ID: 908643082

View in Genome Browser
Species Human (GRCh38)
Location 1:66246755-66246777
Sequence TCCCACAGAGGAGTGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908643082_908643090 23 Left 908643082 1:66246755-66246777 CCTCATGACACTCCTCTGTGGGA 0: 1
1: 0
2: 2
3: 23
4: 190
Right 908643090 1:66246801-66246823 GAGACAAAGCTCTGCAGCCTTGG 0: 1
1: 1
2: 2
3: 47
4: 838

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908643082 Original CRISPR TCCCACAGAGGAGTGTCATG AGG (reversed) Intronic
903381857 1:22902733-22902755 TTCCAGAAAGGAGTGTCAGGGGG + Intronic
904368498 1:30033855-30033877 TCCCTCAGTGGACTGTCCTGAGG - Intergenic
905362217 1:37429010-37429032 TACCACATAGGATTGTCAAGAGG + Intergenic
907509176 1:54945722-54945744 TCCCACAGAGGGGTGGGGTGGGG + Intergenic
907653770 1:56321705-56321727 ACCCTCAGAGGAGTGTTATGTGG + Intergenic
908122442 1:60998932-60998954 TGCCTCATAGGATTGTCATGAGG - Intronic
908249102 1:62251211-62251233 TCCCACAGGGCAGTGTGAGGAGG - Intronic
908593539 1:65659409-65659431 TCCAAGAAAGGAGTGTCATGTGG + Intergenic
908643082 1:66246755-66246777 TCCCACAGAGGAGTGTCATGAGG - Intronic
912553765 1:110501269-110501291 TCCCCCAGAGGACTGTCACAAGG + Intergenic
914334271 1:146700683-146700705 TTCCACAGAGGAATGTGGTGAGG + Intergenic
915072312 1:153280492-153280514 ACCCAAAGAGGAGAGTAATGAGG - Intergenic
915734566 1:158076450-158076472 TCCCACTGAGGACTGACTTGAGG + Intronic
916740950 1:167646698-167646720 TCACACAAAGGAGAGTCCTGGGG - Intronic
919003892 1:191870842-191870864 TCCCAGAGGGTAGTGTCCTGTGG + Intergenic
920113337 1:203602375-203602397 TCCCTCAGAGGACCGTTATGAGG + Intergenic
920903141 1:210132337-210132359 CCTCACAGAGGAGTGGCACGTGG - Intronic
922199610 1:223390861-223390883 TCCCATAGAGCAGTGTTATGTGG - Intergenic
924687082 1:246304828-246304850 GCCCACAGAGGTTTATCATGGGG - Intronic
1067734182 10:48836695-48836717 TCCCACAGGGGACTGTGATGGGG - Intronic
1069167682 10:65183569-65183591 TCCCACAGTGGTCAGTCATGTGG - Intergenic
1073800689 10:107038373-107038395 TCAGACAGAGGACTGTCGTGGGG + Intronic
1075315951 10:121453732-121453754 GCCCTCAGAGGAGCCTCATGTGG + Intergenic
1075783455 10:125032350-125032372 TCAAACAGTGGAGTGTGATGGGG - Intronic
1077395665 11:2319917-2319939 TCCCACAGGGGTGGGTCCTGTGG + Intergenic
1078083674 11:8221137-8221159 TCCCAGGCAGGAATGTCATGTGG + Intergenic
1080210721 11:29781686-29781708 TCCCTCAGAGTAGTGTTTTGAGG + Intergenic
1081600417 11:44488724-44488746 TCCCAGAGAGGAGAGCCAGGTGG + Intergenic
1081637794 11:44732244-44732266 TCCCAGAGATGATTATCATGGGG + Intronic
1085514821 11:77105977-77105999 TCCCAGGGACCAGTGTCATGGGG - Intronic
