ID: 908645969

View in Genome Browser
Species Human (GRCh38)
Location 1:66278278-66278300
Sequence GTTTCTCTGGCCCCATAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908645969_908645973 17 Left 908645969 1:66278278-66278300 CCTGCTTATGGGGCCAGAGAAAC 0: 1
1: 0
2: 1
3: 17
4: 152
Right 908645973 1:66278318-66278340 GCCCAGCTGCTACAGCTTTGGGG No data
908645969_908645971 15 Left 908645969 1:66278278-66278300 CCTGCTTATGGGGCCAGAGAAAC 0: 1
1: 0
2: 1
3: 17
4: 152
Right 908645971 1:66278316-66278338 CTGCCCAGCTGCTACAGCTTTGG 0: 1
1: 0
2: 0
3: 31
4: 295
908645969_908645972 16 Left 908645969 1:66278278-66278300 CCTGCTTATGGGGCCAGAGAAAC 0: 1
1: 0
2: 1
3: 17
4: 152
Right 908645972 1:66278317-66278339 TGCCCAGCTGCTACAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908645969 Original CRISPR GTTTCTCTGGCCCCATAAGC AGG (reversed) Intronic
906331670 1:44890223-44890245 GTTTCTGGGGCCTAATAAGCAGG - Intronic
907645310 1:56236489-56236511 GTTTTTCTGGCTCAAAAAGCTGG - Intergenic
908645969 1:66278278-66278300 GTTTCTCTGGCCCCATAAGCAGG - Intronic
910018008 1:82551069-82551091 GTTTCTCTGGCCAAATTAACTGG - Intergenic
910729349 1:90375786-90375808 GTCTCTCCAGCCCCATAAGATGG + Intergenic
912712865 1:111961949-111961971 GTTTCTCTGGCCCGAGTTGCTGG + Intronic
916036076 1:160923645-160923667 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
916173504 1:162019684-162019706 GCCTCTCTGGCTCCATAAGGAGG + Intronic
918197402 1:182235054-182235076 GTTTCTCTGGCACCAAAGGCGGG - Intergenic
918254651 1:182738004-182738026 GTTTCTGTGGGCCAATAATCTGG - Intergenic
918375370 1:183903731-183903753 GTTTCTCTGGCCCTACAAGTTGG - Intronic
919060025 1:192620687-192620709 GTTTATCTGGTCCCATAAATGGG - Intergenic
920694111 1:208168851-208168873 GTTTCTCTGGCCTCATGTCCTGG - Intronic
924696574 1:246406754-246406776 GTGTCACTGGCTCCAAAAGCAGG + Intronic
1062989777 10:1804563-1804585 GTTTCTGTGGCTACAGAAGCAGG - Intergenic
1065709715 10:28504052-28504074 GTTTCTCTGGACCCTGCAGCTGG - Intergenic
1072955767 10:99886557-99886579 GTTTACAGGGCCCCATAAGCTGG - Exonic
1073351932 10:102826008-102826030 GTTCCTCTGCCCCCATCAGCTGG + Intergenic
1079109020 11:17593701-17593723 GGTTCTCTGGTCCCACAAGAGGG - Exonic
1082958954 11:58900962-58900984 AGTTCTCTGGCGCCATCAGCTGG + Intronic
1083012576 11:59417410-59417432 GTTTCTCTCTCCCCTTATGCTGG - Intergenic
1088101090 11:106156381-106156403 TTTTCCCTGGCCCCATCTGCTGG - Intergenic
1088544920 11:110949742-110949764 GTTTCTCTGGCTCCAGAGCCTGG + Intergenic
1090335284 11:125958242-125958264 GTTTATCTGGAGCCATAATCTGG - Exonic
1090455626 11:126846241-126846263 GTTTCTAGGGCCTAATAAGCAGG - Intronic
1091304049 11:134525544-134525566 TTTTCCCAGGCCCCATAAGAAGG + Intergenic
1092890535 12:12965405-12965427 GCTTCCCTGGCCACATCAGCAGG + Intergenic
1093547441 12:20365728-20365750 GTTGCTCAGGCCCCAGAAGAGGG - Intergenic
1099077363 12:78127341-78127363 GTTTCTCTGGCCCGAACAGTTGG + Intronic
1105425025 13:20286527-20286549 GTTTCTATGGCCTAATAAGCAGG - Intergenic
1106186953 13:27418071-27418093 GTTTCTGTGGGCCCAGAATCAGG + Intergenic
1106472337 13:30068168-30068190 GTTTCTGAAGCCCTATAAGCTGG + Intergenic
1107859508 13:44647568-44647590 GGATCTCTGGGCCCCTAAGCTGG - Intergenic
1108691959 13:52867170-52867192 GTTGCTCTGGCCTCAGCAGCTGG + Intergenic
