055446-83055468 AAGAATAAGAAAAAAGAAGAAGG + Intronic
1141514690 16:84535947-84535969 CTGACAAAGACAAAGGAAGATGG - Intronic
1141541316 16:84724628-84724650 CAGAAGCAGACAAAGGAAGAAGG - Intronic
1141756249 16:85993025-85993047 CAGAAGGACAGAAAGGAGGAAGG - Intergenic
1141967040 16:87452671-87452693 CAGAAGCAGCCAAGGGAGGATGG + Intronic
1143240345 17:5438602-5438624 TAGAATAAGACTAAGGAAAAAGG + Intronic
1143325058 17:6093284-6093306 CTGAATGAGATAAAGCAGGAAGG - Intronic
1143725629 17:8843322-8843344 CAGAATAAGAAAGAGGAAGAAGG - Intronic
1143965763 17:10755667-10755689 GAGAAAGAGACAGAGGAGGAGGG - Intergenic
1144741624 17:17586176-17586198 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1145402223 17:22551212-22551234 GAGAAAAAGAGAAAGAAGGAAGG + Intergenic
1145978302 17:28996900-28996922 CTGAAAGAGACAAGGGAGGAGGG - Intronic
1146910742 17:36646859-36646881 AAGAATAGGAGAAAGGAGGCAGG + Intergenic
1147765701 17:42834095-42834117 CAGCTTCAGACACAGGAGGAAGG + Intronic
1148160097 17:45444792-45444814 CAGAGGAGGACAAAGCAGGAAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148688968 17:49515774-49515796 CAGAGTCAGACAAGGGTGGAGGG + Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149501202 17:57153752-57153774 GAGAAAGAGACAGAGGAGGAGGG - Intergenic
1149687839 17:58548089-58548111 CAAAAGAAGAGTAAGGAGGAGGG - Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150391387 17:64791671-64791693 CAGAGGAGGACAAAGCAGGAAGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150924145 17:69514988-69515010 CAGAAAAAGGCAAAGGAAAATGG - Intronic
1151357605 17:73569847-73569869 CAGGAAAAGACAAGGAAGGAAGG - Intronic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1152128227 17:78460148-78460170 CTGAATAAGGTAAAGGGGGAGGG - Exonic
1152991545 18:367946-367968 CAAAACTAGACAAAGGGGGATGG + Intronic
1153373358 18:4346061-4346083 CAGAAGGGGACAAAGAAGGAAGG + Intronic
1154350594 18:13580141-13580163 CAGAATAAAACACAGGAAGTGGG - Intronic
1155043112 18:22081775-22081797 CTGACTAAGACAAAGGACTAGGG - Intergenic
1155456112 18:26015864-26015886 GAGAATAAGACAACAGAAGATGG + Intergenic
1155570094 18:27184279-27184301 CAGAGAGAGAGAAAGGAGGAAGG + Intronic
1155854828 18:30820096-30820118 CAGAAGAAGCCAAATCAGGACGG - Intergenic
1156082818 18:33359754-33359776 CAAATGAAAACAAAGGAGGAGGG + Intronic
1156099017 18:33571484-33571506 TAGAATAAAAGAAAGGAGAATGG + Intergenic
1156493825 18:37512744-37512766 AAGAAAAAGAGAAAGCAGGAGGG - Intronic
1156579541 18:38359103-38359125 GAGATTAAGACAGAGGAAGAAGG + Intergenic
1156753741 18:40494699-40494721 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1156826332 18:41434426-41434448 CAGAGTAAGACAAGGGAGTGGGG + Intergenic
1157273473 18:46294128-46294150 CAGCTTCAGACAAAGGAGGGTGG - Intergenic
1157448936 18:47771334-47771356 CAGAAAGACACAAAGGAGCAAGG - Intergenic
1157803696 18:50642445-50642467 TAAAATAAGATAAAGGAAGAAGG - Intronic
1157829741 18:50846273-50846295 GAGAAAAAGAAAAAGAAGGAAGG - Intergenic
1158238542 18:55349546-55349568 AAGAATGAAAAAAAGGAGGAAGG + Intronic
1158369893 18:56788611-56788633 CAGAATACCACAAAGGAGATAGG - Intronic
1158762249 18:60403630-60403652 CAGAGTAAAACAAGAGAGGAGGG - Intergenic
1158816286 18:61100976-61100998 CAGAATAAGGCATATGAGGAAGG + Intergenic
1158867190 18:61649179-61649201 CAGAGCATGACAGAGGAGGATGG - Intergenic
1159038322 18:63298585-63298607 CAGAGAAGGACAAAGGTGGAAGG + Intronic
1159306880 18:66654500-66654522 CAGAAGTAGACAAGGGAGAACGG + Intergenic
1159551745 18:69902534-69902556 CAGAAGAAGAGAAAGCATGAAGG - Intronic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1159748601 18:72271615-72271637 CAGACTAAGACAGAGGACGAGGG - Intergenic
1159915864 18:74187188-74187210 CAAAATAAGCCAAAAGAGGCAGG - Intergenic
1160173806 18:76577107-76577129 CACACAAACACAAAGGAGGAAGG + Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1161477569 19:4494919-4494941 CAAAACAAAACAAAGGAGGGAGG + Intronic
1162156593 19:8682387-8682409 CAGAGGGAGACAAAGAAGGAGGG + Intergenic
1162413406 19:10519458-10519480 CAGAAAGAGACAAATCAGGACGG - Intergenic
1163137262 19:15321272-15321294 AAGAAAAAGAGAAAGAAGGAAGG + Intronic
1163171172 19:15532259-15532281 AAGAAGAAGAGAAGGGAGGAGGG - Intronic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164557182 19:29262688-29262710 CAGATCAGGACACAGGAGGATGG + Intergenic
