ID: 908653880

View in Genome Browser
Species Human (GRCh38)
Location 1:66366778-66366800
Sequence TTTATATGTTGCAGTGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908653880_908653883 10 Left 908653880 1:66366778-66366800 CCTATAGCACTGCAACATATAAA 0: 1
1: 0
2: 0
3: 14
4: 217
Right 908653883 1:66366811-66366833 AGATCTGTGGCCTTGATCACAGG No data
908653880_908653881 -3 Left 908653880 1:66366778-66366800 CCTATAGCACTGCAACATATAAA 0: 1
1: 0
2: 0
3: 14
4: 217
Right 908653881 1:66366798-66366820 AAAGCCTGCTTGTAGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908653880 Original CRISPR TTTATATGTTGCAGTGCTAT AGG (reversed) Intronic
904012938 1:27400188-27400210 TGTATATGTGGCTGTGCTAATGG - Intergenic
904426724 1:30429796-30429818 TTTATATATTGAAGTGCTTTGGG - Intergenic
904881711 1:33703401-33703423 TTTATATTTTTGATTGCTATTGG + Intronic
907554137 1:55330098-55330120 TGTATAAGCTGCAGTGCTATTGG + Intergenic
907596623 1:55726298-55726320 TTTCTATGTTGGAGTGCTTAAGG - Intergenic
908026234 1:59954629-59954651 TTCATTTGTTGCAGAGATATGGG + Intergenic
908653880 1:66366778-66366800 TTTATATGTTGCAGTGCTATAGG - Intronic
909221638 1:72969941-72969963 TTTATATGTTGGATTGTTCTTGG - Intergenic
910072458 1:83233866-83233888 TTTATATTTTTCAGTGATATTGG + Intergenic
916412659 1:164560888-164560910 TTTATATATTTCAGTACTATAGG + Intronic
917582583 1:176394033-176394055 TTTTTTTCTTGCAGTTCTATTGG + Intergenic
919686938 1:200492473-200492495 TTAATATGATGCCGTGTTATAGG + Intergenic
1063113961 10:3060205-3060227 TTAAGAGGTTGCAGTGCTAGCGG - Intergenic
1063846404 10:10132668-10132690 TAGATATTTTTCAGTGCTATAGG + Intergenic
1066313621 10:34222036-34222058 TTTATATAGTGCAATGCTAGAGG - Intronic
1071619628 10:87107439-87107461 ATAATATGGTGCTGTGCTATGGG + Intronic
1073993023 10:109285545-109285567 TTTATATGTTTCATAGCTTTAGG + Intergenic
1075449217 10:122536955-122536977 TTAATGTATAGCAGTGCTATTGG - Intergenic
1077727455 11:4689152-4689174 TTTATATGTTGCAATGTCCTGGG - Intronic
1078306331 11:10191085-10191107 TTAATATGTAGCAGTTGTATAGG - Intronic
1079675955 11:23226892-23226914 TTTTTACTTTTCAGTGCTATGGG - Intergenic
1082165973 11:48951494-48951516 TTCAGATTTTGCAGTGATATCGG - Intergenic
1082169537 11:48986249-48986271 TGTAGGTGTTGCAGTGATATGGG + Intergenic
1082234674 11:49809838-49809860 TGTAGGTGTTGCAGTGATATGGG - Intergenic
1082237229 11:49833518-49833540 TTCAGATTTTGCAGTGATATCGG + Intergenic
1082241463 11:49876236-49876258 TTCAGATTTTGCAGTGATATCGG - Intergenic
1082608377 11:55270533-55270555 TGTAGGTGTTGCAGTGATATGGG - Exonic
1082610617 11:55292444-55292466 TTCAGATTTTGCAGTGATATCGG + Intergenic
1082611420 11:55302844-55302866 TGTAGGTGTTGCAGTGATATGGG + Intergenic
1082658499 11:55880843-55880865 TGTAGGTGTTGCAGTGATATGGG - Intergenic
1086696295 11:89850391-89850413 TGTAGGTGTTGCAGTGATATGGG - Intergenic