1109609179 13:64740694-64740716 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
1112421931 13:99260179-99260201 GTTTCTCTGCCCTCCGAAGCTGG + Intronic
1115550686 14:34502461-34502483 GTTGCTCTGGCCCTAGAAGTAGG + Intergenic
1115868809 14:37777953-37777975 TGTTCTCTGGCCCCTTAAGTTGG + Intronic
1116483662 14:45420704-45420726 GTTTTTATGGCCTAATAAGCAGG - Intergenic
1118537880 14:66789558-66789580 GTTTCTATGGCCTAATAACCAGG + Intronic
1118691347 14:68343552-68343574 ATTTCTCTGGCCACATAGCCAGG - Intronic
1119543230 14:75454108-75454130 GTTTCTCAGGCCCCGTCTGCAGG - Intronic
1119601039 14:75977339-75977361 GTTTCTCTGACCCCATGTGATGG - Intronic
1119867690 14:77987815-77987837 GTTTCTCTCCCTCCATAAGATGG - Intergenic
1120254643 14:82103609-82103631 GCATCTCTGGCCCCAGAAGTTGG + Intergenic
1121003862 14:90473843-90473865 GTTTCTATGGCCTAATAAGCAGG - Intergenic
1121950575 14:98167699-98167721 GTTTCCCTGGCTCCATTATCAGG + Intergenic
1122591946 14:102859875-102859897 GTTTCTATGGCCTAATAAGCAGG + Intronic
1122826404 14:104372911-104372933 GCCTCTCAGGCCCCAGAAGCTGG - Intergenic
1126214945 15:46143989-46144011 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
1130971609 15:88738233-88738255 GTTTGTCTGTCTCCAAAAGCTGG + Intergenic
1131407116 15:92174293-92174315 GTTTCTGTGGCCCCATAACATGG + Intergenic
1133041870 16:3065202-3065224 GTTTCTCTGGCCTCTGGAGCCGG + Intergenic
1134502076 16:14777029-14777051 GTTTGTCTGGCCCCAAAGCCTGG - Intronic
1134578485 16:15351864-15351886 GTTTGTCTGGCCCCAAAGCCTGG + Intergenic
1134724103 16:16405680-16405702 GTTTGTCTGGCCCCAAAGCCTGG - Intergenic
1134943326 16:18306189-18306211 GTTTGTCTGGCCCCAAAGCCTGG + Intergenic
1136566557 16:31073846-31073868 GCTTCTCTGCCGCCATAGGCTGG - Intronic
1140410404 16:74737613-74737635 GTTTCCCTGGCCCTAGAAGGTGG - Intronic
1141049504 16:80747650-80747672 GCTTCTCTGGCCTCAGAAGTTGG - Intronic
1142374450 16:89700029-89700051 ATTCCTCTGGCCCCATGAACTGG + Intronic
1144555487 17:16279045-16279067 GTTTCTAGGGCATCATAAGCAGG + Intronic
1147998054 17:44372144-44372166 TCTTCTCTGGCCCCAAAAGGAGG + Intergenic
1150604777 17:66681414-66681436 TTCTCTCTGACCCCAGAAGCAGG - Intronic
1151092471 17:71458395-71458417 GTTTCTCTTTCCCTATAAACTGG - Intergenic
1151579381 17:74969533-74969555 GTTTCTGTGGCCCTAGCAGCAGG - Intronic
1153338071 18:3945063-3945085 GCTTATCTGGCCCCAGAACCTGG - Intronic
1153971026 18:10227127-10227149 GTAGCTCAGGCCCCATATGCAGG - Intergenic
1156815329 18:41303728-41303750 GTGTCTCTGGGCTGATAAGCAGG + Intergenic
1157762410 18:50274436-50274458 GCTCCTCTAGCCCCATAAGACGG + Intronic
1160071800 18:75635429-75635451 GCTCCTCTGCCCCCAGAAGCTGG - Intergenic
1160441210 18:78894300-78894322 GTTTATTTGGCCCCATATGCAGG - Intergenic
1161537146 19:4826876-4826898 GTTTCTCAGGCCCCATAACCAGG - Intronic
1162325628 19:9997430-9997452 GTTTCTCTGTCCCCAACAGGGGG - Exonic
1164129607 19:22349773-22349795 ATATCTCTGGCCCCATCACCTGG + Intergenic
1164169941 19:22716254-22716276 ATATCTCTGGCCCCATCACCTGG - Intergenic
1165193447 19:34082326-34082348 ATTTCTTTGGCCCTAAAAGCAGG + Intergenic
1166539771 19:43597355-43597377 AGTACTCTGGCCACATAAGCTGG - Intronic
1166539776 19:43597381-43597403 CCTCCTCTGGCCACATAAGCAGG + Intronic
1168174968 19:54620597-54620619 GTTTGTCTGGTCCACTAAGCTGG - Intronic
