ID: 908669803

View in Genome Browser
Species Human (GRCh38)
Location 1:66533791-66533813
Sequence TAAGTGGCTCGCTGCGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908669803_908669810 11 Left 908669803 1:66533791-66533813 CCCCCTCCGCAGCGAGCCACTTA 0: 1
1: 0
2: 0
3: 6
4: 46
Right 908669810 1:66533825-66533847 CACGCCAGAGTCCCCTGTTAAGG 0: 1
1: 0
2: 2
3: 0
4: 53
908669803_908669811 14 Left 908669803 1:66533791-66533813 CCCCCTCCGCAGCGAGCCACTTA 0: 1
1: 0
2: 0
3: 6
4: 46
Right 908669811 1:66533828-66533850 GCCAGAGTCCCCTGTTAAGGTGG 0: 1
1: 0
2: 6
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908669803 Original CRISPR TAAGTGGCTCGCTGCGGAGG GGG (reversed) Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
921803759 1:219431401-219431423 AAAGTGGCTGTCTGCTGAGGTGG + Intergenic
922311212 1:224392850-224392872 TAAGTGATTCTCTGTGGAGGAGG - Intronic
1081909835 11:46693897-46693919 TAAATGGCTCTCTGGAGAGGGGG - Intronic
1083144781 11:60750117-60750139 TAGCTGGCTGGCTGGGGAGGAGG - Intergenic
1090407685 11:126486965-126486987 TATGAGGCTCGTTGAGGAGGTGG - Intronic
1093533330 12:20193564-20193586 TAAGTGGTTGCCTGGGGAGGGGG - Intergenic
1125181512 15:36885132-36885154 TAAGTTTCTCGCTTTGGAGGAGG - Intergenic
1142197396 16:88745141-88745163 GCAGTGGGTCCCTGCGGAGGTGG - Intronic
1148816044 17:50329030-50329052 GAAGTGGCTGGCTGTGGAGGAGG - Intergenic
1161531392 19:4792120-4792142 CAGGTGGCCGGCTGCGGAGGCGG - Exonic
1161942204 19:7412408-7412430 TAAGTGTCTCGGTGAGAAGGCGG - Intronic
1164243394 19:23409725-23409747 TTAGAGGCTGGCTGCGGAGGTGG - Intergenic
1164706288 19:30322761-30322783 TAAGGGGCTCGGTGGGCAGGAGG - Intronic
1165657096 19:37543559-37543581 TAAGTGTTTCGCTGATGAGGTGG - Intronic
933178873 2:79207671-79207693 GAAGTGGCTCCCTGCAGAGCTGG + Intronic
938662571 2:133502883-133502905 GAGGTGGCTCCCTGCAGAGGAGG + Intronic
944450345 2:199835983-199836005 GAAGTGGTTGGCTGGGGAGGGGG + Intronic
944667120 2:201967718-201967740 AAAGGGGCTAACTGCGGAGGCGG + Intergenic
945802567 2:214451294-214451316 TAAGTGGGTCGGTGTGGGGGGGG + Intronic
948281071 2:236748380-236748402 GAAGTGGCTGGCTCAGGAGGTGG + Intergenic
948910262 2:240999130-240999152 CAAGTGGCTGGCGGCGGCGGCGG - Intronic
1170884226 20:20325137-20325159 TAAGTGGCTGGGGGTGGAGGAGG - Intronic
1179562114 21:42222084-42222106 TATGTGGCCCGGTGCGGGGGTGG + Intronic
1180103571 21:45601816-45601838 CAAGTGGCCGGCTGGGGAGGGGG - Intergenic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1185367456 22:50443451-50443473 TAAGGGGCTTGCTCTGGAGGGGG - Intronic
951534653 3:23729713-23729735 GAAGTGGCTCTCTGCGGTAGAGG - Intergenic
951692460 3:25410861-25410883 CAAGTGGCTCTCTGCAGAGCAGG - Intronic
955059592 3:55483944-55483966 TAAGGGACTGCCTGCGGAGGAGG - Intronic
961066665 3:123882471-123882493 TAACTGGCTAGCTGAGGAGGAGG - Intronic
968324544 3:197801594-197801616 TAAGTGCCTAACTGGGGAGGAGG - Intronic
979188119 4:117824325-117824347 AAAGTGGCTCTCAGCGGAGAGGG - Intergenic
982642717 4:157983375-157983397 TAAGTGGAAAACTGCGGAGGTGG - Intergenic
990458520 5:56012278-56012300 AAGGTGGCAGGCTGCGGAGGTGG + Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
998656792 5:144190084-144190106 TAAGTGCCTGGCTGCGGGTGGGG - Intronic
1003121264 6:3320598-3320620 GAAGTGGCCCGCTGTGGAGAGGG - Intronic
1006884749 6:37371834-37371856 TAAGAGGCTCTCTGGGGAAGTGG + Intronic
1007704816 6:43784136-43784158 GAAGAGGCTCCCTGCTGAGGAGG - Intronic
1011462575 6:87620172-87620194 TAAGGGGCTTGCTGCGGAAGAGG - Intronic
1014492754 6:122082450-122082472 GAAGTAGCTCTCTGCTGAGGGGG + Intergenic
1014627552 6:123747068-123747090 TCAGTGGCTAGCTGTGGAGAGGG - Intergenic
1030616629 7:111744188-111744210 CAAGTGGCTCTCTGCAGTGGAGG + Intronic
1033242439 7:139691196-139691218 TATGTGGCTAGCTGCAGAGCTGG + Intronic
1037755626 8:21708341-21708363 TCATTTGCTGGCTGCGGAGGGGG - Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1039601968 8:38846867-38846889 TAAGTGAGTCACTGCTGAGGAGG - Intronic
1042185797 8:66135228-66135250 TGAGTGGCTCCCTGCGGTGGAGG + Intronic
1047019409 8:120758907-120758929 TAAGTGGGTTGCTGCCAAGGAGG - Intronic
1049621294 8:143599466-143599488 CAAGTGCCTGGCTCCGGAGGAGG + Exonic
1056758581 9:89398410-89398432 GAAGTGGCTCTCAGCGGAGATGG - Intronic
1058893549 9:109381361-109381383 TAGGTGGGTCGGTGCGGGGGAGG + Intronic