1086697480 11:89862490-89862512 TTCAGATTTTGCAGTGATATCGG - Intergenic
1086702231 11:89911968-89911990 TGTAGGTGTTGCAGTGATATGGG + Exonic
1086703936 11:89932482-89932504 TGTAGGTGTTGCAGTGATATGGG - Intergenic
1086708679 11:89981998-89982020 TTCAGATTTTGCAGTGATATCGG + Intergenic
1086709861 11:89994098-89994120 TGTAGGTGTTGCAGTGATATGGG + Intergenic
1088525056 11:110743827-110743849 TTTAAATGTTGGAATGCTAGAGG + Intergenic
1088569370 11:111206841-111206863 TTTCTATGTTCCAGTCCTCTAGG - Intergenic
1092070491 12:5627538-5627560 TTTATTGGATGCAGTGCTCTGGG - Intronic
1092314459 12:7395640-7395662 TTTATTTGTTCTAATGCTATTGG + Intronic
1093921552 12:24865251-24865273 TTTGTTTGTTGGAGTGATATGGG - Intronic
1095938205 12:47707800-47707822 TTTATGTGTTGCAGTTGTAATGG + Intergenic
1096129427 12:49145921-49145943 TTTATAAGTTAGAGTGCTCTGGG - Intergenic
1098618581 12:72561327-72561349 TATATATGTTGCAGAGATAATGG + Intronic
1100758390 12:97777500-97777522 TTTATATGTTGGCATGCTTTTGG - Intergenic
1104109571 12:125691929-125691951 TTAATATTTTGCATTCCTATGGG + Intergenic
1108949647 13:56075071-56075093 TTTAAATCTTGTAGTTCTATAGG + Intergenic
1111108058 13:83671846-83671868 TTTATAAGATGCAGTGTTAATGG + Intergenic
1112978051 13:105345629-105345651 TTTATGTGTTTAATTGCTATAGG + Intergenic
1115335471 14:32240780-32240802 TTTATATGTTGGCATGCTCTGGG + Intergenic
1115887895 14:37994147-37994169 TTTATATGTTGGCATGCTTTTGG - Intronic
1120303638 14:82739230-82739252 TTTATATGTTGCACAGGTAGAGG - Intergenic
1120328969 14:83063639-83063661 TTTGAATGTTGCAGTGCTCCAGG + Intergenic
1120546686 14:85820402-85820424 TTTATATTTTGACGGGCTATGGG + Intergenic
1120578912 14:86221808-86221830 GTTATATTTTTCAGTGTTATGGG - Intergenic
1125312488 15:38395417-38395439 TTTATTTGTTGCTGTGTTTTTGG + Intergenic
1126330698 15:47527937-47527959 TTTTTATGTTGAAGTAATATGGG - Intronic
1126398324 15:48242871-48242893 TTTTTTTGTTTCAGTGCTTTAGG + Intronic
1128493542 15:68174941-68174963 TTTATATGTTACATAGCTTTAGG + Intronic
1135204818 16:20474512-20474534 TTTATTTCTTGCAGTTCTAGGGG - Intronic
1135214079 16:20549301-20549323 TTTATTTCTTGCAGTTCTAGGGG + Intronic
1135717425 16:24783662-24783684 TTTATACGCTGCAATGCTGTAGG - Intronic
1137493843 16:48953732-48953754 TTTATATCCTGAAGTGCTAGAGG + Intergenic
1145209051 17:20999869-20999891 TCTATATGTTGCAGTGGTGCTGG + Exonic
1149890707 17:60387491-60387513 ATTAAGTGCTGCAGTGCTATAGG - Intronic
1150835548 17:68560486-68560508 TTTATTTCTTGCAGTACTAGAGG - Intronic
1151634422 17:75335115-75335137 TTTATATGTTGGATTGCAACTGG + Intronic
1153472587 18:5463553-5463575 GTTCTATGTTGCTGTGCTACAGG + Intronic
1155097477 18:22571801-22571823 TTCATATGTTGAAGTCCTAATGG - Intergenic
1155209853 18:23591235-23591257 TTTATCTGTTACAGTTCTAGAGG + Intergenic
1155578152 18:27271562-27271584 TTTATATGGTGGATTGCTTTGGG + Intergenic
