ID: 908623973

View in Genome Browser
Species Human (GRCh38)
Location 1:66019288-66019310
Sequence AAATGTCCCATGCAAATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908623973 Original CRISPR AAATGTCCCATGCAAATTGA TGG Intronic
901115502 1:6840669-6840691 AAATGTCACCTGCGCATTGACGG - Intronic
901340581 1:8495223-8495245 AAATGTCCTCTGAAAATTGAAGG - Intronic
901964299 1:12853540-12853562 AGAGGTCACATGCAAATTCAAGG - Intronic
901970639 1:12905072-12905094 AGAGGTCACATGCAAATTCAAGG - Intronic
901990847 1:13112641-13112663 TAAGGTCACATGCAAATTCAAGG - Intergenic
901991815 1:13121316-13121338 AGAGGTCACATGCAAATTCAAGG - Intergenic
902014526 1:13296698-13296720 AGAGGTCACATGCAAATTCAAGG + Intergenic
904552795 1:31334425-31334447 AAATTTCCCAAGCAACTTCAGGG + Intronic
904810428 1:33160072-33160094 AAATGTCACATGCAAAAGCATGG + Intronic
904859184 1:33521999-33522021 AAATGTCCCTTGCAGATTAAAGG + Intronic
907839762 1:58145288-58145310 AAATGTGCCAGGCACATTGCAGG - Intronic
908108001 1:60865672-60865694 TACTGTCCCATGGAAAATGAGGG - Intronic
908286858 1:62614439-62614461 TAAGGTCCCATGGACATTGATGG + Intronic
908623973 1:66019288-66019310 AAATGTCCCATGCAAATTGATGG + Intronic
910077040 1:83293265-83293287 CAATTTCCCATGGATATTGAGGG - Intergenic
910854450 1:91681045-91681067 AAATGGCCTCTGCAAATTAAGGG + Exonic
911060709 1:93745458-93745480 AAATGTTTTATGCAAATTAAAGG + Intronic
911172370 1:94783272-94783294 AAATGTCCAAAGCAAAGTTATGG + Intergenic
911739638 1:101373315-101373337 ACATGTCCCATGCTCATGGATGG - Intergenic
912163980 1:107020519-107020541 AAATGTCCCCTGCAGGTGGAGGG + Intergenic
912204620 1:107496028-107496050 AAATGTCAAATGTAAATTAAGGG - Intergenic
913116652 1:115703522-115703544 AAATCTCCCACGCAAATATATGG + Intronic
915059028 1:153164518-153164540 AAATCTCCCATGGATACTGAGGG - Intergenic
915235665 1:154479110-154479132 AAATGTCCCATGCCATCTGTGGG - Intronic
918537395 1:185588696-185588718 AGATCTCCCAAGCAAATGGAAGG + Intergenic
918888290 1:190227342-190227364 AAATTTCCTTTGCAAATTGTTGG + Intronic
922120059 1:222656931-222656953 AATTGTGCCTTACAAATTGAAGG - Intronic
923885038 1:238145302-238145324 AAATGTCCTATGCAAAGATAGGG - Intergenic
924323763 1:242875078-242875100 AGGTGTCCCCTGCAATTTGAGGG - Intergenic
924691901 1:246360323-246360345 ACATGTCCCATGCTCATGGATGG + Intronic
924887543 1:248235622-248235644 AAATATTCCATGCTAATGGATGG - Intergenic
1063823860 10:9870618-9870640 GAATATTCCATGCAATTTGATGG + Intergenic
1064848216 10:19680475-19680497 AAATTTACCAAGCAAATGGAAGG - Intronic
1065341666 10:24712372-24712394 CAATCTCCCATGAATATTGAAGG - Intronic
1065949324 10:30637517-30637539 AATTGTCCCATGCTTAGTGAAGG + Intergenic
1067923434 10:50482862-50482884 AAATTTACCAAGCAAATGGAAGG + Intronic
1070795566 10:79214471-79214493 AAATGTCCCGTGCTAAATCAGGG - Intronic
1071178255 10:82952973-82952995 AAATGTACCATGCTAATGTAAGG - Intronic