1085877593 11:80427426-80427448 TACCTCACAGGATTGTCATGAGG - Intergenic
1087356647 11:97102196-97102218 TCACACAGGGGCCTGTCATGGGG - Intergenic
1089650390 11:119909098-119909120 TTCCGCATAGGAGGGTCATGGGG + Intergenic
1095838854 12:46669827-46669849 ACGCAGAGAGGAGTGTCCTGAGG + Intergenic
1100715314 12:97299532-97299554 TTCCTCAGAGGACTGCCATGAGG - Intergenic
1101034361 12:100690370-100690392 TACCTCAAAGGATTGTCATGTGG - Intergenic
1101444838 12:104730309-104730331 TGCCACAGAGGGTTGTCATAAGG + Intronic
1101497124 12:105265308-105265330 TAGCACATGGGAGTGTCATGGGG - Intronic
1101647665 12:106646154-106646176 TCCCACACAGGTGTGTAAGGGGG + Intronic
1102721010 12:115016062-115016084 TCCAACAGAGAAGTGTCATGTGG - Intergenic
1104650155 12:130525524-130525546 TCCCACAGGCGAGTGGAATGTGG + Intronic
1104813103 12:131629937-131629959 TTCCTCAGAGGAGTCTCCTGAGG + Intergenic
1106605436 13:31224135-31224157 GCCCACAGGGGAGTGTTTTGGGG + Intronic
1107590131 13:41895219-41895241 TACCTCAGAGGACTGTCATAGGG - Intronic
1107819014 13:44269459-44269481 TCCCAGAGAAGAGAGACATGAGG - Intergenic
1110360568 13:74620479-74620501 TCCAACAGAGGAGGGGCAAGAGG - Intergenic
1111900639 13:94195609-94195631 TGCCCCATAGGACTGTCATGAGG + Intronic
1113299575 13:109003160-109003182 TCCAACAGTGGAGAGTGATGTGG - Intronic
1117154246 14:52922210-52922232 TCCCACAGAGGAGAAAGATGAGG + Intronic
1117316742 14:54578196-54578218 TCCTACAGTGGAGAGGCATGTGG - Intronic
1118324542 14:64772227-64772249 TGCCTCAGAGGACTGCCATGAGG + Intronic
1120127611 14:80764544-80764566 TCCCACAGAGGATAGTGAAGTGG - Intronic
1121066135 14:90967325-90967347 TTCCACATAAGATTGTCATGAGG + Intronic
1122501126 14:102200377-102200399 GCCCACAGAGGAGAGTCACCCGG + Intronic
1128761562 15:70219628-70219650 GCCCACAAAGGATTATCATGGGG + Intergenic
1129060930 15:72859781-72859803 TTCCACAAAGGAGGGTCATGGGG - Intergenic
1129788354 15:78323816-78323838 CCCCACAAAAGGGTGTCATGAGG + Intergenic
1130002273 15:80058173-80058195 TACCACAAAGGATTGTTATGAGG - Intergenic
1130703143 15:86205987-86206009 TCACACAGAGGACTGTCGTGGGG - Intronic
1130881864 15:88062251-88062273 TCCCACAGAGGTGTGTTACAAGG + Intronic
1131014917 15:89050240-89050262 GATCACAGAAGAGTGTCATGGGG + Intergenic
1131852834 15:96561263-96561285 TACCACATGGGATTGTCATGTGG - Intergenic
1136267500 16:29130187-29130209 TCCCACAGAGGACTGGCGTGGGG + Intergenic
1137666720 16:50254074-50254096 TCCTACAGATGAGGATCATGTGG - Intronic
1138233553 16:55359589-55359611 TCCCACTTATGAGTGACATGTGG - Intergenic
1139999346 16:71010549-71010571 TTCCACAGAGGAATGTGGTGAGG - Intronic
1140445721 16:75026036-75026058 TCCCACAGAGGGGTCTTGTGTGG + Intronic
