ID: 908626564

View in Genome Browser
Species Human (GRCh38)
Location 1:66050792-66050814
Sequence GTAACGATGATGCTCCTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908626564_908626565 6 Left 908626564 1:66050792-66050814 CCGTGAAGGAGCATCATCGTTAC No data
Right 908626565 1:66050821-66050843 AACAAATGCTGCCCCTGTCATGG 0: 1
1: 0
2: 1
3: 16
4: 151
908626564_908626567 17 Left 908626564 1:66050792-66050814 CCGTGAAGGAGCATCATCGTTAC No data
Right 908626567 1:66050832-66050854 CCCCTGTCATGGACATCCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908626564 Original CRISPR GTAACGATGATGCTCCTTCA CGG (reversed) Intronic
No off target data available for this crispr