ID: 908669810

View in Genome Browser
Species Human (GRCh38)
Location 1:66533825-66533847
Sequence CACGCCAGAGTCCCCTGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 2, 3: 0, 4: 53}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908669807_908669810 8 Left 908669807 1:66533794-66533816 CCTCCGCAGCGAGCCACTTAGGT No data
Right 908669810 1:66533825-66533847 CACGCCAGAGTCCCCTGTTAAGG 0: 1
1: 0
2: 2
3: 0
4: 53
908669805_908669810 9 Left 908669805 1:66533793-66533815 CCCTCCGCAGCGAGCCACTTAGG 0: 1
1: 0
2: 0
3: 5
4: 33
Right 908669810 1:66533825-66533847 CACGCCAGAGTCCCCTGTTAAGG 0: 1
1: 0
2: 2
3: 0
4: 53
908669803_908669810 11 Left 908669803 1:66533791-66533813 CCCCCTCCGCAGCGAGCCACTTA 0: 1
1: 0
2: 0
3: 6
4: 46
Right 908669810 1:66533825-66533847 CACGCCAGAGTCCCCTGTTAAGG 0: 1
1: 0
2: 2
3: 0
4: 53
908669809_908669810 -5 Left 908669809 1:66533807-66533829 CCACTTAGGTGCTGCTTTCACGC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 908669810 1:66533825-66533847 CACGCCAGAGTCCCCTGTTAAGG 0: 1
1: 0
2: 2
3: 0
4: 53
908669808_908669810 5 Left 908669808 1:66533797-66533819 CCGCAGCGAGCCACTTAGGTGCT 0: 1
1: 0
2: 0
3: 6
4: 78
Right 908669810 1:66533825-66533847 CACGCCAGAGTCCCCTGTTAAGG 0: 1
1: 0
2: 2
3: 0
4: 53
908669804_908669810 10 Left 908669804 1:66533792-66533814 CCCCTCCGCAGCGAGCCACTTAG 0: 1
1: 0
2: 0
3: 4
4: 45
Right 908669810 1:66533825-66533847 CACGCCAGAGTCCCCTGTTAAGG 0: 1
1: 0
2: 2
3: 0
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908669810 Original CRISPR CACGCCAGAGTCCCCTGTTA AGG Intronic
901489977 1:9591728-9591750 GAAGTCAGAGTCCCCTGTAACGG + Intronic
904936252 1:34131759-34131781 CAGGCCAGAGTCTCCAGTCAGGG + Intronic
908669810 1:66533825-66533847 CACGCCAGAGTCCCCTGTTAAGG + Intronic
911192036 1:94957850-94957872 AAAGCCAGAGTTCCCTGTTGGGG - Intergenic
915167216 1:153954846-153954868 CACTCCCAAGTCCCCTGTGAAGG + Intronic
916678694 1:167085469-167085491 CCCACCAGAGTCCCCTCTCAGGG - Intronic
920215517 1:204359463-204359485 ACCTCCAGAGTCCCCTGTCAGGG - Intronic
1064168592 10:13008100-13008122 CATGACAGGGTACCCTGTTATGG + Intronic
1066780858 10:38943165-38943187 CTTGCCAGAAACCCCTGTTAAGG + Intergenic
1072000295 10:91188706-91188728 TCTGCCAGAGTCCTCTGTTATGG + Intronic
1078096172 11:8298546-8298568 CACCCCAGAAACCCCTGTTCTGG - Intergenic
1082693580 11:56332590-56332612 AACTCCATAGTCCCCTGTTCCGG + Intergenic
1083179442 11:60974736-60974758 CACCCCAGCCTCCCCTGTCAAGG - Intronic
1085088696 11:73691181-73691203 CACCCCAGAGCCCCCTTCTAAGG - Intronic
1095298870 12:40558980-40559002 CATGCCAGAGTCCCCAGGTCAGG + Intronic
1099409100 12:82302429-82302451 CCTGCCAGAGTGGCCTGTTAAGG + Intronic
1109994684 13:70107993-70108015 CGCGCGAGAGCCCCGTGTTATGG + Exonic