1164802346 19:31088139-31088161 AAGAAAAAGAGAAAGAAGGAAGG + Intergenic
1165463532 19:35958804-35958826 CAGAAAAAGAAAAGGAAGGAAGG + Intergenic
1165965980 19:39581250-39581272 GAGAAGAAAGCAAAGGAGGAAGG + Intergenic
1166514458 19:43435944-43435966 CAGATAAAGAAAAAGAAGGAAGG + Intergenic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167010118 19:46801678-46801700 CAGGATAAGACAATGGTTGAGGG + Intergenic
1167619226 19:50551873-50551895 CAGAAGGAGAGAAAGAAGGAGGG - Intronic
1167714241 19:51130924-51130946 CAGAAGAAGGCCCAGGAGGAGGG - Intronic
925378645 2:3407810-3407832 AAGAAAAAGAAAATGGAGGAGGG + Intronic
925648922 2:6068081-6068103 GAGAGAAAGAGAAAGGAGGAGGG - Intergenic
925961202 2:9018582-9018604 CAGAACAAGAAAAAGGCCGAAGG + Intergenic
926770436 2:16368319-16368341 AAGAATAAGTCAAGGGAGGGGGG + Intergenic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
929011068 2:37445623-37445645 CAGAATAATATCAAGGATGAAGG + Intergenic
929273529 2:40000394-40000416 CTGAATAAGATAAACGAGGAAGG - Intergenic
929959087 2:46482988-46483010 CAGAAAAAGAGAAGAGAGGAAGG - Intronic
930050742 2:47214423-47214445 CAAAAAAAGAAAAAGGAAGAAGG + Intergenic
930288846 2:49467951-49467973 CACAATAAGATAAAGCAGAAAGG - Intergenic
931208863 2:60173472-60173494 GAGAAAAAGTCAAAGTAGGAAGG + Intergenic
931293049 2:60893717-60893739 CAGCATACCACAAAGGAGCAAGG - Intronic
931913150 2:66924249-66924271 CAGAATAAAACAAGGGAGGAGGG - Intergenic
932155799 2:69416020-69416042 CAGAAAAAAGGAAAGGAGGAAGG + Intronic
932846992 2:75146067-75146089 TGGTATAAGACATAGGAGGAAGG + Intronic
932985025 2:76715733-76715755 CAGAATAAGAAACATGAGAACGG + Intergenic
933368911 2:81390287-81390309 AAAAATACAACAAAGGAGGATGG + Intergenic
934331841 2:92075460-92075482 CAAAAAAATAGAAAGGAGGAAGG + Intergenic
934512790 2:94960720-94960742 CAGAAAAACACACAGGAGGCTGG - Intergenic
935096415 2:99948513-99948535 CAGAGAAACTCAAAGGAGGAAGG + Intronic
935310787 2:101781351-101781373 TGGACTAAGACAAAGGGGGAGGG - Intronic
935447645 2:103173489-103173511 TAGAAAGAGACAAAGGAGAATGG - Intergenic
935653573 2:105402625-105402647 AATAGTAAGTCAAAGGAGGATGG + Intronic
937403515 2:121606760-121606782 CACAAAAAGAGAAAGGAGGTGGG + Intronic
937726576 2:125174427-125174449 CAGAATAGAACAAAGGAAGGAGG - Intergenic
938837944 2:135127230-135127252 CAGACTATGCCACAGGAGGAAGG - Intronic
938881000 2:135588223-135588245 GAGAAACAGACAAAGGAAGAGGG - Intronic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939427974 2:142065413-142065435 CAGAATGAGGCCAAGCAGGAAGG - Intronic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
940164921 2:150760473-150760495 CTGAAAAGGACTAAGGAGGAGGG - Intergenic
941743664 2:169063528-169063550 CAGAAAAGCACAAAGGGGGATGG + Intergenic
941904762 2:170710073-170710095 TAGAAGAAAACAAAGGAGGCTGG - Intergenic
942124625 2:172810975-172810997 GAAAATTAGACAAAGAAGGAAGG + Intronic
942455587 2:176136284-176136306 CAGAGAAAGAGAAGGGAGGAAGG + Intergenic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943508378 2:188792429-188792451 CAGAATAGGACAAAGAAGTGTGG - Intergenic
943770381 2:191709987-191710009 CAGAATGAGATAAAGAAGTAGGG + Intergenic
943804327 2:192103524-192103546 AAGAACAAGATAAAGTAGGAAGG - Intronic
943876307 2:193071915-193071937 CAGAAGAAGGGAAAGGCGGAAGG - Intergenic
943880145 2:193132354-193132376 CAGAAGAAGACAGAAGATGAGGG - Intergenic
943895843 2:193358722-193358744 CTGACTAAAACCAAGGAGGAAGG - Intergenic
943942347 2:194014469-194014491 CAGACTAATACAAAGGAGAATGG + Intergenic
944058599 2:195548148-195548170 CAGGATAAGACAGAGAAGGTTGG + Intergenic
944183280 2:196919751-196919773 AAGAATAAGATAGAGTAGGATGG - Intronic
944467302 2:200015698-200015720 CAAAATAAAACAAAGTAGCAGGG - Intergenic
944499369 2:200342456-200342478 CAGCATCAGACGGAGGAGGAAGG - Intronic
944566351 2:200995444-200995466 CAGAATAAGGCAAAGGTGATGGG + Intronic
945036656 2:205709344-205709366 CAGCATAAAACAAAACAGGATGG - Intronic
945253733 2:207786392-207786414 CAGAAAAAAAAAAAGGAGCATGG + Intergenic
945648227 2:212528066-212528088 CTGAAGAATACAATGGAGGAGGG + Intronic
945925768 2:215802438-215802460 TTGAAAAAGACAAAGTAGGAGGG + Intergenic
946610996 2:221457799-221457821 AAGAAGAAAACAAAGAAGGAAGG + Intronic
