ID: 908661288

View in Genome Browser
Species Human (GRCh38)
Location 1:66438228-66438250
Sequence ATAACGGATGTGGCCAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908661283_908661288 16 Left 908661283 1:66438189-66438211 CCTGATTCAGAATTATAAATGTT No data
Right 908661288 1:66438228-66438250 ATAACGGATGTGGCCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908661288 Original CRISPR ATAACGGATGTGGCCAGAAA TGG Intergenic
No off target data available for this crispr