ID: 908629942

View in Genome Browser
Species Human (GRCh38)
Location 1:66092718-66092740
Sequence GCATTTAAGCTGAGAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 744
Summary {0: 1, 1: 1, 2: 14, 3: 102, 4: 626}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908629941_908629942 3 Left 908629941 1:66092692-66092714 CCAGGGATAGCTTCTCAAAGGAA 0: 1
1: 0
2: 3
3: 25
4: 221
Right 908629942 1:66092718-66092740 GCATTTAAGCTGAGAGATGAAGG 0: 1
1: 1
2: 14
3: 102
4: 626
908629937_908629942 29 Left 908629937 1:66092666-66092688 CCTCTTCTGATCTGGGGGTAGAG 0: 1
1: 0
2: 0
3: 4
4: 166
Right 908629942 1:66092718-66092740 GCATTTAAGCTGAGAGATGAAGG 0: 1
1: 1
2: 14
3: 102
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908629942 Original CRISPR GCATTTAAGCTGAGAGATGA AGG Intronic
900630202 1:3631067-3631089 GCATTTAAGCGGAGACTCGATGG - Exonic
901124066 1:6917022-6917044 GTGTCTAAGCTGAGACATGAAGG + Intronic
902258803 1:15208294-15208316 GCATTTAAGCTGAGAGACAGAGG + Intronic
902308253 1:15560207-15560229 ACATTTCAGCTGAGACCTGAAGG + Intronic
902755637 1:18547608-18547630 GCATTTAAGCTGAGCATTGAAGG + Intergenic
902780096 1:18699365-18699387 GCATTTCAGCTGAGCTCTGAAGG + Intronic
902951080 1:19883048-19883070 ACATTTAAGCTGAGTTCTGAAGG + Intronic
903307906 1:22426650-22426672 ACATTTGAGCGGAGACATGAAGG + Intergenic
903372094 1:22842866-22842888 GCATCTGAGCTGAGACCTGAAGG - Intronic
903374609 1:22858083-22858105 GCATTTAAGCTGGGGTCTGAAGG + Intronic
903405139 1:23089524-23089546 ACATTTAAGAGGAGAGATAAAGG - Intronic
903983347 1:27205812-27205834 GCATTTTAGCTGAGAGCTGCAGG + Intergenic
904262958 1:29300949-29300971 TCATTTCAGTTGAGAGTTGAAGG + Intronic
904953208 1:34261145-34261167 GCATTTGAACTGAGACTTGAAGG + Intergenic
905267630 1:36765653-36765675 GCATTTGAGCTGAGATTTGAAGG + Intergenic
906004051 1:42454044-42454066 ACATTTAAACTGAGAACTGAAGG + Intronic
906098068 1:43237597-43237619 GCATTTGAGCTGAGCCTTGAAGG + Intronic
906276144 1:44517385-44517407 GCATTGAAGCTAAGATCTGAAGG - Intronic
906410250 1:45573280-45573302 GGATTCAATCTGTGAGATGAGGG - Intergenic
906660293 1:47577202-47577224 ACACTTAAGCCGAGAGTTGAAGG + Intergenic
906660732 1:47579544-47579566 ACATTTGAGCTGAGAGCTGAAGG - Intergenic
906922035 1:50075066-50075088 ACATTTAAGCAGAGACATAATGG + Intronic
907122743 1:52021881-52021903 TCATGTCAGCTGAGAGATGGAGG + Intronic
907313575 1:53553702-53553724 GCATTCAAGCAGAGAAATCAAGG + Intronic
907593710 1:55700508-55700530 GCAATCAAGCTGAGACCTGAGGG - Intergenic
907661042 1:56392644-56392666 ACATTTGAGCTGAGACTTGAGGG - Intergenic
907708979 1:56860185-56860207 GCATTTAAACTGAGATGTGAAGG + Intronic
907788192 1:57634932-57634954 GCATTTGAGCAGAGATCTGAAGG + Intronic
908405410 1:63809621-63809643 GCATCTAAGCAGAGAGACCATGG + Intronic
908629942 1:66092718-66092740 GCATTTAAGCTGAGAGATGAAGG + Intronic
908763719 1:67535669-67535691 CCTTTCAAGCTGAGTGATGAGGG - Intergenic
908766156 1:67556306-67556328 GTATTTAGGCTGAAAGTTGAAGG - Intergenic
908986577 1:70031003-70031025 GCCTTTAAGCTGAAACTTGAAGG - Intronic
909731481 1:78896982-78897004 GCATTTAAACAGAGTGATGAGGG - Intronic
909821773 1:80072681-80072703 TCATTTAAGCTGTGAAATAATGG - Intergenic
910067890 1:83175212-83175234 GAATTTAAGATGAGAAATGATGG + Intergenic
910104619 1:83618346-83618368 GCATTTAAGCTCAGATTTGGGGG - Intergenic
910129508 1:83886796-83886818 GCATTTCAGGTGAGAGTTAAAGG - Intronic
910231214 1:84988956-84988978 TCATTTGTGCTGAGAGATGAAGG - Intronic
910332659 1:86093166-86093188 ACACTTAAGCTGACTGATGAAGG + Intronic
910686827 1:89926105-89926127 GGTTTTGAGCTGAGAGATGAAGG - Intronic
910898740 1:92096308-92096330 GCATTTAAGCTGAGTAAGGAGGG - Intronic
911585347 1:99683927-99683949 TCATTTGAGCAGAGACATGAAGG - Intronic
911688868 1:100808649-100808671 ACATGTAAGCTGAGAATTGAAGG + Intergenic
912167022 1:107054142-107054164 ACATTTAAGTTGAGACATGAAGG + Intergenic
912721226 1:112022045-112022067 CCATTGAAGCTGAGACCTGAAGG - Intergenic
913163108 1:116163182-116163204 GCAGTGAAGCTGAGGGAGGATGG + Intergenic
915797326 1:158751190-158751212 GCATTTAAGTAGAGAAATTATGG - Intergenic
916490741 1:165300169-165300191 GGATTTCAGCTGAGAGTTGTAGG - Intronic
916792880 1:168139214-168139236 ACATTTAAGGTGAGATGTGAAGG - Intergenic
916984610 1:170177355-170177377 GCATTTCAGGAGAGAGGTGATGG + Intergenic
917772029 1:178289942-178289964 GTATGTAAGCAAAGAGATGAAGG - Intronic
917793423 1:178514356-178514378 TCCTTTGAGCTGAGAGCTGAAGG + Intronic
918096920 1:181343666-181343688 GCATTTAAGTGGAGAAATCAAGG + Intergenic
919328771 1:196142341-196142363 GCAATTAAGCTAAGAATTGAAGG + Intergenic
919970861 1:202577049-202577071 GCATTGCAGCTGAGGGAGGAAGG + Intronic
919971723 1:202584783-202584805 GCATTTAAGCAGAAAGAAAAGGG + Exonic
920237636 1:204518992-204519014 ACATTTAACCTGAGACTTGAAGG + Intronic
920541289 1:206780064-206780086 ACATCTGAGCTGAGAGCTGAAGG - Intergenic
920766212 1:208836278-208836300 GCATTTAAACTGAGACGGGAAGG + Intergenic
921068542 1:211640026-211640048 GGATATAAGCTCAGAGGTGAAGG + Intergenic
921090806 1:211840582-211840604 GCAATTAAGCTGGGATGTGAAGG + Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921468504 1:215520728-215520750 CCATCAAAGCTGAGATATGAAGG - Intergenic
921836224 1:219781719-219781741 ACATTTGAGCTGAGACTTGAAGG - Intronic
922027304 1:221762344-221762366 GCATTTAAGCTCAGAACTGAAGG - Intergenic
923333375 1:232946306-232946328 GCATCTGAGCAGAGAGTTGAAGG - Intergenic
923603866 1:235425836-235425858 GCATCTGAGCAGAGAGCTGAGGG - Intronic
924311496 1:242748108-242748130 GCATTTAAAAAGAAAGATGAAGG - Intergenic
924387265 1:243510525-243510547 ACATGTAAGCTTAGAGCTGAAGG + Intronic
924434292 1:244025078-244025100 GCATTTCAGATGAGGGATTATGG - Intergenic
1062792744 10:319862-319884 TGTTTTAAGATGAGAGATGAAGG - Intronic
1064054403 10:12085351-12085373 GGATTTAAGCTCAGAGTTAATGG - Intronic
1064061491 10:12141198-12141220 TCATTTAAAGTGAGAGGTGAGGG - Intronic
1064661387 10:17611390-17611412 GCATTTAAACTGAGCGGTGAAGG - Intronic
1064776263 10:18780959-18780981 GTATTTGAGTTGAGAGCTGAAGG + Intergenic
1064816700 10:19273564-19273586 GCTGTCAAGCTGAGATATGAAGG + Intronic
1065277147 10:24096723-24096745 GCATTTCAGCTGAGGCCTGAGGG - Intronic
1065417187 10:25501296-25501318 GCATTTAAGCTGAGACTTGAAGG - Intronic
1066043682 10:31578456-31578478 CATTTTAGGCTGAGAGATGAGGG - Intergenic
1066232131 10:33446109-33446131 GCATATAAACTGAAGGATGATGG - Intergenic
1067720587 10:48724986-48725008 GCATTTAACCAGAGAGCTGAGGG + Intronic
1067731242 10:48812939-48812961 GCATCTAAGCTGAGTGCTGAGGG - Intronic
1067964068 10:50889230-50889252 ACATTTAAGCTGAGACCTGAAGG + Intergenic
1069411612 10:68160109-68160131 CCATTTAAACTGAGAGATGCCGG + Intronic