946756832 2:222955865-222955887 CAGAATAAAGCAAAGAAGAAAGG - Intergenic
946933862 2:224699339-224699361 AAGAAAAAGACAAAGAAGAAGGG - Intergenic
947016505 2:225626409-225626431 CAGAACAGGACACAGGAGGATGG + Intronic
948097630 2:235349121-235349143 CATAATAACACCAAGGGGGATGG - Intergenic
948451732 2:238079531-238079553 CATAATAGCACAAAGGAGGTGGG - Intronic
949076336 2:242061194-242061216 CATAATAAAACAAAAGAAGAGGG + Intergenic
1168745220 20:233486-233508 AAGAAAAAGAGAAAGGAGGTTGG + Intergenic
1169547732 20:6667928-6667950 CAGAACAAGGCAGAGAAGGATGG - Intergenic
1169699980 20:8435342-8435364 TAGAATATGACAAAGGTGAAGGG + Intronic
1169949621 20:11029027-11029049 GAGTATAAGAAAAAGGAGAAAGG - Intronic
1170020663 20:11833864-11833886 AAGAAGAAAAGAAAGGAGGAAGG + Intergenic
1170487432 20:16833024-16833046 TAGAATATGACAGAGGTGGATGG - Intergenic
1171072924 20:22092640-22092662 CAGAAAAAGAGAGAAGAGGAAGG - Intergenic
1171478945 20:25437820-25437842 CAGAATAAGAGAAAAGGGGCCGG + Intronic
1171901775 20:30865220-30865242 AAGAATGAGAGAAAGAAGGATGG + Intergenic
1172191671 20:33065510-33065532 CAGAAAAAGAGAAAGAAGGAAGG + Intronic
1172470658 20:35192055-35192077 AAGAAAAAGACAAACAAGGAAGG + Intergenic
1172675947 20:36672335-36672357 CAGCATAAAACCAAGGAAGAAGG - Intronic
1173144179 20:40510717-40510739 AAGAAAAAAAGAAAGGAGGAAGG + Intergenic
1173423242 20:42921670-42921692 CAGAACGAGACAAAAGGGGAAGG + Intronic
1173837906 20:46137876-46137898 CAGAGTAGGAGAAAGGAGCATGG - Intergenic
1173858323 20:46265775-46265797 AAGAAGAAGAAAAAGGAGAATGG - Intronic
1174667682 20:52275134-52275156 GAGAGTATGACAAAGGAGGCAGG - Intergenic
1175495145 20:59409205-59409227 CAGAATGAATCAAGGGAGGAAGG + Intergenic
1175657839 20:60787135-60787157 GAGAAGAGGACAGAGGAGGAGGG - Intergenic
1177098931 21:16875193-16875215 CAGACAGAGACAAAGGTGGAAGG + Intergenic
1177207718 21:18029684-18029706 CACAAAGAGACAAAGGAGGTAGG + Intronic
1177311034 21:19393140-19393162 AAAAAAGAGACAAAGGAGGAGGG + Intergenic
1177932919 21:27307270-27307292 CAGAAAAAAACAAAGTGGGAAGG + Intergenic
1178076090 21:29014331-29014353 CAGAAGAAGAGAAAGAAGGCAGG - Intronic
1178213131 21:30560576-30560598 AGGAAGAAGACAAAGGAGAAGGG + Intronic
1179292400 21:40030203-40030225 CAAAAAAAGACAGAGGAGCAGGG - Intronic
1179321652 21:40297664-40297686 CATAAAATAACAAAGGAGGAAGG + Intronic
1179355992 21:40660304-40660326 AAGAAGAAATCAAAGGAGGAGGG + Intronic
1180335150 22:11571172-11571194 AAGAATGAGAGAAAGAAGGATGG + Intergenic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181716985 22:24738158-24738180 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1182142912 22:27978047-27978069 CTGAAAATCACAAAGGAGGAAGG + Exonic
1182403539 22:30103620-30103642 CAGAAAAAGAAAAAGAAAGAGGG - Intronic
1182888450 22:33796333-33796355 CAGAATATCAGAAAAGAGGAAGG + Intronic
1183079650 22:35448327-35448349 CAGAGGGAGACAAAGGAGGCTGG - Intergenic
1183587630 22:38762282-38762304 GAGAATCAAACAGAGGAGGATGG - Intronic
1183970998 22:41477453-41477475 CAGAATAAAACTAAAGAGGTCGG - Intronic
1184108971 22:42384162-42384184 CAGATAAAGATAGAGGAGGAGGG + Exonic
1184463101 22:44651226-44651248 AACAATAACACAAAGGATGAAGG + Intergenic
1185000221 22:48241011-48241033 CAAAAGCAGACAGAGGAGGATGG + Intergenic
1185352989 22:50347727-50347749 AAGAACAAGACACAGGAGAAGGG - Intronic
949376124 3:3392304-3392326 AAGAAAAAGGCAAAGGAAGATGG + Intergenic
949434525 3:4013944-4013966 CAGAAGAAGTCAAATCAGGACGG + Intronic
949850203 3:8413007-8413029 CAGAATAAGCCAGAGAAGGGGGG - Intergenic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950080195 3:10216460-10216482 AAGAGGAAGGCAAAGGAGGAGGG + Intronic
950718740 3:14867733-14867755 CAGTGGAAGACAAATGAGGATGG - Intronic
950798465 3:15530510-15530532 CAGAAGAAGACAGGGGAGGGTGG - Intergenic
950806935 3:15613122-15613144 TAGAATATGACAAAGGTGAAGGG - Intronic
950917059 3:16656746-16656768 CAGAAGAAGACAGAGGGTGAGGG - Intronic
951155351 3:19346337-19346359 GAGAATGAGACAAAGGAGACAGG + Intronic
951251376 3:20397748-20397770 GAGTATAAGAAAAAGGAGGTTGG + Intergenic
951591451 3:24269908-24269930 CAGAAAAAGCCAAAGAAGGAAGG - Intronic
952688004 3:36171956-36171978 CTGAATTACAAAAAGGAGGAGGG + Intergenic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