1156952678 18:42921977-42921999 ATGATATGTTGCATTTCTATGGG - Intronic
1157835373 18:50897244-50897266 TGTATCTTTTACAGTGCTATGGG + Intronic
1158175971 18:54656116-54656138 GAAATATGTTGCAGTGCAATTGG - Intergenic
1158491525 18:57914063-57914085 TTTATATCTTCCAGTGTGATGGG + Intergenic
1159676388 18:71288476-71288498 TTTATATGCTGAACTCCTATCGG - Intergenic
925732480 2:6929354-6929376 TTTATTTGTTGCACTTCCATAGG + Intronic
926542604 2:14200058-14200080 TTTATTTTTTGCACTGATATAGG + Intergenic
928041733 2:27884900-27884922 TTTAAATGTTGTAGTGCCCTAGG + Intronic
928665891 2:33550441-33550463 TTAATTTGTTGCAGTGGTGTAGG - Intronic
928755373 2:34518063-34518085 TTTATAAGTTGCTTTGTTATTGG + Intergenic
929942066 2:46341814-46341836 CTTAAATGATGCAGTGTTATTGG - Intronic
930620660 2:53639950-53639972 TTTATTTCTTGCAGTTCTAGAGG - Intronic
933001180 2:76925466-76925488 TTTTTATCTTGAAGTTCTATAGG - Intronic
933376869 2:81490947-81490969 TTTATATCTTGCACTGTTTTAGG + Intergenic
934040394 2:88123529-88123551 TTTATATGCTTCACAGCTATAGG - Intronic
935286999 2:101573958-101573980 TTTATATTTTGCACTGCCCTAGG + Intergenic
935934401 2:108166271-108166293 TTATTTTGTTGCAGTGATATGGG + Intergenic
935981013 2:108627411-108627433 TTTTTTTTTTGCACTGCTATAGG + Intronic
936722282 2:115267043-115267065 TTTAGATGGTGAAGTCCTATAGG - Intronic
938626194 2:133112061-133112083 TCTATATGTTGCACTGCCCTTGG - Intronic
941810075 2:169746943-169746965 TTTATATGTTGAATTTTTATAGG - Intronic
942335037 2:174874606-174874628 TTTTTTTGTTGCAGTCCTAAAGG - Intronic
943096077 2:183430883-183430905 TTTATATCTTACAGTTCTGTGGG + Intergenic
943539805 2:189198318-189198340 TTTATGTTTTGCAGTACTGTTGG + Intergenic
943776156 2:191768106-191768128 TTTAGATGTTGTGTTGCTATTGG + Intergenic
943783955 2:191855911-191855933 TTTCTAAGTTTAAGTGCTATTGG + Intergenic
944429152 2:199614775-199614797 TATAGATGTTCCAGTCCTATAGG + Intergenic
945416324 2:209577432-209577454 TTTATATGATTCAATGCTTTTGG - Intronic
945432015 2:209775699-209775721 TGTATATGTTGATGTGCAATGGG - Intronic
1169298858 20:4424564-4424586 TTTGTATCTTGCAGTGCTTAGGG + Intergenic
1170184587 20:13574087-13574109 TTCATTTGTTCCAGTGCTTTGGG - Intronic
1170452112 20:16493924-16493946 TTAATATGTTGCTTTGATATTGG + Intronic
1173771512 20:45663320-45663342 TTTATTTGTCGCAATGCTAGTGG + Intronic
1174232548 20:49058137-49058159 TTTATATGATTTAATGCTATGGG - Intronic
1174415445 20:50363359-50363381 TTTATATTTTTCAGGGTTATAGG + Intergenic
1174650435 20:52120209-52120231 TTTATTTCTTGCAGTTCTAGAGG - Intronic
1177281285 21:18986033-18986055 TTAATATGTTTCAGTCCTAGGGG + Intergenic
1182034222 22:27185191-27185213 TATATATCTTGCAGGGCTGTTGG + Intergenic
1182812219 22:33126680-33126702 TTATTCTGTTGCATTGCTATGGG + Intergenic
949619952 3:5799643-5799665 TTTTTATTTTGTAGTGCTAAAGG - Intergenic