1141909510 16:87048981-87049003 TCCCACAGCAGAGAGTGATGGGG + Intergenic
1142289683 16:89187871-89187893 GCCCACAGAGGAGGACCATGGGG + Intronic
1142498806 17:321055-321077 TCTCACAGAGGGGTGTCCTGAGG + Intronic
1143102918 17:4514041-4514063 TCCCACAGGGCCATGTCATGGGG - Intronic
1144683361 17:17210036-17210058 GCCCAGACAGGAGTGCCATGGGG + Intronic
1145078742 17:19876810-19876832 TCCCTGAGAGGCGTGGCATGTGG - Intergenic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1147932010 17:43987608-43987630 CCCCACAGGGGTGTGGCATGTGG - Intronic
1149412963 17:56427910-56427932 TACCACATAGGAGTGTTAGGAGG + Intronic
1150941640 17:69699617-69699639 TCCAACAGAGGCCTGCCATGTGG - Intergenic
1152115703 17:78385815-78385837 TCCCACTGAGGCCTCTCATGGGG + Intronic
1155847865 18:30731604-30731626 TCACCCAGTTGAGTGTCATGGGG - Intergenic
1156099517 18:33577857-33577879 TCCAACAGAGGAGAGTAGTGCGG + Intergenic
1156473830 18:37393605-37393627 TCCCACAGAGGCATGTGGTGGGG + Intronic
1157952223 18:52052497-52052519 TCCCAAGGAGGAATGTTATGAGG - Intergenic
1160116851 18:76086722-76086744 TCACACCAAGGAGTTTCATGGGG + Intergenic
1160193311 18:76732992-76733014 TACAACAGAGAAATGTCATGGGG - Intergenic
1162353782 19:10167788-10167810 TCACACAGCTGTGTGTCATGTGG - Intronic
1164457583 19:28421419-28421441 ACCCACAGAAGAGTGTCATTTGG - Intergenic
1165700684 19:37934819-37934841 TCTCACATAGCAGTGCCATGTGG + Intronic
1166783546 19:45354486-45354508 TCCCTCAGAGGAGTACCCTGTGG - Intronic
1168161478 19:54513142-54513164 TTCCCCTGAGGAGTGTCCTGGGG + Intergenic
925009505 2:471506-471528 TCCCCCAGAGTAGTGTCAGTGGG + Intergenic
925938948 2:8796608-8796630 TCCCACACAGTAGTGTGCTGAGG - Intronic
928822492 2:35378455-35378477 TTCTACAGAGTAATGTCATGAGG - Intergenic
932713017 2:74081579-74081601 TCCCAGTGAGGAGAATCATGTGG + Intronic
932737619 2:74265330-74265352 CCCAAAAGAGGGGTGTCATGTGG + Intronic
935847335 2:107180883-107180905 TTCCTCTCAGGAGTGTCATGAGG - Intergenic
936623044 2:114120004-114120026 TCCCAAGGAGGAGTGGCAGGGGG + Intergenic
937813118 2:126220899-126220921 TCTCACAGGGGAGGGTCATGGGG - Intergenic
937954590 2:127414953-127414975 CCACACAGGGGAGTGGCATGGGG + Intergenic
942533406 2:176936899-176936921 TCACCCAGAAGAGTGACATGAGG + Intergenic
942677209 2:178440372-178440394 TCACAGATAGGTGTGTCATGTGG - Intronic
943405631 2:187480024-187480046 TGTCACAGAGGAGTATCATGGGG - Intronic
944533294 2:200685274-200685296 TGACACAGAGCAGTGTCAAGAGG - Intergenic
947979608 2:234397847-234397869 TCCCACAGTGGACTGAGATGGGG - Intergenic
948064038 2:235063325-235063347 GCGCACAGAGGATTTTCATGAGG + Intergenic