953374650 3:42418578-42418600 AAAAATAAGAAAAAGGAGGGAGG + Intergenic
953454646 3:43032000-43032022 GAGAATAAGACAGAAGAGCATGG + Intronic
954391847 3:50271706-50271728 CAGAGAGAGACAAGGGAGGAAGG + Intronic
954409984 3:50366328-50366350 CAGAGTAAGTCCTAGGAGGAAGG + Exonic
954550885 3:51480668-51480690 CAGGATGAGAAAAAGGAGGATGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955731873 3:61995763-61995785 AAGAAAAAGAAAAAGAAGGAGGG - Intronic
955936580 3:64108504-64108526 CAGAGTATGACAAAGAAGGCTGG + Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956446842 3:69334136-69334158 CAGAAGAAGACAAAGCAGACTGG + Intronic
957049772 3:75402387-75402409 CAAAAAAAAAAAAAGGAGGAAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
958144882 3:89612072-89612094 GAGAAAAAGAGAAGGGAGGAAGG - Intergenic
958637869 3:96767838-96767860 AATAATAACACAAAGGAGGCAGG + Intergenic
958798900 3:98733570-98733592 CAGTTTAGGAGAAAGGAGGACGG + Intronic
959678951 3:109070654-109070676 CAGAATAAGACAAAGATGATGGG + Intronic
959845526 3:111028177-111028199 CACAATAAGGTAAAGAAGGATGG + Intergenic
960227733 3:115186488-115186510 CTGAAGATGACAAAGGGGGAAGG - Intergenic
960723714 3:120649437-120649459 TAGAAAAAGACAACGGAGGCCGG - Intronic
961773381 3:129266643-129266665 CAGAATAATAAAAATGAGAAAGG - Intronic
962440776 3:135413968-135413990 AAGAAAGAGAAAAAGGAGGAGGG + Intergenic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
963480353 3:145865467-145865489 CAGAAGAGGAGAAAGGGGGAGGG + Intergenic
963520096 3:146353417-146353439 AAGAATAGTACCAAGGAGGAGGG + Intergenic
964074535 3:152677200-152677222 GGGAACAATACAAAGGAGGATGG + Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
965306840 3:167075624-167075646 AAGAAAGAGATAAAGGAGGAAGG + Intergenic
965834929 3:172840988-172841010 CAAAACAGGAGAAAGGAGGAAGG - Intergenic
965888287 3:173476960-173476982 CTGATTAAGATAAAGAAGGAAGG + Intronic
966154539 3:176901878-176901900 AAGAATAAGAAAAGAGAGGAAGG + Intergenic
966297469 3:178440841-178440863 CAGAACAAGACAAAGAAGTGTGG - Intronic
966566187 3:181383969-181383991 GACAGTAAGACAAAAGAGGAAGG + Intergenic
966646841 3:182255454-182255476 CTGAATAACACAAAAGAGAAAGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968536903 4:1137464-1137486 AACAATAGCACAAAGGAGGAAGG - Intergenic
968808603 4:2790166-2790188 CAGAATAAGGCCAAAGAGAAGGG - Intergenic
968810045 4:2795708-2795730 CAGACTAAGCCAAAGGCGGGCGG + Intronic
969721403 4:8894554-8894576 CAGAACAGGAGACAGGAGGAGGG - Intergenic
969955206 4:10882414-10882436 AAGAAGAAGAAAAAGGAAGAGGG - Intergenic
970455023 4:16214881-16214903 CAAAAAATGACAAGGGAGGAAGG + Intronic
970988994 4:22191337-22191359 CAGAGAAAGAGAAAAGAGGAGGG + Intergenic
971261557 4:25061946-25061968 CAGAATAAGGAAATGGATGAAGG - Intergenic
971527852 4:27643957-27643979 CATAAAAAGACACAGGAGGCCGG - Intergenic
971760163 4:30755624-30755646 CAGACTAAGACAGTGGGGGATGG - Intronic
971849097 4:31960259-31960281 GAGAGAAAGAGAAAGGAGGAAGG - Intergenic
972554335 4:40166096-40166118 CACAATAAGACAATGGAAGGTGG + Intergenic
972633608 4:40863062-40863084 CAGATAAAGACACTGGAGGATGG + Intronic
973124445 4:46566917-46566939 AAGAAGAAGAGAAGGGAGGAAGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974890196 4:67872272-67872294 AAGAATGAAAGAAAGGAGGAAGG - Intronic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
975120206 4:70720068-70720090 CAAAATAAAAAAAAGAAGGAGGG - Intronic
975242375 4:72076027-72076049 CAGCACAAGCCAAAGCAGGAAGG + Intronic
975668390 4:76755496-76755518 GGAAATAAGACAAAAGAGGAGGG + Intronic
976211213 4:82672307-82672329 CAGACTAAGAAAAAAGAGGTAGG + Intronic
976230186 4:82834569-82834591 CTGAATAAGTTAAAGGAGGGTGG + Intronic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
976760743 4:88546524-88546546 CAGAGCAAGACCAAGAAGGAAGG - Intronic
976890416 4:90039766-90039788 CAGACAAAGAGAGAGGAGGAAGG - Intergenic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
978693910 4:111552173-111552195 CATAATAAAACAAAAGATGATGG - Intergenic
978757353 4:112317329-112317351 TAGAAGAACACATAGGAGGAAGG - Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979672332 4:123373119-123373141 AAGAAAAAGAGAAAGGAGGGAGG + Intergenic
979792594 4:124804416-124804438 CAGAGTAAGGCAAAGAAGGTGGG - Intergenic