951489091 3:23248849-23248871 GTGATCTGTTGCAGTGCTAGAGG + Intronic
952177187 3:30877470-30877492 TTTGTATGATGCAGTGATAGAGG - Intronic
954642502 3:52109665-52109687 TTTCTCTGTGGCAGTGCTAAAGG - Intronic
954941742 3:54379386-54379408 TTTATATGTGCCATTTCTATTGG + Intronic
955320017 3:57967807-57967829 TTTATATGTTGGCGTGCTTCTGG + Intergenic
955900510 3:63748689-63748711 TTTATTTCTTACAGTGCTAGAGG - Intergenic
955907714 3:63825066-63825088 TTTATATTGTGCAGTTCTGTGGG + Intronic
957254790 3:77823006-77823028 TTTCTATTTTGCAGGGATATTGG + Intergenic
957899625 3:86472295-86472317 ATAATATGTTGAAATGCTATTGG + Intergenic
957983907 3:87547816-87547838 TTTATATGTTGTAGAACTATCGG + Intergenic
958595778 3:96220217-96220239 TTTCTATGATGCAGTAATATGGG - Intergenic
959370880 3:105523592-105523614 GTTATATGTCTCAGTGCTCTTGG + Intronic
960487776 3:118274176-118274198 TTTATTTTTTGCAGTTCTAAAGG + Intergenic
962323447 3:134410665-134410687 GGCATATGTTGCAGTGCTGTTGG + Intergenic
963924875 3:150940696-150940718 TTTATATGTAGCTGTTCTGTAGG - Intronic
964490265 3:157228515-157228537 TCTAAATGTTGGAATGCTATAGG + Intergenic
965079689 3:164020621-164020643 CTGATATGTGTCAGTGCTATGGG + Intergenic
965997598 3:174904130-174904152 TGTATATGTTGCATTACTCTAGG - Intronic
968617813 4:1587782-1587804 TTTATTTGTTCCAGTGCCATTGG + Intergenic
970109180 4:12618280-12618302 TATATATGTTGCAGTGTCACTGG + Intergenic
971491906 4:27221815-27221837 TTTATATGTATCAGAGATATTGG + Intergenic
971805099 4:31348067-31348089 TTTATATGGTGCAGTGATAAAGG + Intergenic
974978373 4:68921074-68921096 TATTTATTTTGCAGTCCTATGGG - Intergenic
977149353 4:93490057-93490079 TTTAAATGTTGGAGTGTTCTTGG - Intronic
980380464 4:132007866-132007888 TTTTTATTGTGCAGTTCTATGGG + Intergenic
980539050 4:134169622-134169644 TTGACATATTGCAGTGCTACTGG - Intergenic
980798231 4:137712870-137712892 AACATATGTTGCAGTGCTACTGG - Intergenic
982865457 4:160505116-160505138 TTAAAATGTTGCAGTACTTTAGG + Intergenic
983432941 4:167674360-167674382 TTTATTTCTTACAGTTCTATAGG + Intergenic
983682190 4:170366058-170366080 TTTATATGTTGTAGTACATTTGG + Intergenic
985273661 4:188217661-188217683 TTTAAATGCTCCAGTGCTTTAGG - Intergenic
985362842 4:189193659-189193681 TGTATATTTTGCATTTCTATAGG + Intergenic
986178599 5:5373040-5373062 TTTATATGTTGGCATGCTTTTGG + Intergenic
986654522 5:9998268-9998290 TTTATAAGTGGCACTTCTATGGG + Intergenic
986849345 5:11793125-11793147 TTTACAGTTTGCTGTGCTATTGG + Intronic
987201061 5:15578790-15578812 TTTTTATTTTGGAGGGCTATGGG - Intronic
987225063 5:15831519-15831541 TTTCTATGGTCCAGTGCTGTGGG + Intronic
988460547 5:31432834-31432856 TTTGTATGTTGTAATGCCATGGG - Intronic
989004661 5:36796941-36796963 TTTCTATGTCCCAGTGGTATGGG - Intergenic
989789245 5:45376497-45376519 TTTATATCTTGCAGTTCTGGAGG - Intronic
990767003 5:59195131-59195153 TTTATATCTTACAGTTCTAGAGG - Intronic