927138492 2:20114271-20114293 GCTTCACTGGCCCCCTAGGCAGG + Intergenic
927579799 2:24231850-24231872 GATACTCTGGCCGCATAAGTGGG - Intronic
928002553 2:27537606-27537628 GTTTCTATGGCCTCAGGAGCGGG - Intronic
929125656 2:38520733-38520755 GTTTCCCAGGCTCCATCAGCTGG + Intergenic
932123402 2:69121853-69121875 CTGTCTCTGGCCCCAGAAACTGG + Intronic
935244211 2:101204180-101204202 GGCACTCTGGCCCCCTAAGCTGG - Intronic
935885894 2:107618562-107618584 GTTTCTATGGCCTAATAAGTAGG - Intergenic
936033908 2:109094376-109094398 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
940499166 2:154473456-154473478 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
941639617 2:167972945-167972967 GTTTCTAGGGCCTAATAAGCAGG - Intronic
1170085836 20:12530798-12530820 GTTTCTCTGGCTTCATGAGATGG - Intergenic
1181409258 22:22706770-22706792 GATTCTCTGGACCCAACAGCAGG + Intergenic
1181416677 22:22764621-22764643 GATTCTCTGGCCCCAACAGCAGG + Intronic
1183325780 22:37192908-37192930 GTTTCTAAGGCCTAATAAGCAGG + Intronic
1183539016 22:38418949-38418971 GTGTCTCCGGACCCACAAGCCGG + Intergenic
950016639 3:9759216-9759238 CTTTCTCGGACCCCATAGGCTGG + Intronic
950556836 3:13701139-13701161 GTCTCTCTGGCCCTGTAGGCAGG - Intergenic
951256071 3:20451374-20451396 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
952487652 3:33831145-33831167 GTTTATGTGGCCCCAGAAGATGG + Intronic
952730059 3:36629323-36629345 GTCTCTCTGGCCCCAGTATCAGG - Intergenic
953153682 3:40348275-40348297 GTTTCTAGGGCCCAATTAGCAGG - Intergenic
956457984 3:69442766-69442788 GTTTATGTGGCTTCATAAGCAGG - Intronic
958131683 3:89434541-89434563 GCATCTCTGTCCCCATAAGTAGG + Intronic
960763501 3:121098610-121098632 ATTTCTCTGGCCTCATAATACGG - Intronic
961116202 3:124332226-124332248 ATTTCTGTGGCCCCATGGGCAGG + Intronic
965487132 3:169292226-169292248 GATTCTCTGGCCCGAGTAGCTGG - Intronic
967253487 3:187566754-187566776 GTTTCTCTGGGCTCATACACAGG - Intergenic
971816772 4:31501040-31501062 TTTTCTATAGTCCCATAAGCAGG - Intergenic
974839538 4:67285115-67285137 GTTTCTATGGCCTTATAAGCAGG + Intergenic
977499951 4:97825575-97825597 GTTTCTAGGGCCTAATAAGCAGG - Intronic
977527217 4:98159860-98159882 GTTTCTAGAGCCCAATAAGCAGG - Intergenic
978265226 4:106815802-106815824 CTTTCTCTGGCTCCACATGCAGG + Intergenic
980729952 4:136812165-136812187 ATTTCTCCTGCCCCAGAAGCCGG - Intergenic
981316138 4:143341533-143341555 CTTGCTCTGGCCTCAGAAGCAGG - Intronic
982319926 4:154067318-154067340 GTTTCTCAGGCCCAATATGCAGG + Intergenic
982555383 4:156855859-156855881 GTTTCACTGGCTCCATGAGCTGG + Intronic
982864278 4:160490341-160490363 GTTTCTATGGCCTAATAAGCAGG - Intergenic
983694913 4:170516217-170516239 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
984799972 4:183705713-183705735 GTTTCTCTGTCCCTATAAATTGG + Intronic
986139743 5:5018330-5018352 GTCTCTCTGGCCCCATCCGTGGG - Intergenic
987100249 5:14584852-14584874 GTTTCTGAGCCACCATAAGCAGG + Intronic
988568375 5:32340013-32340035 GTTTCTATGGCCTAATAAGTAGG + Intergenic
993133057 5:83923566-83923588 GTTGCTCTGCCACCTTAAGCAGG - Intergenic
994467869 5:100162043-100162065 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
995755683 5:115501525-115501547 GCCTCTCTGATCCCATAAGCTGG - Intergenic