979928242 4:126595096-126595118 CAGAAGAAGCCACAGGAGGGAGG - Intergenic
980254409 4:130359259-130359281 CAGTAAAAGATAAAGGAGAAAGG + Intergenic
980770497 4:137365520-137365542 CAATATAAGAGAAAGGAGGGAGG + Intergenic
980872988 4:138631493-138631515 CAAAGTAAGAAAAAGAAGGAAGG - Intergenic
982050737 4:151498882-151498904 CAGAAAAACAATAAGGAGGAAGG - Intronic
982115799 4:152097422-152097444 AAGAATGAGAGAAAGAAGGAAGG + Intergenic
982167124 4:152624051-152624073 CTGTTTAAGACAAAGGTGGATGG - Exonic
982487167 4:155979909-155979931 CAGAAGAAAACACAGGAAGAGGG - Intergenic
982804924 4:159751548-159751570 TAGACTAAGAAAAAGGAAGAAGG - Intergenic
982936500 4:161484232-161484254 GAGAATAAGAAAAAGAAGGAAGG - Intronic
982967461 4:161930912-161930934 CTGAATTAGACAAAGGCGAAGGG + Intronic
984538852 4:181011944-181011966 CAGAATGAGAGAAAGGAAAAAGG - Intergenic
984587747 4:181582272-181582294 GAGAAAAAGAAAAAGGAGCAGGG + Intergenic
984818375 4:183858584-183858606 GAGAAAAAGAGAAAGAAGGAAGG + Intronic
984823105 4:183901096-183901118 CATAATGACACAAAGGAGAATGG - Intronic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
984882731 4:184424752-184424774 CAGACTAAGACAATAGAGGATGG + Intronic
985385356 4:189440724-189440746 CAAAATAAGAAAAGGGGGGAGGG - Intergenic
985404920 4:189628523-189628545 TATCATCAGACAAAGGAGGAAGG + Intergenic
985756642 5:1723427-1723449 GAGGAAAAGAGAAAGGAGGAGGG - Intergenic
985802481 5:2013796-2013818 CAGGCTGAGACAGAGGAGGACGG + Intergenic
985952919 5:3237100-3237122 CAGAAACAGACACATGAGGAAGG + Intergenic
986028151 5:3870314-3870336 CAGAACAAGAGAACAGAGGAAGG - Intergenic
986127178 5:4893973-4893995 CACAATAAGACAAAGGTGAATGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986597022 5:9433608-9433630 GAGAAAGAGAGAAAGGAGGAAGG - Intronic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
987562659 5:19543672-19543694 CAGAATTACAGTAAGGAGGAAGG + Intronic
987570589 5:19653340-19653362 CAGAATAAGACCTAGAAGAAGGG + Intronic
988444587 5:31271398-31271420 AAGGTTAAGACAGAGGAGGAAGG - Intronic
988690439 5:33566720-33566742 CAGAAGAAGAAAAAGGATTATGG - Intronic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
989619573 5:43371062-43371084 CAGATTAAGAAAAAAGAAGAAGG - Intergenic
990276814 5:54205956-54205978 CAGAAGAAGAATAAGGGGGAAGG - Intronic
990502649 5:56412039-56412061 CAGAATGTGAGAAAGGAGGAAGG - Intergenic
990850182 5:60194344-60194366 CAGCAGAAGACAGAGGAAGAGGG - Intronic
990857809 5:60290505-60290527 TAGAATAATACATAGGAGGCAGG + Intronic
992098631 5:73384046-73384068 GAGAAAAAGACAAGAGAGGAGGG + Intergenic
992317174 5:75567991-75568013 CACAGTAAGACTAAGAAGGAAGG + Intronic
992530027 5:77644841-77644863 GAGAAAAAGAGAAAGGAGGAAGG - Intergenic
992750831 5:79859117-79859139 CAGAAGAAGAGAAAAGAGCAAGG + Intergenic
992768604 5:80026395-80026417 CAGAAGAAAACACAGAAGGAAGG - Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993199800 5:84800755-84800777 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
993929925 5:93925543-93925565 CTGAGTAAAACAAAGTAGGATGG + Intronic
994635997 5:102344828-102344850 CGGAATTAGACAAGTGAGGAGGG + Intergenic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995663229 5:114509942-114509964 CAGAAAAAGAAAAAGAAAGACGG + Intergenic
995907468 5:117142823-117142845 GAGAATGAGAGATAGGAGGATGG - Intergenic
996366334 5:122705187-122705209 AAGAAGAAAACAAAGGGGGATGG - Intergenic
996506676 5:124275807-124275829 GAGAAAAAGACAAAGAAGAATGG + Intergenic
997486325 5:134234009-134234031 CAGAAGAGGGCAAATGAGGATGG - Intergenic
997715906 5:136042631-136042653 GAGAAAAAAACAAAAGAGGAAGG + Intronic
998599946 5:143575225-143575247 CAAAATAAGACAGTAGAGGAGGG - Intergenic
998618951 5:143773278-143773300 CATAATAACACCAAGGAGGATGG + Intergenic
998986118 5:147759245-147759267 AAGAAAAAGAGAAAGGAGAAGGG + Intronic
999015312 5:148097060-148097082 AAGAAAAAGAAAAAGGAGAAAGG - Intronic
999572765 5:152939309-152939331 CAGGTTAAGACACAGGAGCAGGG + Intergenic
1000131900 5:158308222-158308244 CAAAAATAGACAAAGGAGAAAGG + Intergenic
1000154437 5:158536685-158536707 AAGAGTCAGACAATGGAGGAAGG - Intergenic
1000304085 5:159980085-159980107 CAGCAAAAGAGAAAGGTGGAAGG + Intergenic
1000872911 5:166599706-166599728 CGGAATAACACAAAGCATGAAGG - Intergenic