1069678929 10:70269973-70269995 ACATTTATGCTGAGAGCTAAAGG - Intronic
1069802493 10:71090743-71090765 GTATCTAAGATGAGGGATGAGGG + Intergenic
1069862234 10:71478979-71479001 GCATTTGGGTTGAGAGAGGAAGG + Intronic
1069862521 10:71480522-71480544 GCATTGGAGCTGAGACTTGAGGG + Intronic
1070345743 10:75540212-75540234 ACATTTAAGCAAAGAGCTGAAGG + Intronic
1070357960 10:75658923-75658945 GCATTCAAGCTGAGTGCTGTGGG + Intronic
1070373822 10:75810031-75810053 ACATTTGAGCTGAGATGTGAGGG + Intronic
1070380060 10:75872741-75872763 GCATTTAAGCTTGGACTTGAAGG - Intronic
1071257643 10:83886724-83886746 ACATTTTAGCTGAGACTTGATGG + Intergenic
1071345738 10:84690453-84690475 GCCTTGAAGGTAAGAGATGAAGG + Intergenic
1071727276 10:88211911-88211933 GCAATTCAGATAAGAGATGATGG + Intergenic
1071749656 10:88460400-88460422 TCATTTAAGCTGAGAACTAAAGG - Intronic
1071797732 10:89024188-89024210 ACCTTTAAGCAGAGAGATGGAGG + Intergenic
1072710305 10:97712182-97712204 GCATTTAAACTGAGCCTTGAAGG + Intergenic
1072817887 10:98527531-98527553 GCACTTAAGCAGAGACCTGAGGG - Intronic
1073007996 10:100339392-100339414 GCACATGAGGTGAGAGATGAAGG - Intergenic
1073088900 10:100915930-100915952 CCATTTAATCTGAGTTATGAAGG + Intronic
1074712389 10:116188191-116188213 GTATTTAAGCTGAGACCTGTGGG + Intronic
1074976217 10:118583984-118584006 ACATTTAAGCTGAGACCTGAAGG + Intergenic
1075330135 10:121567942-121567964 GCATTTGAGCTGAGAAGTGAAGG + Intronic
1076057506 10:127387498-127387520 ACATTTAAGCTGAGACAGGAAGG - Intronic
1076388846 10:130080849-130080871 GCATTAAAAATGGGAGATGAGGG + Intergenic
1077607919 11:3624814-3624836 GCATTTAAGCTGAGACCTGAAGG - Intergenic
1077609156 11:3633698-3633720 GCATTCAAGCTGAGCTCTGAAGG - Intergenic
1077637068 11:3850235-3850257 TCATTTGAGCTGAGACTTGAAGG + Intergenic
1078251009 11:9616556-9616578 ACATTTGAGCAGAGACATGAAGG + Intergenic
1078567165 11:12426234-12426256 ACATTTAAGCTGAGAGCTGAAGG + Intronic
1078606731 11:12783834-12783856 GCTTGTAAGCTGAGAGGTTACGG + Intronic
1079057342 11:17217692-17217714 ACATTTAACCAGAGATATGAAGG - Intronic
1080438053 11:32264479-32264501 ATATTTAAGCTGAGATATGCTGG + Intergenic
1080686462 11:34519670-34519692 GCATTTGAGTTGGGTGATGAAGG + Intergenic
1080689444 11:34544279-34544301 GCATTTTAGTTGGAAGATGAAGG + Intergenic
1080931232 11:36813528-36813550 ACATTTAAGCTAAGACCTGAAGG - Intergenic
1081144547 11:39546472-39546494 GTATTCTAGATGAGAGATGATGG - Intergenic
1081388309 11:42499477-42499499 TAATTTCAGATGAGAGATGATGG - Intergenic
1082014484 11:47474385-47474407 ACATTTAAGCAGAGAACTGAAGG - Intronic
1082183090 11:49144219-49144241 ACATGTAAGCTGAGACCTGAAGG + Intergenic
1082213747 11:49540306-49540328 TCATTTAAGCTGAGATCTAAAGG + Intergenic
1083028557 11:59571252-59571274 GCATGTGAGCTGAGAGTTGCAGG - Intergenic
1083614569 11:64019849-64019871 GCATTTGAGCTGAGGCTTGAAGG + Intronic
1084160945 11:67349794-67349816 GCATTTGAGCAGAGACTTGAAGG - Intronic
1085287169 11:75370926-75370948 CCATTGAAGTTGAGTGATGATGG - Intergenic
1085365903 11:75944224-75944246 GCATTTAAGCTCCAATATGAAGG - Intronic
1085522629 11:77147260-77147282 GCATATGAGCTGAGGCATGAAGG - Intronic
1085697166 11:78714804-78714826 GCATTTGAACTGACAGGTGAAGG - Intronic
1086191089 11:84079926-84079948 ATATTTAAGCTGAGACATAAAGG - Intronic
1086487396 11:87322184-87322206 GCATATAAACTGAGCTATGAAGG - Exonic
1086635858 11:89084141-89084163 TCATTTAAGCTGAGATCTGAAGG - Intergenic
1086859905 11:91913610-91913632 GCATGTAAGCTGAGTGAGGAAGG + Intergenic
1086981291 11:93200288-93200310 ACACTTAAGCTGACACATGAAGG + Intergenic
1086984709 11:93235213-93235235 ACAGTTAAGCTGAGACCTGAAGG - Intergenic
1087285101 11:96256469-96256491 GTATTTAAGCTGAGATCTGAAGG - Intronic
1087786952 11:102366025-102366047 AAATTTAAGCTGAGCTATGAGGG - Intronic
1087940868 11:104095101-104095123 GTATTTAAACTGAGATCTGAAGG - Intronic
1089302882 11:117509222-117509244 GAATTTGAGCTGAGAGTTAAAGG + Intronic
1089606917 11:119646735-119646757 GCAGATAAACTGAGAGATGGAGG - Intronic
1089761386 11:120726736-120726758 GCATAGAAGTTGAGAGATGCAGG + Intronic
1090478158 11:127043318-127043340 TCGTTTAAGCTGAGAGCTAAAGG + Intergenic
1090738853 11:129638085-129638107 GCTTCTAAGCTGAGACTTGAAGG - Intergenic
1090878170 11:130809851-130809873 GTATTTGAGCTGAGAAATGGAGG + Intergenic
1091171655 11:133525231-133525253 GCATTTAAGCTGAGTTCTGAAGG + Intronic
1093019161 12:14187128-14187150 GCATTTAGGCTGAGACTTGAAGG + Intergenic
1093715338 12:22375713-22375735 GGATTCAATCTGTGAGATGAAGG + Intronic
1093959907 12:25260755-25260777 GCATTTCAGCACAGAGCTGAAGG - Intergenic
1094348168 12:29494740-29494762 GCATTTTAGCTCACACATGAGGG - Intronic
1095671886 12:44871164-44871186 TCATTTAAGCTGATAGTTGAAGG - Intronic
1097841324 12:64324455-64324477 ACATTTAAGCTAAGATCTGAAGG + Intronic
1097881889 12:64693999-64694021 GCATTTAAGCTGAGATGGGGAGG + Intronic
1098770674 12:74548998-74549020 GTATTTAAACTGAGAACTGAAGG + Intergenic
1099177931 12:79443269-79443291 ACATTTAAGCTGAGATGTGAAGG - Intronic
1099361199 12:81703875-81703897 ACATTTAAGCTGAGGTCTGAAGG - Intronic
1100271902 12:93033821-93033843 ACATTTAAGCTGAGAACTGAGGG - Intergenic
1100388390 12:94124761-94124783 GCTTTTAAGCTGAGACCTGCAGG + Intergenic
1100532342 12:95472175-95472197 GCAATTAGGCTGAGATCTGAAGG - Intergenic
1101027868 12:100631193-100631215 ATATTTAAGCTGAGACACGAAGG - Intergenic
1101060170 12:100962856-100962878 GTATTCAAGAAGAGAGATGATGG + Intronic
1101221524 12:102646330-102646352 GTATTTGAGCTGAGACTTGAAGG + Intergenic
1102097025 12:110249090-110249112 GCTTTTGAGGTGATAGATGAGGG + Intergenic
1102173524 12:110859932-110859954 ACATTTAAGTTGAGACCTGAAGG - Intronic
1102550801 12:113690759-113690781 ACATTTAAGCTGAGACCTGAAGG + Intergenic
1102885778 12:116520541-116520563 ACATTCAAGATGAGAGCTGAAGG - Intergenic
1103180398 12:118906308-118906330 ACATTTAGGCTGAAATATGAAGG + Intergenic
1103201117 12:119088716-119088738 ATAGTTAAGCTGAGATATGAAGG + Intronic
1103958831 12:124594757-124594779 GCATTTTAGCTGATAAGTGAGGG + Intergenic
1104090600 12:125513689-125513711 GCATCTGAGCTGAGACCTGAAGG - Intronic
1104524259 12:129503425-129503447 GAATTTAAGCTGAATGATAAAGG + Intronic
1105236681 13:18562791-18562813 GAATATTAGCTGAGAGAGGAAGG + Intergenic
1106257068 13:28031636-28031658 GTGTTTAAGCTGAGATCTGAGGG + Intronic
1106654877 13:31732455-31732477 ACATTTAAGATGAAATATGAGGG - Intergenic
1106775279 13:33002708-33002730 GCATTTCAGCAGAGACCTGAAGG - Intergenic
1107406588 13:40120163-40120185 GCAGTTCAGCTGGGAGCTGACGG + Intergenic
1107666563 13:42696883-42696905 GCATTTGAGCTTAGACTTGAAGG + Intergenic
1107950629 13:45458371-45458393 ACATTAAAGCTGAGAACTGAGGG + Intergenic