996057798 5:118999854-118999876 GTTCCTATGGCCTAATAAGCAGG + Intergenic
996900280 5:128537001-128537023 GCTTCTCTGGCCCCTGCAGCAGG + Intronic
997877371 5:137561290-137561312 CTTTCACTGTCCCCAGAAGCAGG + Intronic
998161389 5:139814686-139814708 TTCTCCCTGGCCCCATTAGCTGG - Intronic
998524096 5:142826693-142826715 GTGTCCCTGGCCCCATCACCAGG + Intronic
1000274087 5:159717221-159717243 TTTTCTCTGCCCCCATACACAGG - Intergenic
1003044137 6:2717433-2717455 CGTTCCCTGGCCCCAGAAGCAGG - Intronic
1004243559 6:13951293-13951315 GTTTCTAGGGCCTAATAAGCAGG + Intronic
1006196911 6:32249479-32249501 GTTTCTATGGCCTAATAAGCAGG - Intergenic
1010104052 6:72147410-72147432 GTTTCTAGGGCCTAATAAGCAGG + Intronic
1011341634 6:86321761-86321783 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
1012201118 6:96406989-96407011 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
1013614481 6:111829022-111829044 GATTCTGTGGCCAGATAAGCTGG - Intronic
1014738558 6:125122837-125122859 GTTTCTAGGGCCTAATAAGCAGG - Intronic
1015007629 6:128302673-128302695 GCTTCTCTGGCCCCTTTTGCAGG + Intronic
1016108564 6:140192221-140192243 GTTTCTAGGGCCTAATAAGCAGG - Intergenic
1021110212 7:16685252-16685274 GATTCTCTTGCCCCAGAGGCAGG - Intronic
1021123521 7:16824200-16824222 GGTTCTCTGGTCAAATAAGCTGG + Intronic
1021498782 7:21306471-21306493 GTTTCTCTAGCCTCACAAGCTGG + Intergenic
1022134836 7:27437333-27437355 TTTTCTTTGTCCCCCTAAGCTGG + Intergenic
1024417857 7:49128590-49128612 GTTTTTCTAGCCCCATGAGAAGG - Intergenic
1027431319 7:78115445-78115467 GTTTCTCTGGCCTATTAACCTGG - Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1038331023 8:26609631-26609653 GTTTCTCTGGCCACCTCATCGGG + Intronic
1041228699 8:55727903-55727925 GTTTCTATGGCCAAATAAGAAGG + Intronic
1044732347 8:95239384-95239406 GTCTCTCTGACCCCAGAATCTGG + Intergenic
1046202804 8:110949987-110950009 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
1047307725 8:123666535-123666557 GTTCTGCTGGCCCCATAGGCTGG + Intergenic
1048187894 8:132261100-132261122 CTTTCTCTGGCCTCCTAAGTAGG - Intronic
1048560109 8:135526658-135526680 TTCTCTCTTGCCCCAGAAGCTGG - Intronic
1052049700 9:23831099-23831121 TTTTCTCTGGCCCCTTTACCGGG + Intergenic
1052962947 9:34316411-34316433 GGCTCTATGGCCACATAAGCAGG - Intronic
1062128674 9:134880768-134880790 GCTTCTCTAGCCCTATAAGAGGG + Intergenic
1186397591 X:9225449-9225471 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
1186450224 X:9666208-9666230 GTTTCTAGGGCCTAATAAGCAGG - Intronic
1187398346 X:18937506-18937528 CTTTCTCTGACCCTAAAAGCTGG - Intronic
1187491979 X:19760782-19760804 GATTCTCTGGCTCCATCAGTAGG + Intronic
1190874102 X:54447448-54447470 GTGTCTCTGGCCACAGAAACAGG - Exonic
1191823062 X:65334726-65334748 GTTTCTCTGACCTAATAAGCAGG + Intergenic
1194059532 X:89180394-89180416 GTTTCTAGGGCCCAATAAGCAGG + Intergenic
1195451576 X:105019903-105019925 GTTTCTTTGGCTCCAAAATCTGG - Intronic
1195558930 X:106261245-106261267 GTTTCTAGGGCCTAATAAGCAGG + Intergenic
1198018234 X:132633166-132633188 GTTTCTCTTGCACAATAGGCTGG - Intronic
1198944014 X:141989489-141989511 GTTTCTGTGGCCCAAAAATCTGG - Intergenic
1199681536 X:150227974-150227996 CTGTCTTTGGCCCCAGAAGCTGG - Intergenic
1200869418 Y:8081403-8081425 ATATCTCTGGGCACATAAGCTGG - Intergenic