1002427184 5:179183349-179183371 CAGAATAGGAGAGAGGAGAAAGG + Intronic
1002942317 6:1728825-1728847 CAGAAAAAGAAAGAGGAGAAAGG - Intronic
1003724471 6:8744874-8744896 CAGAATAAGTTAAAGAGGGAGGG + Intergenic
1003725013 6:8751436-8751458 CAGATGGATACAAAGGAGGAAGG + Intergenic
1003758991 6:9153488-9153510 CAGAATAAGAGAAGAGAGGAGGG + Intergenic
1004258235 6:14084703-14084725 ATGAATGAGACAAAGGAGGTGGG + Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004709781 6:18158278-18158300 AAGATTAAGTCAAAGGAGGCCGG + Intronic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005214064 6:23504429-23504451 CAGGAGAACAGAAAGGAGGAAGG - Intergenic
1005318430 6:24627503-24627525 CAGAAGAAAACAAGGAAGGAAGG - Intronic
1005942381 6:30570376-30570398 CTGAAGAAAACAAAGGAGGGAGG + Intergenic
1006818213 6:36868015-36868037 CAGAAGGACAGAAAGGAGGAGGG + Intronic
1006904061 6:37521353-37521375 CAGGACAAGACAAGGGAGGTGGG - Intergenic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007427943 6:41759362-41759384 GAGAACAAGGCAAAGGAGCATGG - Intergenic
1007507192 6:42344799-42344821 AAAAATAAGACAAAGAAGGTGGG - Intronic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1007822624 6:44571846-44571868 GGGAATAAGACAAAGGTGGGTGG + Intergenic
1007854885 6:44845687-44845709 CAGAAGAAGACACAAGAGGCTGG + Intronic
1008603067 6:53114486-53114508 AAGAGTAAGTCAATGGAGGAAGG + Intergenic
1008717828 6:54310429-54310451 CAGAAAGAGAGAAAGAAGGAAGG - Intronic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1009705222 6:67240675-67240697 CAGAAAAGTTCAAAGGAGGAGGG + Intergenic
1009877578 6:69524580-69524602 CAGAACAGGACAAAGAAGGGCGG - Intergenic
1010940780 6:81915198-81915220 CAGCATAAGACATAGTGGGATGG + Intergenic
1010953313 6:82062182-82062204 CAGATGAAAACAAAGGAGTAAGG + Intergenic
1011596202 6:89019129-89019151 CAGGATAAGACACAAGAAGATGG - Intergenic
1011664514 6:89621745-89621767 CAGGACAAGACCTAGGAGGATGG + Intronic
1011834677 6:91417251-91417273 CAAAAAAAGCCAAAGAAGGAGGG + Intergenic
1013535364 6:111058710-111058732 CAGAGTCAAACAAAGGAGGAAGG + Intergenic
1014395525 6:120923604-120923626 CAGAATATGGCAAAAGAGGTGGG - Intergenic
1014448845 6:121560100-121560122 TAGAGTGAGACAAAGAAGGAAGG - Intergenic
1014705417 6:124740517-124740539 CAGAAAAAGAAAAAGGTTGAAGG + Intronic
1014835084 6:126151876-126151898 AAGAAAAAGACAAGGAAGGAAGG - Intergenic
1015434971 6:133174743-133174765 AAGAAGAAGACAAAGGAGAAGGG - Intergenic
1015478420 6:133679607-133679629 GAGAATAAGACAAAGGGTGGAGG + Intergenic
1015898576 6:138040664-138040686 TAGAATAAGACAAATTAGGCTGG - Intergenic
1016180359 6:141139129-141139151 TAGAATAGCACAAAGGGGGATGG - Intergenic
1016234531 6:141847205-141847227 CAGAAACAGAAACAGGAGGAAGG - Intergenic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017586973 6:155937240-155937262 AAGAATGAGAGAAAGAAGGAAGG - Intergenic
1017638718 6:156469215-156469237 AAGAAAGAGAGAAAGGAGGAGGG + Intergenic
1017681199 6:156865814-156865836 AAGAAAAGGAAAAAGGAGGAAGG - Intronic
1019146228 6:169977125-169977147 CTGAATGAAAGAAAGGAGGAGGG - Intergenic
1020402244 7:7792425-7792447 CAGAATTAGAAAAAGTAGGAGGG + Intronic
1022545061 7:31179300-31179322 AAGAATAAAAGAAAGAAGGAAGG + Intergenic
1022555855 7:31295186-31295208 CAGACCAAGAGAAAGGAGGCAGG + Intergenic
1022585741 7:31607493-31607515 CACAAGAAGACAATGGAGCAAGG - Intronic
1022847493 7:34225621-34225643 CAGGTTCAGACAAAGGAAGAAGG + Intergenic
1023561109 7:41474206-41474228 CAGATTGAGACAATCGAGGAAGG - Intergenic
1024268155 7:47622271-47622293 CAGAAGAAGACACAGGCGGCCGG - Intergenic
1026159302 7:67854514-67854536 CTGACTAAGTGAAAGGAGGAAGG - Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026562443 7:71461763-71461785 CAGGAAAAGGCAGAGGAGGAGGG - Intronic
1026672658 7:72403311-72403333 GAGAATGAGAAAAAGGGGGACGG - Exonic
1026794376 7:73357080-73357102 CTGAATAAGACATGAGAGGAGGG - Intronic
1026997272 7:74626003-74626025 AAAAAGAAGAGAAAGGAGGAAGG - Intergenic
1028075484 7:86508588-86508610 CAGAATATGACAAAGGAAAAGGG + Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028509052 7:91601830-91601852 TAGAAAAAGACAAAGAAGGCTGG - Intergenic
1028522893 7:91752221-91752243 CAGAAATAGAAAAAGCAGGAAGG + Intronic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1029180759 7:98700053-98700075 AAGAAAAAGAAAAAGGAGGGAGG + Intergenic