948986973 2:241531694-241531716 TCCTGCAGAGGAGCGCCATGAGG + Intergenic
1169279935 20:4258264-4258286 TACTACAGAGGAGTGAAATGTGG - Intergenic
1172682397 20:36726878-36726900 TACCAGAGAGGATTGTTATGAGG - Intronic
1172897799 20:38312698-38312720 GACCACTGAGGAGTCTCATGCGG + Intronic
1174669762 20:52296023-52296045 TCCCACAGAGGTGAGCCATGGGG - Intergenic
1175364034 20:58438671-58438693 TCCCACAGAGTAGCAACATGGGG + Intronic
1179334344 21:40436368-40436390 TCCCCCAGAGGACTATGATGGGG - Intronic
1181421705 22:22803710-22803732 TGCCTCAGGGGACTGTCATGGGG + Intronic
1181786939 22:25234054-25234076 ACACACAGAGGCCTGTCATGGGG + Intergenic
951678703 3:25272237-25272259 TCCCTCACATCAGTGTCATGTGG - Intronic
954503669 3:51047239-51047261 TCACACAGGGGCCTGTCATGAGG + Intronic
957879144 3:86187695-86187717 TCCCACTTATGAGTGACATGCGG - Intergenic
957888390 3:86321567-86321589 TCCCACAGAAGAGTATTATAAGG - Intergenic
961154788 3:124670396-124670418 TCTCACTGAGGAGTGTTTTGTGG - Intronic
962367694 3:134796799-134796821 TCCCCCAGAGGAGTTCCATCCGG - Intronic
962628352 3:137249874-137249896 TCCCACAGCAGATTCTCATGAGG + Intergenic
963183271 3:142383617-142383639 TGCCACAGAGGTTTGTCATGAGG - Intronic
964676838 3:159292615-159292637 TCCCTCATAAGAATGTCATGAGG + Intronic
964938605 3:162125738-162125760 TCCTTCAGAGGATTGACATGTGG - Intergenic
967778521 3:193409935-193409957 TCTCAAAGATGAGTCTCATGAGG - Intronic
968084166 3:195867219-195867241 GACCACAGAGGAGTGCCAGGCGG - Intronic
969296681 4:6274404-6274426 TCCCACATAGGGGTGCTATGGGG - Intronic
970733818 4:19141893-19141915 TCTCCCAAAGGAGGGTCATGAGG + Intergenic
971100223 4:23458353-23458375 TTCCACAGGGGAGTGTCATGAGG - Intergenic
972120388 4:35694604-35694626 TCAGACAGAGGCTTGTCATGGGG - Intergenic
973112210 4:46410629-46410651 TCACACAGGGGCCTGTCATGGGG + Intronic
975845418 4:78520037-78520059 TCCCAAAGAGGACAGTAATGGGG - Intronic
977863422 4:101994812-101994834 TTGCACAGAGAAGTTTCATGGGG + Intronic
982399642 4:154952879-154952901 TCTCAGAGGGGAGTGTCTTGTGG + Intergenic
982756091 4:159220356-159220378 TCCCACAGTGGGGTGGGATGGGG + Intronic
983301059 4:165926483-165926505 TTCCACAGAGGAAGGTGATGCGG + Intronic
984667607 4:182445962-182445984 TTCCACAGAGACGTGTAATGAGG - Intronic
984734130 4:183095244-183095266 TCCATCAGAGAAGTATCATGAGG - Intergenic
987553485 5:19414266-19414288 ACACACAAAGGAGTGTCATTTGG - Intergenic
987679620 5:21118171-21118193 TCCAAAAGAGGAATGTCACGAGG + Intergenic
991309762 5:65224668-65224690 TCTCACAGAGGATTGATATGAGG - Intronic
991403387 5:66277522-66277544 GCCCAGAGAGGAGTGGCAGGAGG + Intergenic
991958159 5:72016204-72016226 ATCCACAGAGGTGTGGCATGTGG - Intergenic