1071476376 10:86028882-86028904 AAATGTCCCATGAATTCTGAAGG + Intronic
1073968460 10:109018837-109018859 TAATGTCCCATACAAGTTTAGGG - Intergenic
1076017560 10:127040332-127040354 AAATGTCACATGCAAACAGTGGG - Intronic
1079396409 11:20067453-20067475 ATATGTCCCATGCAATATTAGGG - Intronic
1079482067 11:20891666-20891688 AAATTTACCAAGCAAATGGAAGG + Intronic
1080163731 11:29211603-29211625 AAAAGCCACATGCAAATTCAAGG - Intergenic
1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG + Intronic
1081080336 11:38732804-38732826 ATATGTCTCATGAAATTTGATGG - Intergenic
1081188331 11:40072801-40072823 AAATGTCACATACAAATTGGTGG + Intergenic
1081440915 11:43079944-43079966 CAATTTCCCATGGATATTGAGGG - Intergenic
1081440928 11:43080020-43080042 CAATTTCCCATGGATATTGAGGG - Intergenic
1081550373 11:44106207-44106229 AGAAGTACCATGCAAATTCAGGG + Intronic
1084576925 11:69994721-69994743 AAATGTAACATGCAAGCTGATGG - Intergenic
1087322236 11:96677131-96677153 AAATGTTGGATTCAAATTGAAGG + Intergenic
1088789445 11:113211352-113211374 ATATGTCCCATACATACTGATGG - Intronic
1089049314 11:115532797-115532819 CAATCTCCCATGTATATTGAGGG + Intergenic
1089222147 11:116882143-116882165 AAATGGGCCAGGCAAATAGATGG + Intronic
1089826408 11:121281855-121281877 CCAGCTCCCATGCAAATTGAAGG + Intergenic
1091816072 12:3438866-3438888 AAATGTCCTTTTAAAATTGATGG + Intronic
1092905324 12:13095896-13095918 AAATTTCCTCTGCAAATTGCAGG - Intronic
1092917333 12:13200678-13200700 GAATCTCCCAGGTAAATTGAAGG - Intronic
1097010979 12:55953360-55953382 ACCCTTCCCATGCAAATTGACGG + Exonic
1098600061 12:72320210-72320232 AAATCCCCCATGGATATTGAGGG - Intronic
1100967431 12:100028087-100028109 AAATCTCCCATGGACATGGAGGG + Intergenic
1104535338 12:129613323-129613345 AAAGGTCTCATGTAAGTTGATGG + Intronic
1106729809 13:32528880-32528902 CAATCTCCCATGGATATTGAGGG - Intronic
1108258182 13:48630535-48630557 AAATTAGGCATGCAAATTGAAGG + Intergenic
1108678736 13:52761250-52761272 AAATGTCTCATCCAATTTAATGG + Intergenic
1109173575 13:59126701-59126723 GACTGTCACATGCAATTTGATGG + Intergenic
1110337532 13:74348874-74348896 AAATTTACCAAGCAAATTGAGGG + Intergenic
1111846181 13:93511792-93511814 AAATATCCCATGCTCATGGATGG - Intronic
1112036054 13:95497653-95497675 AAATGTCCCCTGCAATTTCAGGG + Intronic
1112299707 13:98218664-98218686 ATATGTCCCATGCCAGTTGCGGG + Intronic
1112977639 13:105340542-105340564 AATTGTCCTCTGCAAAATGAAGG - Intergenic
1115582925 14:34779562-34779584 AAAGATCCCATGCAAATTATAGG + Intronic
1116021388 14:39466294-39466316 AAATATTCCATGCCAATAGAAGG - Intergenic
1116794221 14:49372894-49372916 GAATTCCCCATGGAAATTGAGGG - Intergenic
1116990200 14:51268038-51268060 AAAAGTCCCATGCAAGATTAGGG - Intergenic
1117246674 14:53893504-53893526 GAAAGTACTATGCAAATTGAAGG - Intergenic
1120668759 14:87339533-87339555 AAATCTCAAATGCAAATTAAAGG - Intergenic