1029815212 7:103086893-103086915 GAGAATAAGACAGAAGAGGGAGG + Intronic
1029911887 7:104161468-104161490 GAGAATCTGACATAGGAGGATGG - Intronic
1030579665 7:111338057-111338079 CAGAGTGAGACAAAGGAAGAAGG + Intronic
1030740707 7:113106101-113106123 AAGAATAATGCAAAGCAGGAAGG + Intergenic
1030909322 7:115226870-115226892 CAGAATTAAACAAAGAAAGAAGG - Intergenic
1031154089 7:118088406-118088428 CAGAAAAAAGCAAAGGATGATGG - Intergenic
1031207748 7:118782450-118782472 CAGAATAAGAGAAACAAGGTAGG - Intergenic
1031377481 7:121045256-121045278 CACAATAAGGCAAAGGAGCAAGG - Intronic
1031544749 7:123037016-123037038 CAGAATAAGTGACTGGAGGAGGG - Intergenic
1031549111 7:123086201-123086223 CAGTATCAGAAAAAGGAGAATGG + Intergenic
1031688948 7:124765162-124765184 CACAAGATGCCAAAGGAGGAAGG - Exonic
1031700692 7:124921741-124921763 CACAATAAAATAAAGGAGAAAGG + Intronic
1031731160 7:125302531-125302553 CAGAATATAGCAAAGGAGAAAGG - Intergenic
1031979824 7:128117252-128117274 TAGACTAAGACACTGGAGGAAGG - Intergenic
1032354455 7:131197042-131197064 GAGAATTAAACAGAGGAGGATGG - Intronic
1032707017 7:134429834-134429856 CAGAATAAGACAAGAGAGATGGG + Intergenic
1032724705 7:134580127-134580149 CAGGAAAAGACTCAGGAGGAAGG - Intergenic
1033013776 7:137650811-137650833 CAGACTAAGACAATGGCTGAGGG + Intronic
1033023228 7:137748188-137748210 GAAACTAAGGCAAAGGAGGAAGG + Intronic
1033184850 7:139218106-139218128 CAGAAAAAAACAATGCAGGATGG - Intergenic
1033412375 7:141129945-141129967 CAGATTAAGACAAAAGATTATGG + Intronic
1033646713 7:143310608-143310630 CAGAATAAGTCACAGAAGCAAGG - Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034103591 7:148471935-148471957 CAGAACGAGAAAAAGGAGGAAGG + Intergenic
1035672554 8:1431493-1431515 AAGAAGAAGAGAAAGGAGAAAGG + Intergenic
1036725064 8:11212859-11212881 CAGAATATGACAAAGGTGATGGG + Intergenic
1037135655 8:15456467-15456489 AAGAATAAGAAAAGAGAGGAGGG + Intronic
1038087008 8:24209464-24209486 AAGAAAATGACAAAGGAAGAAGG + Intergenic
1038683303 8:29691081-29691103 CAGAACAAGAGAAAGAATGAAGG + Intergenic
1038787712 8:30635683-30635705 AAGAATGAGATAAAGGAGAAAGG - Intronic
1039023136 8:33229242-33229264 AGGAATAAGACAAAGAAGAAAGG + Intergenic
1039970157 8:42315386-42315408 TAGATGAAGAGAAAGGAGGAAGG + Intronic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041692545 8:60703147-60703169 CACAATAAGAAAAAGGAAGGAGG - Intronic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1041954444 8:63542063-63542085 CAAAATGAGACAGAAGAGGAAGG - Intergenic
1042426955 8:68660336-68660358 AAGAATAAAATAAAGGAAGATGG - Intronic
1042434322 8:68745518-68745540 CAAAATAAAAGAATGGAGGAAGG + Intronic
1044533469 8:93334152-93334174 CAAAATAATACAAATGTGGAAGG + Intergenic
1045938149 8:107706618-107706640 CAGAGAAAGACAGAAGAGGAGGG - Intergenic
1045992784 8:108329302-108329324 GAGTATAAGAGAAAGCAGGACGG - Intronic
1046048274 8:108988636-108988658 CAGAAAGAGAGAGAGGAGGAAGG + Intergenic
1046361540 8:113164944-113164966 TAGAATAAACCAATGGAGGAAGG - Intronic
1046484616 8:114870510-114870532 CAGCATAGCACAAAGGAGGAAGG + Intergenic
1046778528 8:118190195-118190217 CAGAGTATGAGAAGGGAGGATGG - Intronic
1047021502 8:120779617-120779639 CTGACTAGGACAAAGGAAGAGGG + Intronic
1047767667 8:128002639-128002661 CAGGAGAGGACACAGGAGGATGG - Intergenic
1047895459 8:129361618-129361640 GAGAGAAAGAGAAAGGAGGAAGG - Intergenic
1047956559 8:129981041-129981063 GGGAAGAAGACAGAGGAGGAAGG + Intronic
1048383109 8:133885753-133885775 GAGAGAAAGAGAAAGGAGGAGGG + Intergenic
1048542619 8:135356073-135356095 CAGACTAATACACAGGGGGAAGG + Intergenic
1048689053 8:136938001-136938023 AAGAACAAGACAGAGAAGGAAGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048927637 8:139284794-139284816 AAGAATAAAACAAAGCAGGCTGG - Intergenic
1050076660 9:1872800-1872822 GAGTGCAAGACAAAGGAGGAGGG - Intergenic
1050193511 9:3055487-3055509 TAGAATAAGATAAAGAAGGGAGG + Intergenic
1050304438 9:4294049-4294071 GAGAACAAAATAAAGGAGGAGGG - Intronic
1050826334 9:9951105-9951127 TAGAATAAGATGTAGGAGGAGGG + Intronic
1050922650 9:11224756-11224778 GAGAGTAAGACAGAGGAGGAAGG + Intergenic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051105732 9:13577893-13577915 GAGAATGGGAAAAAGGAGGAGGG + Intergenic