993026251 5:82650373-82650395 TACCTCACAGGATTGTCATGAGG - Intergenic
994890175 5:105623367-105623389 TCCCACAGAGGAACATGATGAGG + Intergenic
998177038 5:139907976-139907998 TCCCTCACAGGATTGTCGTGAGG - Intronic
999198967 5:149802640-149802662 TGCCTCACAGAAGTGTCATGAGG - Intronic
1000675382 5:164116402-164116424 TTCCACAGAGCAATGTCATTAGG + Intergenic
1009511370 6:64553130-64553152 TCTCACGGAGCTGTGTCATGGGG + Intronic
1011145265 6:84207549-84207571 ACACACTGAGGACTGTCATGGGG + Intronic
1012461474 6:99466434-99466456 TGCCTCATAGGTGTGTCATGAGG + Intronic
1013428947 6:110039023-110039045 TCCCTCAGAGGAGTGTCTGTTGG + Intergenic
1014184426 6:118419052-118419074 TCCCTCAGAGGACAGTCTTGAGG - Intergenic
1016147919 6:140699052-140699074 TTCCACAGAGGAGTTTCAAGGGG - Intergenic
1016485591 6:144534488-144534510 CACCACAGAGGACTGTCATGAGG + Intronic
1017576380 6:155809357-155809379 TCACATGGAGGAGTGTGATGAGG + Intergenic
1019189415 6:170242695-170242717 CCGCACAGAGGAGTGTCTTGGGG - Intergenic
1019558658 7:1645170-1645192 TCCCACCCAGGGGTGTCCTGGGG - Intergenic
1020082649 7:5295120-5295142 TCCCACATGGGAGGGACATGTGG + Intronic
1020357474 7:7293012-7293034 TCCCACAGAGAAGTATGCTGGGG - Intergenic
1020434119 7:8143818-8143840 TCCCACAGGTGAGAGTTATGTGG - Intronic
1020634596 7:10681360-10681382 TACCTTATAGGAGTGTCATGAGG - Intergenic
1022802170 7:33787154-33787176 GTCCACAGAGGAGAGTCACGTGG - Intergenic
1022876141 7:34532573-34532595 TACCCCAGAGGAATTTCATGGGG + Intergenic
1023840034 7:44091805-44091827 TGCCCCACAGGAATGTCATGAGG - Intergenic
1024275916 7:47676891-47676913 CGGCACAGAGGAGTGCCATGTGG - Intergenic
1026587265 7:71666071-71666093 AGCCCCACAGGAGTGTCATGCGG + Intronic
1028012150 7:85659559-85659581 TCCCACAGTGGGATGTGATGAGG - Intergenic
1028302846 7:89223640-89223662 GCCCATAGTGGAGTGCCATGAGG - Intronic
1028363266 7:89994779-89994801 TCCCAGAGAGGAATGTAATAAGG - Intergenic
1033615745 7:143012554-143012576 CCCCACAGAGGAGTGTGCAGGGG - Intergenic
1033876476 7:145825103-145825125 TCCCACAGAGTAGTGTTCTGTGG + Intergenic
1035305737 7:157930151-157930173 GCCCACAGAGGGGTGTCTTGGGG + Intronic
1035362244 7:158321297-158321319 TCCCGCAGAGGAGGGGCCTGAGG - Intronic
1035692570 8:1569862-1569884 CTCCACAGAGCAGTGCCATGGGG - Intronic
1035692578 8:1569901-1569923 CTCCACAGAGCAGTGCCATGGGG - Intronic
1035692587 8:1569941-1569963 CTCCACAGAGCAGTGCCATGGGG - Intronic
1036523544 8:9514479-9514501 AACCACAGAGGAGGCTCATGTGG + Intergenic
1036835257 8:12058852-12058874 ACACACTGAGGACTGTCATGGGG + Intergenic
1038271093 8:26076597-26076619 TGCCTCATAGGATTGTCATGAGG - Intergenic