993188823 5:84654759-84654781 ATTATATGTTGCACTGTTATGGG - Intergenic
993469141 5:88285614-88285636 TTTGTTTGTTGCATTGTTATAGG - Intergenic
994925876 5:106116316-106116338 TTTATATCTTGCAGTCTTTTTGG - Intergenic
996023012 5:118612429-118612451 TTTATATGCTGCAATACTTTGGG - Intergenic
996555656 5:124776592-124776614 TCAATATCTTGCAGTTCTATAGG + Intergenic
997027160 5:130078378-130078400 TCTTTATGTGGCAGTTCTATAGG - Intronic
997348826 5:133215262-133215284 TTTAAATGTTGGAGTGCTTCAGG + Intronic
997383623 5:133455437-133455459 TTTATCTTTTGCTGTGTTATCGG - Intronic
998601033 5:143585275-143585297 TTTATATGGATCAGTGCTATTGG - Intergenic
998624441 5:143829656-143829678 TTTATCTGTTGAAGTGCATTTGG + Intergenic
999507528 5:152213644-152213666 TCTAAATGTTGCAGTGCTCCAGG - Intergenic
1000194916 5:158947958-158947980 TTTTTCTGTTGCAGTGCTGGAGG - Intronic
1000798905 5:165699509-165699531 TTTATATATTGCTGTGTTAAAGG - Intergenic
1003469191 6:6412816-6412838 TATATATGTTGCACTTCTCTTGG + Intergenic
1003699162 6:8443329-8443351 TTTTTATTTTACAGTTCTATAGG + Intergenic
1005504815 6:26460305-26460327 TTGATATGTTGTAGTTCTCTGGG - Intronic
1005696751 6:28358929-28358951 CTTATTTGTTCCAGTTCTATAGG + Intronic
1008338015 6:50329813-50329835 TTTATATGTAACTGTTCTATTGG - Intergenic
1009025845 6:57999432-57999454 TTTTTATGTTGCAGTACTGTGGG + Intergenic
1009201403 6:60750899-60750921 TTTTTATGTTGCAGTACTGTAGG + Intergenic
1009314180 6:62196990-62197012 TTTTTATACTGCAGTGCTAGAGG - Intronic
1010344630 6:74797506-74797528 TATATATGTTGAAGTGTTAAGGG + Intergenic
1010653441 6:78481829-78481851 TTTATAAGATGCAGTGAAATTGG + Intergenic
1011449484 6:87477618-87477640 TTTATATGTTTAATTGCTCTGGG + Intronic
1013719170 6:113001963-113001985 ATTACATGTTGAAATGCTATTGG + Intergenic
1015081425 6:129230110-129230132 TCTAAATGTTGGGGTGCTATAGG - Intronic
1015824876 6:137300967-137300989 TTTATATGTTGGCATGCTTTGGG + Intergenic
1015891438 6:137973634-137973656 TTTATTTATTGCAGTTCTAGAGG + Intergenic
1016019442 6:139220258-139220280 TTTATTTCTTGCAGTACTAGAGG - Intergenic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1017626928 6:156358437-156358459 TTTATATGCCGCAGTCCCATTGG - Intergenic
1018058900 6:160074771-160074793 ATTATATGTGGCAGTGATATGGG + Intronic
1020343560 7:7138774-7138796 ATTATAAATTGCAGTACTATTGG + Intergenic
1022092381 7:27115970-27115992 TTTATTTGTTGGTTTGCTATTGG + Intronic
1022601771 7:31767704-31767726 TTTATTTCTTGCAGTTCTAGAGG + Intronic
1024273031 7:47656672-47656694 TTTATTTCTTGCAGTTCTAGTGG - Intronic
1025255109 7:57379403-57379425 TTTATATTTTTCAGGGTTATAGG - Intergenic
1027290170 7:76698839-76698861 TTTATATTTTTCAGTGATATTGG + Intergenic
1028312222 7:89353514-89353536 TTTATTTCTTACAGTGCTAGAGG + Intergenic
1028672306 7:93416488-93416510 TTCTTTTGTTGCTGTGCTATTGG + Intergenic