1121530482 14:94649324-94649346 AAATGTAGAATGCAAAATGAAGG - Intergenic
1121556865 14:94844747-94844769 CAATGTCCCATGCAGGGTGACGG - Intergenic
1123693198 15:22856736-22856758 AAATGGGAAATGCAAATTGAAGG + Intronic
1124213965 15:27791139-27791161 ACAAGTTCCATGCAATTTGATGG - Intronic
1129782720 15:78284343-78284365 AATTGTCCCAACAAAATTGAGGG - Intronic
1131554295 15:93383450-93383472 AAATGTGGCTTGCACATTGACGG - Intergenic
1132436520 15:101809110-101809132 AAATGTACCATGGAAATATAAGG - Intronic
1135470010 16:22721853-22721875 AAATGAGCCATGCAGATTGCTGG - Intergenic
1135613706 16:23890915-23890937 AAATGTCCCATTCATCTTCAGGG - Intronic
1137577826 16:49615303-49615325 GTATGTCCCATGCAAATGAATGG + Intronic
1138001607 16:53286694-53286716 AAATCCCCCATGGATATTGAGGG - Intronic
1139000256 16:62501275-62501297 ATATATCCAATGCAATTTGAAGG + Intergenic
1144003657 17:11079341-11079363 CAATGTCCCATGAATCTTGAAGG - Intergenic
1148847666 17:50538757-50538779 AAATGGCCCATGCACACTGAGGG + Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1156164210 18:34398446-34398468 ACATGTCCCATGCCCATGGATGG - Intergenic
1159308665 18:66679141-66679163 AACTGTCCCATGCAAACTCTTGG - Intergenic
1161455489 19:4367769-4367791 AAATGTCCCATGGAACATGGCGG + Intronic
1164351741 19:27354591-27354613 AAATATCCCTTGCAGATTGTAGG + Intergenic
1166880978 19:45929803-45929825 AAATGTCCCATGCAATATGTGGG - Intergenic
927358414 2:22202811-22202833 GTATGTCCCATGCAAATTTGGGG - Intergenic
928796576 2:35029487-35029509 AAATGCCAGAAGCAAATTGAAGG + Intergenic
929668801 2:43853413-43853435 AACTGTCCCCTGCAGAATGAAGG - Intronic
930732030 2:54736875-54736897 AACAGACCAATGCAAATTGAGGG + Intronic
931972575 2:67605316-67605338 AAATGCTCCATGCAAATTGATGG + Intergenic
932050010 2:68389007-68389029 AAAAGTCAAATGCAGATTGAGGG + Intronic
933386701 2:81619907-81619929 AAATGTCCCATTACAATTGATGG - Intergenic
936712673 2:115150314-115150336 AAATGTCCAATTCAATTTCAGGG + Intronic
936848767 2:116871136-116871158 AAATTTACCAAGCAAATGGAAGG - Intergenic
937436236 2:121884336-121884358 AAATGTGCCATAAAAATTGCAGG + Intergenic
938005269 2:127784738-127784760 AAAAGTTCCATTCAAATTGCAGG - Intronic
939123971 2:138152645-138152667 ACATGTTCCAGGCAAAATGAAGG - Intergenic
941149768 2:161899851-161899873 AATTTTCCCAGGCAAATGGATGG - Intronic
941883677 2:170506743-170506765 AAATGACCCATGCTTCTTGAAGG + Intronic
943670229 2:190652243-190652265 TAATATACCATGCAAATTAATGG - Intronic
943850234 2:192711182-192711204 AAATGCACCATGCTATTTGAAGG + Intergenic
944243020 2:197504043-197504065 ACAAGTACCATGTAAATTGAGGG + Intronic
944490402 2:200252934-200252956 CATTTTCCCATGCAACTTGAAGG - Intergenic
945192154 2:207199993-207200015 AAATTTCCCATGCCATTTTAAGG - Intergenic
945864513 2:215161570-215161592 CCAGCTCCCATGCAAATTGAAGG - Intergenic
946109550 2:217402629-217402651 AAATGTCCCATGCACTTCAAGGG + Intronic