1038441086 8:27571330-27571352 TCCCTCAGAGCAGTGCCAAGGGG + Intergenic
1038735456 8:30164902-30164924 ACACACAGAGGAGGGTCGTGTGG - Intronic
1041666165 8:60447059-60447081 TACCATAGAGGATTGTCATGAGG + Intergenic
1041676410 8:60544503-60544525 TACTTCAGAGGAATGTCATGAGG - Intronic
1044508671 8:93049776-93049798 GCCCACCCAGGAGTGGCATGAGG - Intergenic
1046030052 8:108772884-108772906 TACCTCACAGGATTGTCATGGGG + Intronic
1046190779 8:110791496-110791518 TTCCACAGAGGACTATCAGGTGG - Intergenic
1046246109 8:111565189-111565211 TTGCACAGAGGAGGATCATGGGG + Intergenic
1048026722 8:130593791-130593813 TGGCACAGAGGAGAGTCACGGGG - Intergenic
1048208166 8:132432015-132432037 TCCCTCAGAGGGTTGTTATGAGG + Intronic
1049164110 8:141116164-141116186 TCCCACAGGTGCCTGTCATGCGG + Intergenic
1049182854 8:141231804-141231826 GCACACAGAGCAGTCTCATGTGG - Intronic
1049293007 8:141813800-141813822 TCTCACAGATGAGGGTCTTGGGG - Intergenic
1050930574 9:11318930-11318952 TCCCACAGAGCAATTTAATGTGG - Intergenic
1051729351 9:20123631-20123653 TGCCTCATAGGATTGTCATGTGG + Intergenic
1052847687 9:33351658-33351680 TCACAAAGGGGAGTGTCTTGTGG + Exonic
1057532800 9:95868249-95868271 TCCCACAGAGGAGGGAAATAGGG - Intergenic
1057885437 9:98826196-98826218 TGCCTCAGAGGATTGTTATGAGG + Intronic
1058942905 9:109830751-109830773 TTCCACTTAGGATTGTCATGAGG - Intronic
1060698170 9:125728047-125728069 TTCCTCATAGGACTGTCATGAGG + Intergenic
1060835858 9:126754798-126754820 TCTCACAGAGGAGTCCCATGGGG - Intergenic
1060877981 9:127096886-127096908 TACCTCACAGGAGTGTCAGGAGG - Intronic
1186418376 X:9403224-9403246 CCCCACAGAGCAGGGTCAGGAGG + Intergenic
1187896460 X:23984913-23984935 TCACACAGAGCAGAGTAATGAGG + Exonic
1189484900 X:41422818-41422840 TCCCAAAGAGGTTTGTTATGTGG - Intergenic
1190746366 X:53324942-53324964 TACCACATAGGATTGTCATGAGG - Intergenic
1192045247 X:67665132-67665154 TCTCACAGGGGAGTGTCAAATGG - Intronic
1192288208 X:69761429-69761451 TCCTTCACAGGAATGTCATGAGG - Intronic
1194040060 X:88929658-88929680 ACACACTGAGGACTGTCATGGGG + Intergenic
1196623094 X:117846591-117846613 TCCCTCATAGGATTGTTATGAGG - Intergenic
1197262717 X:124334427-124334449 TCCCCCAGGGGAGTGTCCTGGGG - Intronic
1197262766 X:124334613-124334635 TCCCCCAGGGGAGTGTCCTGGGG - Intronic
1197262814 X:124334799-124334821 TCCCCCAGGGGAGTGCCCTGGGG - Intronic
1197744120 X:129919520-129919542 TTCCACAGAAGAAAGTCATGTGG + Intronic
1199036995 X:143063604-143063626 TGGCACAGAGCAGAGTCATGAGG + Intergenic
1201124139 Y:10898530-10898552 CACTACAGAGGAGTGGCATGGGG - Intergenic
1201607690 Y:15805240-15805262 TCTCAAGAAGGAGTGTCATGAGG - Intergenic