ID: 908657302 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:66401863-66401885 |
Sequence | TCTCCTAAATGGAGTCCTGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
908657297_908657302 | 10 | Left | 908657297 | 1:66401830-66401852 | CCAGGCACAAGTTGCTATGTGTT | No data | ||
Right | 908657302 | 1:66401863-66401885 | TCTCCTAAATGGAGTCCTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
908657302 | Original CRISPR | TCTCCTAAATGGAGTCCTGG TGG | Intergenic | ||