1108292174 13:48972932-48972954 GCTTTCAAGCTGAGACCTGAAGG + Intergenic
1108322547 13:49302406-49302428 GTATTTAAGCTGAGAGAGCAAGG + Intergenic
1108368645 13:49744914-49744936 ACATTTAAGCTGAAACCTGAAGG - Intronic
1108376325 13:49817528-49817550 GCATTTCAGCTAATAGATGAAGG - Intergenic
1108726830 13:53192133-53192155 TCATTTAAGCTGAGGGCTAAGGG - Intergenic
1109277722 13:60321331-60321353 CCATTTAAACTGAAAGAGGAAGG + Intergenic
1109784437 13:67155984-67156006 GTATTTGAGCTGAGACCTGAAGG - Intronic
1111733537 13:92107724-92107746 GCATTAAAGCTTAGAGATAAAGG + Intronic
1112574057 13:100619407-100619429 GCATTTGAACTGAGATAAGAGGG - Intronic
1112688801 13:101864943-101864965 TCATGTAATCTGACAGATGAGGG + Intronic
1112946070 13:104928580-104928602 GAATTTACACTGAGGGATGATGG - Intergenic
1113156422 13:107327892-107327914 ACTTTTAAGCTGAGATCTGAAGG - Intronic
1113326491 13:109286900-109286922 TCATTTGAACTGAGAGGTGAAGG + Intergenic
1114359285 14:21952768-21952790 ACATTTGAGCTGAGACCTGAAGG - Intergenic
1115283452 14:31690745-31690767 GCATAAAAGATGAGGGATGAAGG + Intronic
1115286360 14:31717299-31717321 ACATCTAAGCTAAGACATGAAGG - Intronic
1115448952 14:33524109-33524131 ACATTTAAGCTGAGACCTAATGG - Intronic
1116824240 14:49656696-49656718 GCATTTAAGCTGGGAACTGCAGG - Intronic
1117783405 14:59257907-59257929 GCATTTAAGCTGAGACCTGATGG - Intronic
1118378000 14:65193483-65193505 GAATTCAATCTGTGAGATGAGGG - Intergenic
1118476115 14:66119097-66119119 GCATTTTAGAGGAGAGATGGGGG - Intergenic
1118486948 14:66223458-66223480 GGATTCAATCTGTGAGATGAGGG - Intergenic
1118512361 14:66489440-66489462 ACATTTAAGCTGAGACCTGAAGG - Intergenic
1118965043 14:70573662-70573684 GCATTTAAGCTGAAAGTGAAGGG + Intergenic
1119113456 14:71996721-71996743 ACATCTAAGCTGAGAACTGAAGG + Intronic
1119535015 14:75395903-75395925 ACATTTAAGCTGAGACATGAAGG + Intergenic
1119983329 14:79107290-79107312 ACATTGAAGTTGAGACATGAAGG + Intronic
1120146997 14:80989609-80989631 GCATTTGATCTGAGACTTGAAGG - Intronic
1120583792 14:86286928-86286950 GTATTTAGACTGAGAAATGAAGG + Intergenic
1120930590 14:89844542-89844564 GCATCTAAGCTGGGTGGTGATGG - Intronic
1121383934 14:93499822-93499844 ACATTTAAGCTGATACCTGAAGG + Intronic
1121728440 14:96169855-96169877 GCATTTGAGCTGAGACTTAAAGG - Intergenic
1121957646 14:98228647-98228669 GCATTTAATCTGAGACCTAAAGG - Intergenic
1125653262 15:41334540-41334562 GAATTTAGGCTGAGATATTAAGG - Intronic
1125729436 15:41884682-41884704 GCTTTTACTCAGAGAGATGATGG - Intronic
1126062396 15:44795517-44795539 ACATTTGAGCAGAGAGCTGAAGG + Intergenic
1126131714 15:45348326-45348348 GCATTTAAGCAAAGACCTGAAGG + Intergenic
1126703579 15:51387634-51387656 TCATTTAAACTGAGAGTTAAAGG + Intronic
1126718645 15:51551969-51551991 GTATTTAAACTGAGAGTTGAAGG + Intronic
1126728902 15:51661538-51661560 TCATTTTAGCTGAGACCTGAAGG + Intergenic
1128105567 15:65042189-65042211 ACATTTAAGCTGAGGCTTGAAGG + Intergenic
1128417291 15:67458435-67458457 GTAATTGAGGTGAGAGATGATGG - Intronic
1128451519 15:67808473-67808495 CCATTTGAGCTGAGACCTGAAGG - Intergenic
1129481365 15:75829206-75829228 ACATTTAAGCTGAGACTTGAAGG + Intergenic
1129802501 15:78426337-78426359 TCATATAAGATGAGAGACGAGGG + Intergenic
1130078500 15:80710524-80710546 GTATTTTAGATGAGAGATGCTGG + Intronic
1130099463 15:80881472-80881494 ACATTTGAGCTGAGAAATGAAGG + Intronic
1130623676 15:85490944-85490966 TCATTTAGGCTGAGACCTGAAGG + Intronic
1130965047 15:88690874-88690896 ACATTTCAGCTGAGAGCAGAAGG + Intergenic
1131299418 15:91183170-91183192 GCTTTTGAGTTGAGAGCTGAAGG + Intronic
1131363293 15:91814701-91814723 GCGTTAAATGTGAGAGATGATGG - Intergenic
1131723039 15:95192043-95192065 ACATTTAAGCTGAGATACAATGG + Intergenic
1133333198 16:4988987-4989009 GCACTGAAGCTGAGTGCTGAAGG + Intronic
1133605035 16:7378567-7378589 GCATTTAATCTGGGACATGGTGG + Intronic
1133615188 16:7469494-7469516 ACATGCAAGCTGAGATATGAAGG - Intronic
1133733052 16:8592265-8592287 ACATTGATGCTGAGACATGAAGG + Intergenic
1133928947 16:10216615-10216637 GTATTTAAGTTGAGAGCTGTAGG + Intergenic
1133933971 16:10254117-10254139 GCATTGAAGCTGAGACCTGAAGG - Intergenic
1134030433 16:10988327-10988349 GTACTTGTGCTGAGAGATGAGGG + Intronic
1134309731 16:13064930-13064952 ACATTTGAGCTGAGACCTGATGG + Intronic
1135192545 16:20366785-20366807 GCAATCAAGATGAGAGATGGAGG - Intronic
1135824829 16:25717469-25717491 GCATTTGAGATGAGATCTGAAGG + Intronic
1136082847 16:27864077-27864099 GGATGTAAGCTGGGAGCTGATGG - Intronic
1137778237 16:51074352-51074374 TCATTTGAGCTGAGAGCTAAAGG - Intergenic
1137961680 16:52887612-52887634 ACATTTAAGCAGGGAAATGAAGG + Intergenic
1138446412 16:57066935-57066957 GCATTTAAGCTGAGACCTGAGGG - Intronic
1139275548 16:65724296-65724318 GCATTTAAGAAAAGAGATGTTGG - Intergenic
1139722703 16:68869746-68869768 GCATTTAAACTGAGCCCTGAAGG + Intronic
1140143961 16:72287346-72287368 GCAATTATGTTGAGATATGAAGG + Intergenic
1140349781 16:74251263-74251285 GCATTTAGGCTAAGAGAGGAAGG + Intergenic
1140624072 16:76770806-76770828 ATATCAAAGCTGAGAGATGAGGG + Intergenic
1140990510 16:80206654-80206676 GCACTGAAGCAGAGAGAAGAAGG - Intergenic
1141777609 16:86134700-86134722 GCATTTAAGCTGGGTCTTGAGGG + Intergenic
1142792555 17:2279153-2279175 ACATTTAGGCTGAGACCTGAAGG + Intronic
1143342034 17:6219144-6219166 TCATTTGAGCTGAGAGAGCAAGG - Intergenic
1143560376 17:7690494-7690516 GCATTTGAGCTAAGACCTGAAGG + Intronic
1143746089 17:8995282-8995304 ACATTTAAGTTGAAACATGAGGG - Intergenic
1144029577 17:11307478-11307500 GGCTGAAAGCTGAGAGATGATGG - Intronic
1144030214 17:11313641-11313663 GCATTTAAGCAGGGATTTGAAGG + Intronic
1144517305 17:15927696-15927718 GTAGTTCAGGTGAGAGATGAGGG + Intergenic
1144602765 17:16633026-16633048 ACATTTAAGCCGAGACCTGAAGG - Intronic
1144809655 17:17990552-17990574 ACATTTAATCTGAGACCTGAGGG - Intronic
1146095075 17:29922062-29922084 ACATTTAAGCTGAGACCTGAAGG + Intronic
1146447869 17:32947191-32947213 GCAGTCTAGGTGAGAGATGATGG + Intergenic
1146626720 17:34440476-34440498 GCATTTTAGCTGATTGCTGAAGG - Intergenic
1146817879 17:35958676-35958698 ATATTTAAGCTGAGACATGAAGG + Intergenic
1147185248 17:38709841-38709863 GCATTTAAGCTGAGTGGAGGTGG + Intronic
1147991012 17:44333515-44333537 AGGTCTAAGCTGAGAGATGAGGG + Intergenic
1148259012 17:46162976-46162998 ACATGTAAGCTGAGACCTGAAGG - Intronic
1148521074 17:48275492-48275514 GTATTAAAGCTGAGAGTTAAAGG - Intronic
1148724493 17:49778966-49778988 GTATTTGAGCTGAGATCTGAAGG + Intronic
1148780837 17:50120807-50120829 GCATTTAAGCGAAGACTTGAAGG - Intronic
1149102333 17:52921933-52921955 GGATTCAACCTGTGAGATGAGGG - Intergenic
1149572666 17:57684788-57684810 GCATTCATGCTGAGGGGTGAGGG - Intergenic