946634148 2:221706013-221706035 AAATCTACCATTAAAATTGATGG + Intergenic
947436996 2:230081311-230081333 AAATGTCCTCTGGAAATTGAGGG - Intergenic
948247161 2:236496407-236496429 AAATGTTCCTTTCAAAATGAAGG + Intronic
1170790846 20:19508296-19508318 AAAATACCCATGCAACTTGAGGG - Intronic
1171130461 20:22647896-22647918 AAATATTCCATGCAAAATAAAGG - Intergenic
1175376124 20:58525132-58525154 AAACATCCCAGGCACATTGAAGG + Intergenic
1178820572 21:35971452-35971474 AAATGTCCAATGCGACTGGAAGG + Intronic
1179443657 21:41415491-41415513 ACATATCCCATGCACATGGATGG + Intergenic
1184984872 22:48124096-48124118 AAATGTAATAGGCAAATTGAGGG + Intergenic
949870734 3:8585818-8585840 AAATGTGCCAAGGCAATTGAAGG - Intergenic
952081065 3:29757774-29757796 AAATGTGCCATGGTAATTTAAGG - Intronic
956286122 3:67612445-67612467 AAATCTGCTATGCAAATGGATGG + Intronic
957887345 3:86304720-86304742 AAATCTGCCATGGAAAGTGAAGG - Intergenic
958094786 3:88929716-88929738 AAAAGTCCCATGAAAACTCAGGG - Intergenic
958130199 3:89409383-89409405 AATTGTCCAAGTCAAATTGAGGG - Intronic
959261177 3:104082747-104082769 CAGTGTCCCTTGCAAATTTATGG - Intergenic
960452575 3:117828556-117828578 AAATGTCCCATGCATATTTAGGG - Intergenic
963075835 3:141345510-141345532 GAATCTCACATGCAAATAGATGG - Intronic
965565764 3:170116134-170116156 AAATGTCCCGCTCAAAATGAAGG - Intronic
967784728 3:193479636-193479658 ATATGTCCCATGCTCATGGATGG + Intronic
970070899 4:12158981-12159003 ATATTTACCAAGCAAATTGAAGG - Intergenic
970346603 4:15158907-15158929 CAAGCTCCCATGCAAACTGAAGG + Intergenic
972588272 4:40459362-40459384 AAATGTCCAAAGCAATTTGGTGG - Intronic
972789721 4:42359388-42359410 AAATGTCCTATGGAACTGGATGG + Intergenic
973104053 4:46309641-46309663 AAATGTCCTATGTACATAGAAGG + Intronic
974457895 4:62151751-62151773 TAAGGACCCATGCAAATTTAAGG + Intergenic
975120172 4:70719612-70719634 GAATGTCCCATGTAATTTGAAGG + Intronic
975361825 4:73479218-73479240 AAATATCCCATGCTTATTAATGG + Intergenic
976672760 4:87672695-87672717 AAATATCCCATGCTCATGGACGG + Intergenic
979709198 4:123757806-123757828 AAATATTTCATACAAATTGAAGG - Intergenic
980597847 4:134978257-134978279 AAAGGTCACATCCAAATAGAGGG - Intergenic
981559699 4:146033416-146033438 CCAGATCCCATGCAAATTGAAGG - Intergenic
981795544 4:148590648-148590670 ACATGTCCCATGCTCATGGATGG - Intergenic
982267256 4:153549373-153549395 AAATGTCATATGGAAGTTGATGG + Intronic
983145725 4:164212617-164212639 CAATCTCCCATGGATATTGAAGG - Intronic
983873481 4:172849360-172849382 AAATGTCTCATTCAAAATGAGGG + Intronic
986057293 5:4150995-4151017 TAATGTCCCTTGGATATTGAGGG + Intergenic
986229999 5:5854605-5854627 AACTGATCCATACAAATTGAAGG + Intergenic
986523732 5:8649799-8649821 AGATGTCCCAGGCAGATTTAGGG - Intergenic
987685991 5:21202140-21202162 AAAAGTCACATGAAAATTAATGG + Intergenic
990250416 5:53908559-53908581 AAATGCCCCATGGATACTGAGGG + Intronic