1051518319 9:17955604-17955626 CTGGGTAGGACAAAGGAGGAAGG - Intergenic
1051716349 9:19988578-19988600 AAGAATTAGACAAGGGAGGGAGG + Intergenic
1052332480 9:27283787-27283809 CAGAAGAAGAGAGAGGAAGAGGG - Intergenic
1052790940 9:32875084-32875106 CAGAAAAAAAAAAAGGGGGATGG + Intergenic
1052982915 9:34461893-34461915 CAGAAAAAGATAAAGGAGGATGG + Intronic
1053486893 9:38465354-38465376 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1055037670 9:71835745-71835767 AAGAAAAAGAGAAAGGAAGAAGG - Intergenic
1055538860 9:77279367-77279389 CAGAAAAAGAGAGAAGAGGAAGG - Intronic
1055647361 9:78373626-78373648 CATAAAAACACAAAAGAGGAAGG - Intergenic
1056368234 9:85928038-85928060 CAGAACAAGACCAAGAAGGAGGG - Intergenic
1058074198 9:100634120-100634142 CAGAGTGAGACAAAGAAAGAAGG - Intergenic
1059064352 9:111067155-111067177 CAAAATAAGACACAATAGGATGG - Intergenic
1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG + Intergenic
1059483421 9:114609717-114609739 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059812035 9:117866026-117866048 GAGAAGAAGACAAAGAAAGAAGG + Intergenic
1060085038 9:120690796-120690818 TAGGATAGGACAGAGGAGGAGGG + Intronic
1060259837 9:122064760-122064782 AGTAAGAAGACAAAGGAGGAGGG + Intronic
1061921848 9:133786949-133786971 CAGAAAAACAAAAAGGATGATGG + Intronic
1061934959 9:133852361-133852383 CAGAAGAATAAAAAGAAGGAAGG + Intronic
1062413786 9:136437990-136438012 CAGAAAAAAACAAAGGGGGCAGG + Intronic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1185499096 X:584157-584179 GAGAAAGAGAAAAAGGAGGAGGG + Intergenic
1185499122 X:584257-584279 GAGAAAGAGAAAAAGGAGGAGGG + Intergenic
1185499150 X:584357-584379 GAGAAAGAGAAAAAGGAGGAGGG + Intergenic
1185509070 X:649332-649354 CAGAAAAAGAGAGAGGAGGCCGG - Intronic
1186119721 X:6347246-6347268 CAGAATAGGAGAGAAGAGGAAGG - Intergenic
1186129518 X:6451644-6451666 AAGAATAAGACAAATGTGTAGGG + Intergenic
1186226006 X:7399844-7399866 GAGAAAGAGAGAAAGGAGGAGGG + Intergenic
1186226604 X:7405622-7405644 CAGACAGAGACAAAGAAGGAGGG + Intergenic
1186547471 X:10465431-10465453 CAGAATATGGCAAAGGACAAAGG + Intronic
1186712538 X:12215280-12215302 CAGAGTGAGAGAGAGGAGGAGGG - Intronic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1188053462 X:25514229-25514251 AAAAATGAGACAAGGGAGGAAGG + Intergenic
1188218229 X:27505676-27505698 CAGAATATGACAAAAGTGAAGGG + Intergenic
1188531354 X:31144790-31144812 CAGAGAAAGAGAAATGAGGAAGG + Intronic
1189307064 X:39994802-39994824 CACAATAATAAAAAGGGGGAGGG + Intergenic
1189328054 X:40125067-40125089 CAGAACAGGACAAAGCAGGCTGG - Intronic
1189555414 X:42139843-42139865 AATAATATCACAAAGGAGGAGGG - Intergenic
1189911041 X:45810707-45810729 CACAATTAGACAAAGGAAAAAGG + Intergenic
1190632282 X:52399610-52399632 GAAAACAAGACATAGGAGGAAGG + Intergenic
1190639194 X:52466530-52466552 CAAAGCAAGACAGAGGAGGAAGG - Intergenic
1190999664 X:55646610-55646632 GAAAGTAAGACAGAGGAGGAAGG + Intergenic
1191722958 X:64249833-64249855 CAGAAGAAGAGAAAGGAAAAGGG - Intergenic
1193568375 X:83108762-83108784 TAGAACAAGACAAAGGAGGAGGG - Intergenic
1194822053 X:98522005-98522027 CAGAAGATCTCAAAGGAGGATGG - Intergenic
1194847735 X:98832531-98832553 AACAAGAAGAAAAAGGAGGAAGG - Intergenic
1194978670 X:100417769-100417791 CAGAGCAAAACAAAGGAGCAGGG + Intergenic
1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG + Intronic
1195024456 X:100862304-100862326 CTGAAATAGACAAAGAAGGATGG + Intronic
1195512691 X:105735667-105735689 AAGAATAAGGCAAAGCAGGGTGG - Intronic
1195915822 X:109934561-109934583 CAGAAGGAAACAAGGGAGGAAGG - Intergenic
1196421873 X:115530891-115530913 CATAGTAAGAAAAATGAGGAAGG + Intergenic
1196581108 X:117380087-117380109 CACAAGAAGAAAAAGGAAGATGG + Intergenic
1197570290 X:128142157-128142179 CCAAAGATGACAAAGGAGGAAGG + Intergenic
1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG + Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198797466 X:140414240-140414262 CAGAATATGACAAAGGTGACAGG - Intergenic
1198852251 X:140977330-140977352 GAAAATAAGAAAGAGGAGGAGGG - Intergenic
1200872264 Y:8114845-8114867 CAGAAGAAAAGAAAGAAGGAAGG + Intergenic
1201637611 Y:16142750-16142772 CGGAAGAAAATAAAGGAGGAAGG - Intergenic
1202083593 Y:21111199-21111221 CAGAAAAAGTCAAAGCAGGGAGG + Intergenic