ID: 908655683

View in Genome Browser
Species Human (GRCh38)
Location 1:66385766-66385788
Sequence CCCTTTTATGGAGACTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908655683_908655690 -1 Left 908655683 1:66385766-66385788 CCACTGAAGTCTCCATAAAAGGG No data
Right 908655690 1:66385788-66385810 GCCAAGAGGACAGGGTTCATGGG No data
908655683_908655688 -9 Left 908655683 1:66385766-66385788 CCACTGAAGTCTCCATAAAAGGG No data
Right 908655688 1:66385780-66385802 ATAAAAGGGCCAAGAGGACAGGG No data
908655683_908655689 -2 Left 908655683 1:66385766-66385788 CCACTGAAGTCTCCATAAAAGGG No data
Right 908655689 1:66385787-66385809 GGCCAAGAGGACAGGGTTCATGG No data
908655683_908655692 0 Left 908655683 1:66385766-66385788 CCACTGAAGTCTCCATAAAAGGG No data
Right 908655692 1:66385789-66385811 CCAAGAGGACAGGGTTCATGGGG No data
908655683_908655693 7 Left 908655683 1:66385766-66385788 CCACTGAAGTCTCCATAAAAGGG No data
Right 908655693 1:66385796-66385818 GACAGGGTTCATGGGGCTTCTGG No data
908655683_908655687 -10 Left 908655683 1:66385766-66385788 CCACTGAAGTCTCCATAAAAGGG No data
Right 908655687 1:66385779-66385801 CATAAAAGGGCCAAGAGGACAGG No data
908655683_908655694 26 Left 908655683 1:66385766-66385788 CCACTGAAGTCTCCATAAAAGGG No data
Right 908655694 1:66385815-66385837 CTGGAGAGCTGAACTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908655683 Original CRISPR CCCTTTTATGGAGACTTCAG TGG (reversed) Intergenic
No off target data available for this crispr