1149727616 17:58912359-58912381 ACATTTAAGCAGAGACTTGAAGG + Intronic
1150201898 17:63365781-63365803 GCATTTAAGCTGAGATCTGAAGG - Intronic
1151177532 17:72301053-72301075 TCATTTCACCTGAGAGATGAAGG - Intergenic
1151181512 17:72332402-72332424 GCATTTGAGCTGAGCCTTGAAGG + Intergenic
1151297701 17:73197694-73197716 GCCTTTAACCTGAAAGCTGAAGG + Intronic
1154167462 18:12026839-12026861 GCACTGAAGCTGAGCTATGAGGG - Intronic
1155035041 18:22018923-22018945 GCAGTTCAGGTGGGAGATGATGG + Intergenic
1155606849 18:27615989-27616011 GGATTCAATCTGTGAGATGAGGG + Intergenic
1155710328 18:28869396-28869418 TTATTTCAGGTGAGAGATGATGG - Intergenic
1155906959 18:31463149-31463171 TCATCTAAGCTGAGTGTTGAAGG - Intronic
1156289994 18:35739397-35739419 TCATTTGAGCTGGGAGGTGAAGG - Intergenic
1156336301 18:36175522-36175544 ACATTTAAACTGACAGATGTAGG + Intronic
1156649632 18:39210009-39210031 GCATCTTAACTTAGAGATGAAGG + Intergenic
1156765642 18:40651527-40651549 GCATTTATTCTGAGAAATGATGG - Intergenic
1157254513 18:46126398-46126420 GCATATAAGCTGAAACATGGAGG + Intronic
1157529988 18:48411707-48411729 GCATTTAGGTTGAGAAAAGAGGG + Intergenic
1157693002 18:49698949-49698971 GCATTGAAGCTGAGCCTTGAAGG - Intergenic
1157728846 18:49986525-49986547 GCACTTGAACTGAGAGAGGAAGG + Intronic
1157952228 18:52052585-52052607 GCATTCAAGTGCAGAGATGAAGG + Intergenic
1158059630 18:53323747-53323769 GCATTTAAATTGAGACCTGAAGG + Intronic
1158735822 18:60077528-60077550 GCATTCAATCTGTGATATGAGGG - Intergenic
1159045288 18:63364148-63364170 GTATTTGAGCTGAGATTTGATGG - Intronic
1160661921 19:305304-305326 ATATTTAAGCTGAAACATGAAGG - Intergenic
1162859203 19:13492873-13492895 GCATATCAGCTTAGAGATGGAGG - Intronic
1162865732 19:13545285-13545307 GAATTTATCCTAAGAGATGATGG - Intronic
1164635113 19:29786115-29786137 GCATCTAAGCTGAGGCCTGAAGG + Intergenic
1165991528 19:39818014-39818036 GCATGTAAGATGAGATCTGAAGG - Intergenic
1166194318 19:41196128-41196150 ACATTTAAGCCGGGACATGAAGG + Intronic
1167018695 19:46858880-46858902 GACTTCAAGCTGAGAGTTGAAGG + Intergenic
1167533424 19:50033239-50033261 GCATTTCAGCAGAGAACTGAGGG + Intronic
1168115708 19:54220490-54220512 GCCTTTGAGCTCAGAGAGGACGG + Intronic
1168118694 19:54240236-54240258 GCCTTTGAGCTCAGAGAGGACGG + Intronic
925627078 2:5852277-5852299 ACATTTAAGCTGAGATAAGAAGG + Intergenic
926702962 2:15816288-15816310 GCATATAAGCAGTGATATGACGG - Intergenic
926959165 2:18335144-18335166 ACACTTAATCTGAGAGCTGAAGG - Intronic
927122338 2:19977544-19977566 GCAATTCAGGTGAGAGATTATGG - Intronic
927263688 2:21120545-21120567 GCCTGTAAGCTGAGAACTGAAGG + Intergenic
927279535 2:21291908-21291930 GCATTTGAACTGAGAAATGAAGG - Intergenic
927877434 2:26668121-26668143 GCATTTGAGCTGAGACTTGAAGG + Intergenic
928873391 2:36008567-36008589 ACATTTAACCTGAGATCTGAAGG + Intergenic
929491379 2:42399734-42399756 GCACCTAAGCTGAGAGGGGATGG - Intronic
929938586 2:46313325-46313347 ATATTTAAGCTGAGACCTGAAGG - Intronic
929970069 2:46566507-46566529 GTAATTCAGCTGAGAGAAGATGG - Intronic
930420140 2:51140871-51140893 ACATCTAAGCTGAGATTTGAAGG - Intergenic
930731346 2:54731065-54731087 GCATTTAAGCAGAAACCTGAAGG + Intronic
931667444 2:64619557-64619579 GCATTTCAGCTGAGAACTGGAGG + Intergenic
932132582 2:69201245-69201267 ACATTTAAGCTAAGACAAGAAGG + Intronic
933250333 2:80022437-80022459 GCGTTTGATCTGAGAGCTGAAGG + Intronic
933256920 2:80091696-80091718 TCATTTCAGCTGTGAGGTGATGG + Intronic
933506692 2:83185053-83185075 GCAATTAACGTGAGGGATGAGGG - Intergenic
934604508 2:95683510-95683532 GCCTTTGAGGTGAGAAATGAGGG - Intergenic
934681750 2:96288705-96288727 CAATTTCAGCTGTGAGATGAAGG + Exonic
935011197 2:99137699-99137721 GTATTTTAGGTGGGAGATGATGG + Intronic
936044606 2:109176955-109176977 GCATTTTAGGTGAGGTATGATGG + Intronic
936082739 2:109446029-109446051 GAAGTCAAGCTGACAGATGAAGG - Intronic
937031216 2:118742382-118742404 GCATCTGCGCTGAGAGCTGAAGG - Intergenic
937375317 2:121332298-121332320 GCACTTAAGCTGGGACCTGAAGG + Intergenic
937866598 2:126756260-126756282 GCATTTGAGTGGAGAGTTGAAGG - Intergenic
938513107 2:131971759-131971781 GAATATTAGCTGAGAGAGGAAGG - Intergenic
939269625 2:139921063-139921085 ACATTTAACATGAGAGTTGAAGG - Intergenic
939419174 2:141943953-141943975 GGATTCAATCTGGGAGATGAGGG - Intronic
940415959 2:153420504-153420526 GCCTTTAATTTGAGACATGATGG + Intergenic
940432466 2:153609469-153609491 ACTTTTAAGCAGAGAAATGATGG - Intergenic
940436461 2:153662086-153662108 GGAATTCAGCTGAGAGATGTCGG - Intergenic
940828797 2:158444293-158444315 GGATTTAAGCTGAGAGTTATTGG + Intronic
942087165 2:172454341-172454363 GTTTTTAAGCAGAGACATGAAGG + Intronic
942228493 2:173837616-173837638 ACATTTAAGCTGAGGCCTGAAGG - Intergenic
942357045 2:175127464-175127486 GCAGTCCAGGTGAGAGATGATGG - Intronic
942557174 2:177183864-177183886 TCATTTAACCTGCAAGATGATGG + Intergenic
943181837 2:184554394-184554416 GCATTTGAGCTGAGATTTGCAGG + Intergenic
943360255 2:186910934-186910956 GCAATTCAGCTGAGATCTGAGGG + Intergenic
943754150 2:191540783-191540805 GAATTTAAGCTGAGAATTGCAGG - Intergenic
944054632 2:195510561-195510583 GGATTTATTTTGAGAGATGATGG - Intergenic
945059922 2:205899946-205899968 GTATAGAAGCAGAGAGATGAGGG + Intergenic
945181504 2:207096488-207096510 ACATTTAAGCTGAGATACGAAGG + Intronic
945746742 2:213727697-213727719 GTTTTTAAGCTGAGTGATAAGGG + Intronic
945829893 2:214771067-214771089 GCATTTATGCAGCGGGATGAAGG + Intronic
945942024 2:215959822-215959844 GCATTTGAGCTGAGCCTTGAAGG - Intronic
946701340 2:222417276-222417298 GCCTTCAAGCTGGGAGATTAGGG + Intergenic
947713690 2:232329693-232329715 GTCTTTAAGCTGAGACCTGAAGG + Intronic
947802379 2:232938110-232938132 GCAATTAAGCCCTGAGATGATGG - Intronic
947887693 2:233587627-233587649 AAATTTATGCTGAGACATGAGGG - Intergenic
947964729 2:234269899-234269921 TCATCTGAGCTGAGATATGAAGG + Intergenic
948061557 2:235046174-235046196 GCATTTGAGCTGGCAGCTGAGGG - Intronic
1168832334 20:853426-853448 ATATTTAAGCTGAGATGTGAAGG + Intronic
1168949557 20:1787292-1787314 ACATTTGAGCTGAGACCTGAAGG - Intergenic
1168995476 20:2129771-2129793 GCATTGAAGCCGAGACCTGAAGG + Intronic
1169420947 20:5459314-5459336 GTTTTTGAGCTGAGAGACGATGG + Intergenic
1170154260 20:13255193-13255215 ACATTTAAGCTGAGACTTGAAGG + Intronic
1170192567 20:13658639-13658661 GTAATCTAGCTGAGAGATGATGG + Intergenic
1170855640 20:20051831-20051853 ACCTTTAAGCTGAGACTTGAAGG - Intronic
1171765597 20:29269160-29269182 GCTTCAAATCTGAGAGATGAAGG - Intergenic
1172166509 20:32902983-32903005 GCAGTTCAGGTGGGAGATGACGG - Intronic
1172185823 20:33030529-33030551 ACATTTAGGCTGAGACCTGAGGG - Intergenic
1172211017 20:33198613-33198635 GCATTTGAGCAGAGACCTGAAGG - Intergenic