995245364 5:109929297-109929319 AAATGGCCTCTGCAAATAGACGG - Intergenic
995888958 5:116928419-116928441 AAATCTCCCATGGACACTGAGGG + Intergenic
996033312 5:118731088-118731110 AAGTGTCCCATGCAAATGAGGGG - Intergenic
997470044 5:134112579-134112601 AAATGTCCAAAGAAACTTGAGGG + Intergenic
997473670 5:134130566-134130588 AAATGCCCCATGTGAATTAATGG + Intronic
998407596 5:141882891-141882913 AGCTGCCCCATGCAAACTGAGGG + Intergenic
999077225 5:148807717-148807739 AATTGTCACATGCAAATTGGAGG - Intergenic
999862483 5:155663387-155663409 AAATGTGCCATCCAAAGAGAAGG - Intergenic
1000896853 5:166865687-166865709 AAATGTGCAGTTCAAATTGAAGG + Intergenic
1000953476 5:167514105-167514127 AAATGTCCTATGCAAAGTCATGG - Intronic
1001670544 5:173469783-173469805 ATATGTCCCATGCTCAGTGATGG + Intergenic
1001679065 5:173543048-173543070 CAATGGGCCATGGAAATTGAGGG + Intergenic
1003005051 6:2373498-2373520 AAATGTCCCCTCCAAAATAAAGG + Intergenic
1003269700 6:4596872-4596894 ACCTGTCCCATGCTAATGGATGG - Intergenic
1004046805 6:12033183-12033205 AAATGTGCTAAGCACATTGAAGG + Intronic
1007293022 6:40801341-40801363 AAATGTCTAATGCCTATTGATGG - Intergenic
1007832530 6:44649524-44649546 ATATGTCACACCCAAATTGAGGG + Intergenic
1009454288 6:63837055-63837077 GAATGTCACATGTGAATTGATGG - Intronic
1012138836 6:95594899-95594921 AAATGTCCTGGCCAAATTGAAGG - Intronic
1012160826 6:95883873-95883895 AAATGTACCTTGTAAAATGAGGG - Intergenic
1013795952 6:113888969-113888991 AAATGCCCATTGCAAAGTGATGG - Intergenic
1013970434 6:116011701-116011723 GAGTGTGCCCTGCAAATTGAAGG - Intronic
1014056407 6:117020591-117020613 AAATATGCCTTGCAAATAGAAGG + Intergenic
1017167393 6:151422432-151422454 AAATCTCCCATGGATACTGATGG + Intronic
1017521463 6:155206659-155206681 AAATGACACATCCAAATTGAGGG + Intronic
1018494300 6:164332897-164332919 AAATGTCCCATGTAAGTTTTAGG - Intergenic
1020587440 7:10086651-10086673 CAATCTCCCATGGATATTGAGGG - Intergenic
1020664899 7:11028135-11028157 AAATGTTCCAAGCATATTAAAGG - Intronic
1020702837 7:11504759-11504781 AAATGTATCAGGCAAATGGATGG - Intronic
1020915220 7:14184461-14184483 ACAGCTCCCATGCAAACTGAAGG - Intronic
1021081865 7:16374160-16374182 AATTGTCCCACCCACATTGAAGG - Intronic
1021962248 7:25884722-25884744 AAATGTCTCATGCAAAGGAAAGG - Intergenic
1026246323 7:68623161-68623183 AAATGTCCTATTTCAATTGAAGG + Intergenic
1027294813 7:76758476-76758498 CAATTTCCCATGGATATTGAGGG - Intergenic
1027649335 7:80846037-80846059 AAATATTTCATGCAAATTCAGGG + Intronic
1027688484 7:81309303-81309325 AAATTTTCTATGCACATTGAAGG + Intergenic
1028704772 7:93828725-93828747 AAATGTTCCAAGCACATTTAAGG + Intronic
1028919886 7:96299191-96299213 AAATGTGCTATGAAAATTGAGGG - Intronic
1029049112 7:97665232-97665254 AAATGTCTCAAGCATATTTATGG + Intergenic
1030445185 7:109640248-109640270 AAATGTCCTGTACATATTGAAGG + Intergenic
1031345413 7:120659695-120659717 CAATGTCCCATGTATACTGAGGG - Intronic
