ID: 908651380

View in Genome Browser
Species Human (GRCh38)
Location 1:66336970-66336992
Sequence CAGGCTGATTGCCCTAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908651375_908651380 20 Left 908651375 1:66336927-66336949 CCAGCTGGGAATTAGGCTGCATG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 908651380 1:66336970-66336992 CAGGCTGATTGCCCTAATGAGGG No data
908651371_908651380 27 Left 908651371 1:66336920-66336942 CCCCGAGCCAGCTGGGAATTAGG No data
Right 908651380 1:66336970-66336992 CAGGCTGATTGCCCTAATGAGGG No data
908651374_908651380 25 Left 908651374 1:66336922-66336944 CCGAGCCAGCTGGGAATTAGGCT No data
Right 908651380 1:66336970-66336992 CAGGCTGATTGCCCTAATGAGGG No data
908651373_908651380 26 Left 908651373 1:66336921-66336943 CCCGAGCCAGCTGGGAATTAGGC 0: 1
1: 0
2: 2
3: 16
4: 120
Right 908651380 1:66336970-66336992 CAGGCTGATTGCCCTAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908651380 Original CRISPR CAGGCTGATTGCCCTAATGA GGG Intronic
No off target data available for this crispr