1172283024 20:33721256-33721278 GCATTTGAGCTGAAACCTGAAGG - Intergenic
1172291455 20:33780124-33780146 ACATTTGAGCTGAGATATGAAGG + Intronic
1172460756 20:35116577-35116599 GCATTTGAGCAGAGACCTGAAGG - Intronic
1172504743 20:35453337-35453359 TCATTTAAGCTGGGACCTGAAGG + Intronic
1172699023 20:36841471-36841493 ACATTTGAGCTGAGACAAGAAGG + Intronic
1172715196 20:36957951-36957973 ACATTTGAGCAGAGAGTTGAAGG + Intergenic
1172816305 20:37689754-37689776 GCAATTAAGCTGAGACCTGAAGG + Intergenic
1173155295 20:40603334-40603356 GTATGTAATATGAGAGATGAAGG + Intergenic
1173316989 20:41953938-41953960 ACATTTAAGCTGAGATTTGACGG - Intergenic
1174260739 20:49293084-49293106 GAATTTTAGCTGAGAGGTGGTGG + Intergenic
1174500266 20:50979157-50979179 ACAGTTCAGCTGAGAGGTGATGG - Intergenic
1174568819 20:51486443-51486465 GCATTTAGGCTGAGACCTGAAGG - Intronic
1174951796 20:55050447-55050469 ATATTTAAGCTGAGACTTGAGGG - Intergenic
1175393162 20:58640011-58640033 GCATTTGAGCTGAGCCCTGAAGG - Intergenic
1176780669 21:13191078-13191100 GAATATTAGCTGAGAGAGGAAGG + Intergenic
1177145430 21:17402298-17402320 GGATTTTAACTGAGATATGAAGG - Intergenic
1177978347 21:27880193-27880215 GAATATTAGCTGAGAGAGGAAGG + Intergenic
1178139416 21:29665659-29665681 GCATGGAAGCTCAGAGCTGATGG + Intronic
1178742070 21:35210589-35210611 GCACTTAAGCTGATAGGTGAAGG - Intronic
1178989020 21:37336257-37336279 TCACTTAAGCTGGGAGATCAAGG - Intergenic
1181294353 22:21823489-21823511 GCATTTAAACAGAGAACTGAAGG + Intronic
1181774138 22:25147593-25147615 ACATTTGAGCAAAGAGATGAGGG - Intronic
1181830296 22:25555164-25555186 ACATTTAAGCTGAGAATGGAAGG - Intergenic
1181871409 22:25902241-25902263 GCATTTTAGTAGGGAGATGATGG + Intronic
1181891544 22:26067816-26067838 ACATTTGAGCTGAGAGTTGAAGG - Intergenic
1182307653 22:29381940-29381962 TCATCTAAGCTGAGATTTGAAGG - Intronic
1182836556 22:33346635-33346657 GCATTTGAGCTCAGCCATGAAGG - Intronic
1183036563 22:35144929-35144951 ACATTTAAAGTGTGAGATGAAGG - Intergenic
1183566864 22:38621832-38621854 GCGTTTGAGCTGAGATTTGAAGG - Intronic
1183715636 22:39532047-39532069 ACATTTCAGCCGAGAGCTGAAGG - Intronic
1183947315 22:41333928-41333950 ACATTTAAGCTGAGACCGGAAGG + Intronic
1184345665 22:43911137-43911159 GAATGTAAGCTGAGAAAGGAGGG - Intergenic
1185058472 22:48593243-48593265 GCATTGGAGCTGGGAGAGGAGGG + Intronic
1185125087 22:49005855-49005877 GTCTTTAAGCTCAGAGGTGATGG + Intergenic
950013349 3:9739414-9739436 GCCTTCAAGCAGACAGATGACGG + Exonic
950536193 3:13580200-13580222 GCATTTCAGTTGAGAGGTGCTGG + Intronic
950790392 3:15466960-15466982 GCATTTGAGCTGAGAGCCAAAGG - Intronic
951467195 3:23014290-23014312 GCATCTAAGCAAAGAGTTGAAGG + Intergenic
951992895 3:28695814-28695836 GCAGTTTAGTTGAGAGTTGATGG + Intergenic
952525611 3:34207314-34207336 ACATTTAAGCAGAGAGCTGAAGG - Intergenic
952626555 3:35412699-35412721 GCAATTAAGTTGAGACAAGAAGG + Intergenic
953633482 3:44640817-44640839 GCAGTTGAGATGAGATATGAGGG + Intronic
954001277 3:47559091-47559113 CCATTTAAGCACAGAGCTGAAGG - Intergenic
954512622 3:51139781-51139803 GCATTTAGGCTAAGATCTGAAGG + Intronic
954856163 3:53645792-53645814 TCATTTAAGCTGAGCCTTGAAGG + Intronic
954941774 3:54379769-54379791 ACATTTAAGCTGAGCTCTGAAGG - Intronic
955140214 3:56261185-56261207 GTGTTTAAGCTGAGACTTGAAGG - Intronic
955153565 3:56393086-56393108 GCATTTTAGCTGTGATATAAAGG - Intronic
955365801 3:58308865-58308887 GTATTTAAACTGAAAGTTGAAGG + Intronic
955419366 3:58721488-58721510 ATATTTAAGCTGAGATCTGAAGG + Intronic
955708659 3:61755372-61755394 GCCTTTGAGCTGAGACATGGAGG - Intronic
955746743 3:62148199-62148221 ACATTTGAGCTCAGACATGAAGG + Intronic
955842040 3:63123023-63123045 ACATTTAAACTGAGACCTGAAGG + Intergenic
956660883 3:71596174-71596196 ACATTTAAGCTGAGACCTGTAGG - Intergenic
957009745 3:74990376-74990398 AAATTTAAGCTGAAATATGAAGG + Intergenic
957012771 3:75027323-75027345 GTATTTAATCTGAGACCTGAAGG + Intergenic
957509742 3:81171887-81171909 GCATTTAACTTGATAGATCAGGG - Intergenic
958809641 3:98845871-98845893 ACTTTTAAGCTGAGAAGTGAAGG - Intronic
959110277 3:102114935-102114957 ACATTTAAGCTGTGACCTGAAGG - Intronic
959754912 3:109885546-109885568 GCACCTAAGCTGAAAGATGCTGG + Intergenic
959963363 3:112326993-112327015 GTAGTTAAGATGAGAGTTGATGG + Intergenic
960031224 3:113056801-113056823 ACATTTGAGCTGAGTGTTGAAGG - Intergenic
960600143 3:119449092-119449114 GTATTTAAGCTGAGACCTAAAGG + Intronic
961018522 3:123485280-123485302 GCCATCCAGCTGAGAGATGATGG + Intergenic
961483024 3:127196227-127196249 GCCCCTAAGCTGACAGATGAAGG - Intronic
962417924 3:135200833-135200855 ACATTTAAGCGGAGAACTGAAGG + Intronic
962796653 3:138855459-138855481 ACATTTAAGCTGAGATCTAAAGG + Intergenic
963008141 3:140745523-140745545 TCATTCAAGCTGAGACCTGAGGG + Intergenic
963457788 3:145567975-145567997 GCATTTGAGATGACAGTTGATGG + Intergenic
963730178 3:148963601-148963623 TGATTTAAGTTGAGAGAGGAAGG - Intergenic
963797798 3:149648571-149648593 GCATCTAAGCTGATATCTGAAGG + Intronic
964209927 3:154215289-154215311 TCATTTAAGCTGAAAGCTGAAGG - Intronic
964381611 3:156103406-156103428 GCATTGAAGCAGAGAGACCAAGG + Intronic
964599033 3:158474776-158474798 GTATTTAAGGTGAGACCTGAAGG - Intronic
964719885 3:159761029-159761051 ACATTTAAGCTGAGACTTGAAGG + Intronic
965301124 3:167006307-167006329 CTATTTAAGCTGAGATCTGAAGG + Intergenic
965632790 3:170750473-170750495 GCATTTGAGCTGAGATTTGAAGG - Intronic
965691761 3:171364794-171364816 ACATTTGAGCTGAGACCTGAAGG + Intronic
966240571 3:177751575-177751597 ACATTTAAGCTGAGACCTGAAGG + Intergenic
966439297 3:179926189-179926211 GGAGTCCAGCTGAGAGATGAGGG - Intronic
966633499 3:182106085-182106107 GCATTTGAGCTGAAACCTGAGGG - Intergenic
966698215 3:182814984-182815006 GCTCTTAAGCTGAAAAATGAAGG + Intronic
966911137 3:184561053-184561075 GCATTCAAGCTGAAATAGGAAGG - Intronic
967387228 3:188923727-188923749 GCATTTGAGCTGAGCCTTGATGG + Intergenic
967904906 3:194491551-194491573 GCATGCCAGGTGAGAGATGAGGG - Intronic
967904935 3:194491674-194491696 GCATGCCAGGTGAGAGATGAGGG - Intronic
967904964 3:194491797-194491819 GCATGCCAGGTGAGAGATGAGGG - Intronic
967904975 3:194491845-194491867 GCATGCCAGGTGAGAGATGAGGG - Intronic
968423069 4:501409-501431 GCATTTAAACTGAGACTGGAAGG + Intronic
969063575 4:4459585-4459607 ACATTTAAGCTGAGACTTGAAGG + Intronic
969086825 4:4662811-4662833 ACATTTAAGCTGAGACCTGCAGG + Intergenic
969234851 4:5858590-5858612 GTAATTCAGCTGAGAGATGAGGG - Intronic
969255704 4:6000370-6000392 GCATTCAACCTGAGAGCTGGTGG + Intergenic
969317786 4:6392496-6392518 GCATTTGAGCAGAGACCTGAAGG + Intronic
969528389 4:7715792-7715814 CCATTTAAGCTGAGACCTGCAGG - Intronic
969858254 4:10017078-10017100 GTATTTGAGCTGAGTCATGAGGG - Intronic
