ID: 908640277

View in Genome Browser
Species Human (GRCh38)
Location 1:66215463-66215485
Sequence GCTCCTATGACTCCACAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908640274_908640277 27 Left 908640274 1:66215413-66215435 CCTAGTTTGTAGCTATGCTATAC 0: 1
1: 0
2: 0
3: 6
4: 71
Right 908640277 1:66215463-66215485 GCTCCTATGACTCCACAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908640277 Original CRISPR GCTCCTATGACTCCACAAGA GGG Intronic
No off target data available for this crispr