ID: 908630046

View in Genome Browser
Species Human (GRCh38)
Location 1:66093863-66093885
Sequence ACAAATATGGAAAAGTAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908630043_908630046 -6 Left 908630043 1:66093846-66093868 CCGCTCATATCATTAAGACAAAT 0: 1
1: 0
2: 0
3: 15
4: 234
Right 908630046 1:66093863-66093885 ACAAATATGGAAAAGTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908630046 Original CRISPR ACAAATATGGAAAAGTAGAA GGG Intronic
No off target data available for this crispr