970354604 4:15239442-15239464 GCATTTATGCTGAGATCTGTCGG + Intergenic
970406897 4:15772741-15772763 TCATTGAAGCTGAAACATGAAGG + Intergenic
970625277 4:17870404-17870426 GCATCTAAGCTGAGGCTTGAAGG - Intronic
970830828 4:20337503-20337525 GAATTTAAGATGAGATTTGATGG + Intronic
971069236 4:23071918-23071940 GCATTGAACCTGGGAGGTGAAGG + Intergenic
971305869 4:25480862-25480884 GCATTTAAGCTGAAATATAGTGG + Intergenic
972088323 4:35248665-35248687 ACATTTGAGCAGAGACATGAAGG + Intergenic
972125463 4:35759902-35759924 TCATTTAAGCTGAAATATAAAGG + Intergenic
972163514 4:36254496-36254518 ACATTTAAACTGAGATGTGAAGG + Intergenic
972524207 4:39892130-39892152 CCATTTAAGCTCAAAGATTATGG + Intronic
973163357 4:47046621-47046643 GCAATCAAGCTGAGATATGCAGG + Intronic
973554398 4:52067607-52067629 ACATTTAAGCTGAGACTTGGAGG - Intronic
974098694 4:57393608-57393630 GCATTTGAGCTGAGAGCTCAGGG - Intergenic
974356220 4:60816069-60816091 ACATTTGAGCTGAGACTTGAAGG - Intergenic
974866269 4:67584594-67584616 TGATTTAAGCAGAGAGCTGAAGG + Intronic
974873346 4:67672068-67672090 GTAGTTCAGCTGAGAGATGCTGG - Intronic
974891094 4:67884391-67884413 GCATTTAATCATACAGATGAGGG - Intergenic
974922287 4:68256619-68256641 GCCTTTCAGATGAGACATGAGGG - Intergenic
976106646 4:81625954-81625976 ACATTTAAGCAGAGACCTGAAGG - Intronic
976351422 4:84064349-84064371 ACATTTGAGCTGAGATGTGAAGG + Intergenic
976366044 4:84233297-84233319 GAGTTTGAGCTGAGACATGAAGG - Intergenic
976483903 4:85577786-85577808 TAATTTAACCTGAGAAATGAAGG + Intronic
976945434 4:90760984-90761006 GTATTTAAGCTGAGACTTGAAGG + Intronic
977015797 4:91692157-91692179 GTATTGAAGGTGAGACATGATGG + Intergenic
977358187 4:95972511-95972533 GCATTTAAGCTGAGGCTTAATGG - Intergenic
977431923 4:96940661-96940683 GCAGTTATGTTCAGAGATGAGGG - Intergenic
977706901 4:100081614-100081636 CCATTTAAGTTGAGACTTGAAGG + Intergenic
977774824 4:100904691-100904713 GATTTTGGGCTGAGAGATGATGG - Intergenic
978655503 4:111061201-111061223 CCATTTAAGCTGAGAGGAAAAGG + Intergenic
978685332 4:111435578-111435600 GCAATTAAGGTGAAAGATGATGG - Intergenic
978698990 4:111619504-111619526 ACATTTAAGCTGAGGCTTGAAGG - Intergenic
979191302 4:117862578-117862600 GCAATAAAGCTGATATATGAGGG + Intergenic
979633095 4:122925254-122925276 GCAGTCCAGGTGAGAGATGATGG - Intronic
979927310 4:126583284-126583306 CCATTTCAGCAGAGAGTTGAGGG + Intergenic
980327793 4:131370978-131371000 ACATTTGAGCTGAGACTTGAAGG + Intergenic
980523994 4:133965789-133965811 TTGTTTAAGGTGAGAGATGAAGG - Intergenic
980705433 4:136486992-136487014 GCATTTTAATTGAGAGATAATGG + Intergenic
980826704 4:138082053-138082075 GGATTCAATCTGTGAGATGAAGG - Intergenic
980829917 4:138118265-138118287 TCATTTATGCTGTGAGATAAGGG + Intergenic
982271883 4:153598771-153598793 GCATTAAAGCTGAGAGTGAAAGG + Intronic
982482810 4:155933025-155933047 GCCTTGGAGATGAGAGATGAGGG - Intronic
982693188 4:158571007-158571029 TCATTTAAGCTGAGATCTGGAGG - Intronic
982846711 4:160262158-160262180 GCATTTCAGCTGAAAAAAGAAGG + Intergenic
983916716 4:173300474-173300496 TCATTTAGGCTGAGACCTGAAGG + Intronic
984050593 4:174860175-174860197 GTATTCAAGCTGAGACATGGAGG - Intronic
985363700 4:189203347-189203369 ACATGTGAGCTGAGAGCTGATGG - Intergenic
985410656 4:189680027-189680049 GCTTTTAAGCAGATAGAGGAAGG - Intergenic
986421926 5:7593901-7593923 TCATTTGAGCTGAGAACTGAAGG + Intronic
986609474 5:9552205-9552227 GCATTTGAGATGAGATTTGAAGG + Intergenic
987442176 5:17969199-17969221 TCATTTCAGCTGAGAGGTAAAGG - Intergenic
987452276 5:18100902-18100924 GCATCTAAACTGAGACCTGAGGG + Intergenic
989010792 5:36870203-36870225 GCATTTAATCTAAGAAATAAGGG - Intergenic
989330664 5:40254102-40254124 ACATTTAAGCTGAGGTCTGAGGG - Intergenic
989447362 5:41546005-41546027 GCATAAAATCAGAGAGATGAAGG + Intergenic
989616168 5:43338937-43338959 ACACTTAAGCTGAGACTTGAAGG + Intergenic
989987443 5:50717692-50717714 GCATAGAAACTGAGAGATCATGG + Intronic
990703148 5:58497251-58497273 CCATTTAAGCTGAGACTTGAAGG + Intergenic
991277875 5:64872139-64872161 GCATGGAAGCTGAGATCTGAAGG + Intronic
991494551 5:67214569-67214591 GCAACTGAGGTGAGAGATGATGG + Intergenic
991628196 5:68626753-68626775 ACAGTTCAGGTGAGAGATGAAGG + Intergenic
991645403 5:68795916-68795938 GTAATTCAGGTGAGAGATGATGG - Intergenic
992180126 5:74187910-74187932 GGAGTCAAGCTGAGAGAAGAGGG + Intergenic
993370053 5:87081909-87081931 GCATTGAAGCAGACAGAAGAAGG + Intergenic
993382846 5:87227639-87227661 GTATTTAGGCTGAGACCTGAAGG + Intergenic
994181451 5:96771181-96771203 GTATTTAAACTGAGATATAATGG - Intronic
994913130 5:105939105-105939127 GGATTCAATCTGTGAGATGAGGG - Intergenic
995393916 5:111667157-111667179 ACATTTAAGCTGAGAGGTGAAGG + Intronic
995651208 5:114370587-114370609 ACATTTAAACTGAGACATAAAGG + Intronic
995849957 5:116534532-116534554 ACATTTAAGCTAAGACCTGAAGG - Intronic
996491796 5:124106600-124106622 GTATCTAAGCTCAGTGATGAAGG + Intergenic
996785397 5:127231448-127231470 CCATTTAAGCAGAGACCTGATGG - Intergenic
996863139 5:128087485-128087507 ACATTGAAGCTGAGACCTGAAGG + Intronic
997153565 5:131526627-131526649 GCAGGTAAGCTGAGAGATAGTGG - Intronic
997817384 5:137032507-137032529 GCGGGGAAGCTGAGAGATGATGG + Intronic
997836389 5:137196589-137196611 GCATTCGAGCTGAGACTTGAAGG - Intronic
998193474 5:140045974-140045996 ACATTTAAGCTGAGACTAGAAGG + Intergenic
998478388 5:142440818-142440840 ACATTTAGGCTGAGACCTGAAGG - Intergenic
998504175 5:142658753-142658775 ACATTTAAGTTGAGATTTGAAGG + Intronic
998679942 5:144455735-144455757 GCATTTAAGCACTGAGGTGAAGG + Intronic
998809617 5:145953277-145953299 GCATTTATGCTGATACCTGAAGG + Intronic
998852443 5:146364103-146364125 ACATTTAAGCTGGAGGATGAAGG + Intergenic
998872037 5:146561978-146562000 GTGGTTAAGGTGAGAGATGACGG + Intergenic
999483009 5:151966147-151966169 GCATTTAAGCTGAGACATGTAGG + Intergenic
999766024 5:154741534-154741556 CCATTTAAGCTGAGGCTTGAAGG + Intronic
999806683 5:155087741-155087763 GGATTTCAGCTGAGCTATGAAGG + Intergenic
1000041080 5:157485771-157485793 ACATTTGAGCTGAGACATGAAGG - Intronic
1000342785 5:160290226-160290248 ACTTTTAAGCTGAGATCTGAAGG - Intronic
1000693096 5:164346690-164346712 GCATGTTTTCTGAGAGATGAAGG - Intergenic
1000858958 5:166433516-166433538 ACATTTAAGCTGAGACCTGAGGG - Intergenic
1001365953 5:171140092-171140114 AAATTTAAGCAGAGAGCTGAGGG - Intronic
1001635511 5:173207402-173207424 GCATTTAGGCTGAGTCCTGATGG + Intergenic
1001939916 5:175733114-175733136 GCATTGGAGCTGAGAGGTGTGGG + Intergenic
1002891557 6:1337102-1337124 ACATTTGAGCTGAGATCTGAAGG - Intergenic