1028991130 7:97050189-97050211 TTTATGTGATGCAATGATATTGG - Intergenic
1030767031 7:113422651-113422673 TATTTATGTTGCAGTGAGATGGG + Intergenic
1031849818 7:126850333-126850355 TTTATGTGTTGGAGTGCTTCAGG + Intronic
1032860805 7:135877494-135877516 TTTATATTTCTCATTGCTATAGG + Intergenic
1032961788 7:137043973-137043995 TTTATTTCTTGCAGTGCTAGAGG + Intergenic
1033715788 7:144000710-144000732 TTTAAATGTTGCTGCGCTGTAGG - Intergenic
1035144055 7:156795269-156795291 TTTATATAATGAAGTCCTATGGG - Intronic
1035960916 8:4136962-4136984 TTTATTTGTTTCATTGATATAGG - Intronic
1036143556 8:6230361-6230383 TTTATATGTTTCAGAATTATTGG + Intergenic
1042018421 8:64343090-64343112 TTTATTTGTTGCTGTGTTAATGG - Intergenic
1042758555 8:72245614-72245636 TTGCAATGTTGCAGTGTTATTGG + Intergenic
1043957289 8:86375708-86375730 GTTATTTGTTGCAGCACTATTGG - Intronic
1045608116 8:103801581-103801603 TTTATATCTGCCAGTACTATTGG + Intronic
1045627558 8:104073367-104073389 CTTATTTGTTGAAATGCTATGGG - Intronic
1045876965 8:106992879-106992901 CTTATGTGTTGCTGGGCTATTGG + Intergenic
1046927142 8:119804011-119804033 TTTATTTGTTGCAGAGTTAAAGG - Exonic
1047452243 8:124975043-124975065 TTTTTATATTGCAGGGTTATTGG + Intronic
1048478234 8:134762586-134762608 TCTAAATGTTGAAGTGCTTTGGG + Intergenic
1048908281 8:139109630-139109652 TTTATATGGTTCAGTGTTAATGG - Intergenic
1049748123 8:144271581-144271603 TTTATCTGTTGAAGTGCTCAGGG + Intronic
1050251772 9:3752194-3752216 TAGATGTGTTGCAGTGCTGTGGG + Intergenic
1051524760 9:18031584-18031606 TGCATATGTAGCAGTGCTCTGGG + Intergenic
1053567138 9:39265386-39265408 TTCATTTGTTGCAGAGATATGGG - Intronic
1053832909 9:42103232-42103254 TTCATTTGTTGCAGAGATATGGG - Intronic
1054130005 9:61353613-61353635 TTCATTTGTTGCAGAGATATGGG + Intergenic
1054597643 9:67084178-67084200 TTCATTTGTTGCAGAGATATGGG + Intergenic
1058990120 9:110247424-110247446 GTTATATGGTGCATTACTATAGG - Intronic
1186731919 X:12419276-12419298 TCAATCTGTTGCAGTACTATAGG - Intronic
1188471403 X:30544349-30544371 TTTATATGTTTAATGGCTATAGG - Intergenic
1190021417 X:46881255-46881277 TTGAAATGATGCAGTGCTAATGG - Exonic
1190426960 X:50342594-50342616 TTTATGACTTGCAGTGCAATAGG - Intronic
1192776338 X:74249423-74249445 TTTATATATTAAAGTGCCATTGG + Intergenic
1193181596 X:78464856-78464878 TTTATTTCTTACAGTGCTGTAGG + Intergenic
1195549506 X:106151101-106151123 TTTATTTCTTGCAGTTCTAGAGG - Intergenic
1196178087 X:112662287-112662309 TTTATAGGTTCCAGAGCTCTGGG + Intronic
1196324462 X:114386113-114386135 TTTACATTTTGCACTGGTATGGG + Intergenic
1196769134 X:119276043-119276065 TTTTTATTTTGCAATGCTAGAGG - Intergenic
1198717625 X:139576796-139576818 TTCTTTTTTTGCAGTGCTATTGG - Intergenic
1199781087 X:151060288-151060310 TATATATATTGCTGTGCAATAGG + Intergenic
1199940554 X:152622371-152622393 TTCATATATTGCAGTACTTTTGG - Intergenic