1032501375 7:132402780-132402802 ACCTGTCTCATGCAAAGTGATGG - Intronic
1032943529 7:136823568-136823590 ATATGTCCCTTGCAATTTGGGGG - Intergenic
1033916044 7:146327612-146327634 AAATGCCCAATGCATTTTGAAGG + Intronic
1034149565 7:148903659-148903681 AAGTATCACATGCAAATTCAAGG + Intergenic
1035015250 7:155760140-155760162 AAATGTCTCATGCACACAGAAGG - Intronic
1039067571 8:33622342-33622364 TAAAGTGCTATGCAAATTGAGGG + Intergenic
1039831333 8:41217465-41217487 AAATATCCCTTCCAAATTGAAGG + Intergenic
1040586506 8:48748362-48748384 AAATGTCCCAGCCAATTGGATGG - Intergenic
1040790318 8:51221309-51221331 AAATATCCCATGCTCATGGAAGG + Intergenic
1043617114 8:82139606-82139628 AAATGCCCCATGGATACTGAGGG - Intergenic
1044155691 8:88843630-88843652 TAACTTCCAATGCAAATTGAGGG + Intergenic
1044845875 8:96380677-96380699 GACTTTCTCATGCAAATTGATGG + Intergenic
1047080628 8:121455830-121455852 AAATGGCCTTAGCAAATTGAGGG + Intergenic
1047842723 8:128771233-128771255 AAATTTCCCATACTCATTGATGG + Intergenic
1048732994 8:137464501-137464523 GAATTTGCCAGGCAAATTGAGGG + Intergenic
1048912778 8:139152030-139152052 AAATCTCCCATGAAAAATCAGGG - Intergenic
1052608825 9:30742274-30742296 AAAAATCCCATGTAAATAGAAGG - Intergenic
1052627510 9:30996034-30996056 AAATGTCCCATACATATTTTAGG + Intergenic
1053310895 9:37018852-37018874 AAATCTCCCATGGAGATTGAGGG - Intronic
1055859998 9:80737942-80737964 CAATGTCCCATGAATTTTGAGGG - Intergenic
1056614307 9:88150269-88150291 AAATGTTCCATCCAAATGCATGG + Intergenic
1058301782 9:103382490-103382512 AAATGTTCCATGACAATTAATGG + Intergenic
1059532981 9:115054673-115054695 CAATGTTCCATGCAAAATGAGGG + Intronic
1059581930 9:115558621-115558643 AAATGTTCCAGGCACTTTGAAGG + Intergenic
1059806473 9:117806346-117806368 AAATGTGCCATTCAGAATGAGGG - Intergenic
1186901695 X:14064277-14064299 AAATATCCCATAGAAATTAATGG + Intergenic
1187640762 X:21286501-21286523 AAAAATCCCTTGTAAATTGAAGG - Intergenic
1189595303 X:42558572-42558594 AAATTTCCCATGCTCATGGATGG + Intergenic
1189782051 X:44524754-44524776 AAATGTCCCTGACTAATTGAAGG + Intronic
1192930041 X:75797306-75797328 AATTTTACCAAGCAAATTGAAGG - Intergenic
1194005899 X:88491441-88491463 AATTCTCCCACCCAAATTGATGG - Intergenic
1194012206 X:88576171-88576193 ATATGTCCCATGCTCATGGATGG - Intergenic
1195389858 X:104350355-104350377 AAATGACCAATACAAATGGATGG - Intergenic
1197422327 X:126253636-126253658 AAATATTCCATGCTCATTGATGG - Intergenic
1197920858 X:131592234-131592256 CAATGTCCCATGCATATTTAGGG - Intergenic
1198841565 X:140863240-140863262 AATTTTCCCATGTAATTTGAGGG + Intergenic
1198865236 X:141115457-141115479 GAATATCACATGCAAAATGAGGG + Intergenic
1199690636 X:150306591-150306613 AAAGGCCCCATGCAGAGTGAGGG - Intergenic
1201014605 Y:9587676-9587698 GAATATCACATGCAAAATGAGGG + Intergenic
1201597573 Y:15688883-15688905 ATATGGCCCAAGGAAATTGAGGG - Intergenic