1002987019 6:2200370-2200392 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987029 6:2200450-2200472 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987055 6:2200690-2200712 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987064 6:2200770-2200792 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987074 6:2200850-2200872 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987083 6:2200930-2200952 GCATGTTAGCAGAGAGATGAAGG + Intronic
1002987112 6:2201170-2201192 GCATGTTAGCAGAGAGGTGAGGG + Intronic
1002987121 6:2201253-2201275 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987129 6:2201333-2201355 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987136 6:2201413-2201435 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987143 6:2201493-2201515 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987153 6:2201573-2201595 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987162 6:2201653-2201675 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987172 6:2201733-2201755 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987202 6:2201973-2201995 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987220 6:2202133-2202155 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987229 6:2202213-2202235 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1003155017 6:3586006-3586028 GCATTCTAGCTAAGAAATGAAGG - Intergenic
1003549405 6:7089072-7089094 ACATATAAGAAGAGAGATGAAGG - Intergenic
1005330500 6:24745354-24745376 GGATTTAAGCGGTGATATGACGG - Intergenic
1005371942 6:25142687-25142709 GCTTCTAAGCTCAGAGCTGAGGG + Intergenic
1006364361 6:33606656-33606678 ACATTTAAGCTGAGCCTTGAGGG + Intergenic
1007392646 6:41559100-41559122 GCATTTATGCTTAGATATGAAGG - Intronic
1007895229 6:45348830-45348852 TCATTTAAGCTGAAACATGAAGG - Intronic
1008440636 6:51528317-51528339 GCATTTGAGTTGAAACATGAAGG - Intergenic
1009262889 6:61517919-61517941 GGATTAACTCTGAGAGATGAAGG - Intergenic
1009833144 6:68964976-68964998 GCCACTAAGCTAAGAGATGATGG - Intronic
1009907033 6:69883056-69883078 ACATTTAAGCAGAGGCATGAAGG + Intronic
1009995015 6:70887768-70887790 GCCTTTAAGCTGAGATTTGAAGG + Intronic
1010244132 6:73647324-73647346 GCTTTCCAGCTAAGAGATGAAGG + Intronic
1010758524 6:79695156-79695178 GCATTTAAGCTTACATCTGAAGG - Intronic
1011111736 6:83845078-83845100 ACATTTAAACTGAGACCTGAAGG - Intergenic
1011143221 6:84183633-84183655 GAATTTAAGCTGAGCAATGAAGG - Intronic
1011429096 6:87266084-87266106 ACATTTAAGCTGTGAACTGACGG - Intergenic
1012278234 6:97298794-97298816 GCATTTAAGCTGAGACCTGATGG + Intergenic
1012749168 6:103135682-103135704 GCACTTGAGCTGAGACTTGAAGG - Intergenic
1013073340 6:106749027-106749049 GCTTCTAAGCTGAGATCTGAAGG - Intergenic
1013228037 6:108134769-108134791 GCCTTTATGCTGAGAGAGCAAGG + Intronic
1013657823 6:112263906-112263928 GCATGTAAGCTGAGAAAAGTGGG + Intergenic
1014105219 6:117553378-117553400 GGATTTAAGATCACAGATGAAGG - Intronic
1015092954 6:129380599-129380621 GCACTTAAACTGAAAGCTGATGG + Intronic
1015544246 6:134345859-134345881 ATATTTAAGCTGAGAGCTGGAGG + Intergenic
1015988210 6:138907634-138907656 GGATTTAAGATAAGAAATGAAGG - Intronic
1016010455 6:139134015-139134037 GTATTTGAGCTGAGACCTGAAGG + Intergenic
1016304405 6:142668571-142668593 GCATTAAAACTCAGAAATGAAGG + Intergenic
1017047360 6:150359872-150359894 GCATTTAAGTGGAGGCATGATGG - Intergenic
1017137783 6:151163407-151163429 GCCTTTCAGCTGAGAGAGCAAGG + Intergenic
1017635674 6:156440648-156440670 GTAGTTTAACTGAGAGATGAAGG - Intergenic
1017648368 6:156559426-156559448 GCAATGCAGATGAGAGATGATGG - Intergenic
1017766632 6:157612233-157612255 ACAGTTAAAGTGAGAGATGATGG - Intronic
1017797257 6:157856952-157856974 GCATTTCAGCTGATAAATGAAGG - Intronic
1017954364 6:159166784-159166806 GCTTTCAATCTGAGAGGTGAAGG - Intergenic
1019273676 7:164719-164741 GGATTTAATCTTAGAGACGAAGG - Intergenic
1019489773 7:1306885-1306907 TCATTTAAGCTGAGACCCGAAGG + Intergenic
1020708815 7:11579641-11579663 GTATTTAAGCTGGGAAATTAGGG - Intronic
1021055181 7:16038003-16038025 GTATTTGAGCTGAGACCTGAAGG - Intergenic
1021383109 7:19992577-19992599 GCATTTAAGCAGAGATTTCAAGG + Intergenic
1022010070 7:26301046-26301068 ACAACTAAACTGAGAGATGATGG - Intronic
1023677093 7:42642232-42642254 GCATTTAAGTTAAGATGTGAAGG + Intergenic
1023781626 7:43661050-43661072 GCATTTGAGCTGAGACTTAAAGG - Intronic
1023949432 7:44830586-44830608 GCACTTAAGCAGAGAGAAGAAGG - Intronic
1024231056 7:47363894-47363916 GGATCTAAGCTGAAAGAGGAGGG + Intronic
1024693148 7:51824944-51824966 GCATTTAAGGTGAGCCCTGAAGG - Intergenic
1024775667 7:52782841-52782863 TAATTTAACCTGAGAGATGATGG + Intergenic
1025245284 7:57312480-57312502 ACATCTCAGCTGAGAGCTGAAGG + Intergenic
1026444430 7:70471762-70471784 GCATTTAAGCGAAGATCTGAAGG + Intronic
1027198240 7:76046252-76046274 GCAGATAAGCTGAGACATGCTGG - Intronic
1027276204 7:76559550-76559572 GAATTTAAGATGAGAAATGATGG - Intergenic
1027372388 7:77519795-77519817 GCATTTAAGCAAAGAGCCGAAGG + Intergenic
1028539281 7:91924593-91924615 AAATTCAAGGTGAGAGATGATGG + Intergenic
1028611699 7:92718908-92718930 TCAGTGAAGCTGAGGGATGATGG - Intronic
1029129084 7:98316495-98316517 GCATTTTGACTGAGAGCTGAAGG - Intronic
1030220336 7:107091970-107091992 GCATTTGAGCAGAGATTTGAGGG + Intronic
1031107863 7:117567946-117567968 ACATTTAAGCTGAGAGAGGATGG + Intronic
1031359349 7:120828561-120828583 GTATTTGAGCTGAGATGTGATGG - Intronic
1031663184 7:124453005-124453027 CTATTTATGTTGAGAGATGAAGG - Intergenic
1031847099 7:126819024-126819046 GCAGTTCAGGTGAGAGCTGAAGG - Intronic
1031875272 7:127132652-127132674 GCATTTAAGCTGAGATTTGAAGG + Intronic
1031928098 7:127657379-127657401 GCATTTGTGCTGAGATCTGATGG + Intronic
1033014051 7:137653615-137653637 GCAATTAAGCTGAGACCTTAAGG - Intronic
1033594112 7:142842383-142842405 GCAGTAAAGCTGGAAGATGAGGG - Intergenic
1033897134 7:146086890-146086912 GCACATAAGCAGAGAGAAGAAGG - Intergenic
1037007488 8:13799995-13800017 TCATTTAAGTTGAGACTTGAAGG - Intergenic
1037156345 8:15704154-15704176 TCATTTAAGCAGAGACCTGAAGG + Intronic
1037516624 8:19638209-19638231 ACATTTGAGCTGAGACCTGAAGG - Intronic
1037591970 8:20320310-20320332 GCTTTTAATCTGAGAAATCAGGG + Intergenic
1039009115 8:33073981-33074003 GCATTTGAGCTGAGTTTTGAAGG + Intergenic
1039331201 8:36538878-36538900 TTATTCAAACTGAGAGATGAGGG - Intergenic
1039586292 8:38710013-38710035 ACATTGAAGCTGAGACCTGAAGG - Intergenic
1041043047 8:53866049-53866071 GCATCTAAGCTGAGACTTGAAGG + Intronic
1041347880 8:56920429-56920451 TCACTTATGCTGAGAGAAGACGG + Intergenic
1041401291 8:57448175-57448197 GAATTCAAACTGTGAGATGAGGG - Intergenic
1041488731 8:58408900-58408922 ACATTTTAGCTGAGTGTTGAAGG - Intergenic
1042435601 8:68761129-68761151 GCATTTAATTTGGGAGAAGAAGG - Intronic
