ID: 908657302

View in Genome Browser
Species Human (GRCh38)
Location 1:66401863-66401885
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908657297_908657302 10 Left 908657297 1:66401830-66401852 CCAGGCACAAGTTGCTATGTGTT No data
Right 908657302 1:66401863-66401885 TCTCCTAAATGGAGTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type