ID: 908651944

View in Genome Browser
Species Human (GRCh38)
Location 1:66343409-66343431
Sequence GCTCCTAGGACGCCAAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908651939_908651944 24 Left 908651939 1:66343362-66343384 CCCTTGGCTCAAACATGTCATCA 0: 1
1: 0
2: 1
3: 19
4: 239
Right 908651944 1:66343409-66343431 GCTCCTAGGACGCCAAACTGTGG No data
908651938_908651944 25 Left 908651938 1:66343361-66343383 CCCCTTGGCTCAAACATGTCATC 0: 1
1: 0
2: 0
3: 9
4: 247
Right 908651944 1:66343409-66343431 GCTCCTAGGACGCCAAACTGTGG No data
908651942_908651944 -7 Left 908651942 1:66343393-66343415 CCTGTGCTATGATTCTGCTCCTA 0: 1
1: 0
2: 2
3: 11
4: 149
Right 908651944 1:66343409-66343431 GCTCCTAGGACGCCAAACTGTGG No data
908651940_908651944 23 Left 908651940 1:66343363-66343385 CCTTGGCTCAAACATGTCATCAG 0: 1
1: 0
2: 0
3: 23
4: 248
Right 908651944 1:66343409-66343431 GCTCCTAGGACGCCAAACTGTGG No data
908651941_908651944 -6 Left 908651941 1:66343392-66343414 CCCTGTGCTATGATTCTGCTCCT No data
Right 908651944 1:66343409-66343431 GCTCCTAGGACGCCAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908651944 Original CRISPR GCTCCTAGGACGCCAAACTG TGG Intronic
No off target data available for this crispr