1042917900 8:73893330-73893352 GCCCTTAAGCTGAGAGAAGGTGG + Intergenic
1043194179 8:77269369-77269391 GCATTTAAATTGAGAGTGGAGGG - Intergenic
1043247513 8:78023757-78023779 ACATTTAAACTGAGACTTGAGGG + Intergenic
1043441985 8:80284374-80284396 ACATCTTAGCTGAGACATGAAGG - Intergenic
1044165056 8:88971566-88971588 GCATTTAAGATGAGATATTAAGG + Intergenic
1044407141 8:91840648-91840670 GCCATTCAGCTGAGAGATGGAGG + Intergenic
1044769464 8:95615187-95615209 ATATTTAAGCTGAGATCTGAGGG - Intergenic
1046316342 8:112508010-112508032 GCATTTAAGCTTGGAGATGGAGG - Intronic
1046502832 8:115100201-115100223 TCATTTAAGCTGAGCTCTGAAGG - Intergenic
1046568355 8:115930470-115930492 ATATTTAAGCTGAGATATGAAGG - Intergenic
1046844446 8:118900343-118900365 GCATTTGAGATGAGATATAAAGG + Intergenic
1046950460 8:120015279-120015301 ACATTTAATCTGAGACTTGAAGG - Intronic
1047464717 8:125101262-125101284 GTAGTTCAGCTGTGAGATGAAGG + Intronic
1047594422 8:126363578-126363600 GCATTTCAGCTGACAAATGAAGG + Intergenic
1047633151 8:126730129-126730151 GCATTTAAGCTGAGATCTGAAGG + Intergenic
1048190116 8:132280665-132280687 ACATTTAAGCTGAGAGATGAGGG + Intronic
1048830414 8:138471385-138471407 GCAATAGAGCTGAGAGATGATGG + Intronic
1049003340 8:139839694-139839716 GCATTTCAGCTGTGACCTGAAGG - Intronic
1049145617 8:140999884-140999906 ACATTCAAGCTGAAAGCTGAAGG - Intronic
1050029433 9:1369792-1369814 AAATTTAAGGTGAGAGCTGAAGG - Intergenic
1050136790 9:2473759-2473781 ACATCAAAGCTGAGATATGAAGG - Intergenic
1050137406 9:2480991-2481013 ATATTTAAGTTGAGAGCTGAAGG - Intergenic
1050628326 9:7532290-7532312 ACATTTAAACTGAGATATGAAGG - Intergenic
1050797812 9:9567143-9567165 GCATTTGAGCTGAAATTTGAAGG + Intronic
1051471746 9:17451435-17451457 GAATTTAAGATGAGAGATTTTGG + Intronic
1052025685 9:23571028-23571050 GCATTTGAGCTGAATGTTGAAGG - Intergenic
1052387856 9:27843328-27843350 AAATTTAAGCTGAGACCTGAAGG + Intergenic
1052467594 9:28849763-28849785 TGATCTAAGCTGAGAGCTGAGGG - Intergenic
1054986419 9:71267183-71267205 ACATTTAAGCTGAGCCTTGAAGG - Intronic
1057334421 9:94144555-94144577 GCATTTGAGCTGAGGCTTGAAGG - Intergenic
1057544249 9:96005512-96005534 GCATTTAAGTTAAGAGCTGAAGG + Intronic
1057902617 9:98961425-98961447 GGATTTAAGATGAGATCTGAGGG + Intronic
1058474004 9:105312259-105312281 ACATTTATGCTGAGAGCCGAAGG - Intronic
1058516033 9:105776908-105776930 GCATTTTAGCAGAGACCTGAAGG + Intergenic
1058634363 9:107022131-107022153 GCATGTAAGCTGAGACCTGAAGG - Intergenic
1058702110 9:107609765-107609787 TCATTTGAGCTAAGAGCTGAAGG - Intergenic
1058704942 9:107630283-107630305 GCATTTTGGGTGAGAGAGGATGG + Intergenic
1058787334 9:108403013-108403035 GACTTTAAGCTAAGAGATGTAGG + Intergenic
1058839868 9:108895662-108895684 TATTTTAAGCAGAGAGATGAAGG + Intronic
1059468329 9:114483880-114483902 TCATTAAAGCAGAGAGATCAGGG + Intronic
1059643654 9:116242253-116242275 ACATGTAAGCTGAGACTTGAAGG + Intronic
1059647334 9:116280373-116280395 ACATTTAAGCTGAGACTTGAGGG + Intronic
1059761201 9:117339320-117339342 GCATTGGAGCTGAGATTTGAAGG + Intronic
1059811067 9:117856284-117856306 GAATTCAATCTGTGAGATGAGGG - Intergenic
1059927026 9:119219844-119219866 GCATTTAAGCTGAGACCTAATGG + Intronic
1060066752 9:120508709-120508731 GGATTTGAGCTGAGACTTGAAGG - Intronic
1060386092 9:123230089-123230111 GAATTTAAGCTGAGTGAGGAAGG + Intronic
1060769500 9:126321646-126321668 ACATTTGAGCTGAGAGCTCAAGG + Intergenic
1060942025 9:127548201-127548223 TGAATTAACCTGAGAGATGAGGG - Intronic
1061121111 9:128643003-128643025 GCGTTTGAGCTGAGATGTGAAGG + Intronic
1061407424 9:130400136-130400158 GCATTTAACCTGCGATCTGAAGG - Intronic
1061772379 9:132935815-132935837 GCATTTAAGCTGAGATTTTAAGG - Intronic
1203672106 Un_KI270755v1:25399-25421 GCTTTTAAGCAGATAGAGGAAGG + Intergenic
1185573513 X:1152635-1152657 ACATTTAGGATGAGAAATGAAGG + Intergenic
1185774116 X:2788421-2788443 ACATTTAAGCTGAGACAGGAGGG + Intronic
1186062197 X:5721215-5721237 GCATTTAAACTTTGAGATGAGGG + Intergenic
1186265175 X:7824813-7824835 GCATTTAAGCTGAGATCTTATGG + Intergenic
1189067372 X:37824706-37824728 GCATTTCAGCTGTGACCTGAAGG - Intronic
1189184214 X:39038244-39038266 GCATCTAAGGTGAGACTTGAAGG - Intergenic
1189670529 X:43403832-43403854 GCATTTGAGCAGAGACATGAAGG + Intergenic
1190438713 X:50454393-50454415 GAAATCAAGGTGAGAGATGATGG - Intronic
1190736698 X:53260200-53260222 GCATATAAGCAGAGTGCTGAGGG + Intronic
1191046461 X:56143280-56143302 GCATTTAAGCAGAGACATAAAGG - Intergenic
1192426201 X:71079109-71079131 GCATGTAAGCTTAGATGTGAAGG - Intergenic
1192576071 X:72244339-72244361 GCATTTGATCTAAGAGCTGAAGG + Intronic
1193239817 X:79154846-79154868 TCATTTAAGCTGAGAGAAACAGG - Intergenic
1193787618 X:85778793-85778815 GAATTTAAGCTGAGTGAGTAGGG - Intergenic
1194353638 X:92854636-92854658 TAATATAAGCTGAGAAATGATGG + Intergenic
1194423585 X:93708172-93708194 ACATTTAAGCTGAAACCTGAAGG + Intronic
1195111497 X:101655051-101655073 GCATTTAAGCTGAACCCTGAAGG - Intergenic
1195572988 X:106417306-106417328 GCATTTGAGCAGAGACTTGAAGG + Intergenic
1195624904 X:106997823-106997845 ACATTTAAGCTGAGATTTGAAGG - Intronic
1195677498 X:107518185-107518207 ACATTTAAGCTGAGACCTAAAGG + Intergenic
1195814748 X:108872819-108872841 ACATTTAAGCTGAAAATTGAAGG + Intergenic
1195986849 X:110639665-110639687 ACATTTAGGCTGAGACAGGAAGG + Intergenic
1196116301 X:112003334-112003356 TCACTTAAGCTGAGATTTGAAGG + Intronic
1196120739 X:112047787-112047809 GTAATTAAGCTGAGATCTGAAGG - Intronic
1196232649 X:113241770-113241792 ACATTTGAGCTGAGATATGATGG + Intergenic
1196388141 X:115181241-115181263 GCTTTTATTCTGAGAGATGTGGG + Intronic
1196562350 X:117165477-117165499 TCATTTAAGCTGAGACCTGAAGG + Intergenic
1197048314 X:122027417-122027439 ACATTTAAGCTGAGACCTGAAGG - Intergenic
1197154571 X:123256451-123256473 GCATTTAAGCTGAGAACTAAAGG + Intronic
1197659146 X:129150930-129150952 GCATTTAGGCTGAGATCTGAAGG + Intergenic
1197673677 X:129307318-129307340 ACATATAAGCTGAGACTTGAAGG + Intergenic
1197814712 X:130485284-130485306 ACAATTGAGCTGAGACATGAAGG - Intergenic
1198698144 X:139365898-139365920 GCATTTAAGCTGACACTTAAAGG - Intergenic
1198751148 X:139937444-139937466 ACATTTAAGCTGAGAGCTGAAGG - Intronic
1199271236 X:145884809-145884831 TCATTTGAGCTGAGAGTTCAAGG + Intergenic
1199341268 X:146679993-146680015 GAATTTAAGCTGAGTAATGAGGG - Intergenic
1199444693 X:147908917-147908939 GCTTTTACTCTGAGAGATGTAGG + Intergenic
1200002315 X:153068454-153068476 ACAGTTCAGCTGAGACATGAAGG + Intergenic
1200005416 X:153081571-153081593 ACAGTTCAGCTGAGACATGAAGG - Intergenic
1200662000 Y:5971708-5971730 TAATATAAGCTGAGAAATGATGG + Intergenic
1201295649 Y:12460972-12460994 ACATTTAAGCTGAGACAGGAGGG - Intergenic