1113728077 13:112619970-112619992 GGCTCCAGAGTCCCCCGTTAGGG - Intergenic
1121302177 14:92880653-92880675 CATTCCTGAGTGCCCTGTTAAGG - Intergenic
1127769062 15:62216079-62216101 AACTCCATAGTCCCCTGTTCTGG + Intergenic
1128133893 15:65248810-65248832 CAGGCCAGAGTCCTAGGTTAGGG + Intronic
1141681419 16:85546520-85546542 CAGGGCAGAGGCCCCTGTTCTGG - Intergenic
1147495535 17:40911775-40911797 CAAGCCAGAGACCCATGCTAGGG - Intergenic
1148655020 17:49276824-49276846 CACCCCACAGTCCCCTGACATGG + Intergenic
1152411062 17:80123338-80123360 CAGGCCAGCGTCCCATGTAATGG - Intergenic
1162418483 19:10552487-10552509 AACGCCAAAGCCCACTGTTAAGG + Intronic
1162953050 19:14083259-14083281 CACCCCAGAGGCCCCTGGTCGGG - Exonic
927231193 2:20825772-20825794 CACAGCAGAGACCCCTCTTAAGG - Intergenic
928258145 2:29742662-29742684 CATGCCAGAGTCTCCTGCCAGGG - Intronic
931984169 2:67725620-67725642 CACCCCAGAATCCCCTGCTCAGG - Intergenic
936160698 2:110082174-110082196 CACGCCAGAGCCCACTGTTATGG + Intergenic
936183966 2:110289180-110289202 CACGCCAGAGCCCACTGTTATGG - Intergenic
945212474 2:207397876-207397898 CAGGACAGAGTCCCCTGTGTCGG + Intergenic
948420548 2:237857822-237857844 CAAGCCAGAGTCCCTGGATATGG + Intergenic
1172766914 20:37355918-37355940 CAAGCCTGAGTGCCCTGTGAGGG - Intronic
1173802726 20:45904859-45904881 CACTCCTGATTCCCCTGTTCAGG - Exonic
1177502357 21:21973974-21973996 CACGCCAGGGTCCTCTGCCATGG - Intergenic
1179939721 21:44629557-44629579 AAAGCCAGAGCCCCCTGATATGG - Intronic
950792854 3:15487420-15487442 CAGGCCGGAGTCCCCTCTTGTGG + Intronic
960937431 3:122912472-122912494 CACCCAACAGTCCACTGTTAGGG + Intronic
967136943 3:186520596-186520618 CACGCCAGAAGCCCATGTGAAGG - Intergenic
976435660 4:85014763-85014785 CAAGTCAAAGTCACCTGTTAAGG - Intergenic
979905920 4:126292590-126292612 CACGCAACAGTCAACTGTTAGGG + Intergenic
992089587 5:73305049-73305071 CACTCCAGAGTGCCCTGTCTGGG + Intergenic
997839879 5:137229587-137229609 CTCGTCTGAGCCCCCTGTTATGG - Intronic
1001543937 5:172558536-172558558 CACACCAGAGGCCCCTGAAAGGG + Intergenic
1002160285 5:177310836-177310858 GACACCAGAGTCCCCTGGCAGGG + Intronic
1006236645 6:32639139-32639161 CACACCAGAGTGCCCTGGTCAGG + Intronic
1013336627 6:109169434-109169456 TACTCCCAAGTCCCCTGTTATGG + Intergenic
1017304209 6:152898189-152898211 CACACCAGAGTCCCCGGTGCTGG - Intergenic
1017529613 6:155275760-155275782 CACTCCAGAGACCCCAGATAAGG - Exonic
1022552743 7:31256932-31256954 CATGCCAGAGTGCCATGTTTTGG + Intergenic
1042807694 8:72789741-72789763 CATGCCAGAATACCCCGTTAGGG - Intronic
1044807313 8:96021444-96021466 TAAGCCACAGTCCCCTGTTGTGG - Intergenic
1187003994 X:15213791-15213813 CACGCCTGAGTTCCCTTTTCAGG + Intergenic
1201278605 Y:12321509-12321531 AACTCCATAGTCCCCTGTTCAGG - Intergenic