ID: 908670133

View in Genome Browser
Species Human (GRCh38)
Location 1:66537109-66537131
Sequence ATTCCCCAGGGACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908670127_908670133 17 Left 908670127 1:66537069-66537091 CCTCCTCAGTGATCCTAATTTTG 0: 1
1: 0
2: 1
3: 174
4: 241
Right 908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 137
908670130_908670133 4 Left 908670130 1:66537082-66537104 CCTAATTTTGTGGAAGTCAACGA 0: 1
1: 0
2: 1
3: 4
4: 72
Right 908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 137
908670128_908670133 14 Left 908670128 1:66537072-66537094 CCTCAGTGATCCTAATTTTGTGG 0: 1
1: 0
2: 1
3: 10
4: 153
Right 908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908670133 Original CRISPR ATTCCCCAGGGACCACAAGC AGG Intronic
904462653 1:30689393-30689415 ATACCCCAGGGACTCCCAGCTGG + Intergenic
904616002 1:31750255-31750277 CTTCCTCAGGGACCACAGGAGGG - Intronic
905083269 1:35344811-35344833 ATTGCCCTGGGACCAAAACCAGG - Intronic
905248082 1:36628574-36628596 TTGCTGCAGGGACCACAAGCAGG - Intergenic
905707299 1:40070532-40070554 ATTCCTCAGGGACAAAAAGAAGG - Intronic
908017400 1:59857832-59857854 ATTTCCCAAGGACAGCAAGCTGG - Intronic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
909004505 1:70258991-70259013 ATTGCTCCGAGACCACAAGCTGG - Intergenic
909720904 1:78767949-78767971 ACTCTCCAAAGACCACAAGCTGG - Intergenic
913524505 1:119678203-119678225 ATTCCCAAGGGAGCATAAACAGG - Intronic
918078634 1:181189615-181189637 ATTCCCCAGAGACCTCAGCCAGG + Intergenic
920032121 1:203043863-203043885 GTGCCCCAGGGGCTACAAGCAGG - Intronic
922819584 1:228474863-228474885 ATTCCCCAGTGGACACCAGCTGG + Intergenic
922820315 1:228480233-228480255 ATTCCCCAGTGGACACCAGCTGG + Intergenic
1063670416 10:8095540-8095562 ATTCCCCAGGGAACACAGCAGGG + Intergenic
1065684623 10:28271579-28271601 ATTTCCCAGGGAGTACAAACAGG - Intronic
1066013701 10:31217323-31217345 ACTCCCCATGGACCCCAACCAGG + Intergenic
1066591746 10:37002318-37002340 ATTCCCCAAGGAAGACAAGCAGG - Intergenic
1067460316 10:46453315-46453337 ATTCCCCAGAAAGCAGAAGCTGG - Intergenic
1072662758 10:97372800-97372822 ATTCCCTCGGGGCCACAAGTTGG - Exonic
1073120854 10:101121920-101121942 ATTCGCCAGGGACCACCATCTGG - Intronic
1075522063 10:123148847-123148869 CTTCCCCAGGAAGCCCAAGCCGG - Intronic
1077274826 11:1699696-1699718 GTCCTCCAGGGACCACAAGGTGG + Intergenic
1077284960 11:1761541-1761563 ATTCCCCAGGGGCCTCCAGGTGG - Intronic
1077334730 11:1998199-1998221 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1078533238 11:12153149-12153171 GTTCCCCAAGTACCACAAGTGGG + Intronic
1079391067 11:20022750-20022772 ACTCCCCTGGGACCACATGGAGG + Intronic
1083769776 11:64860113-64860135 CTTGCCCAGGGACCACATGAGGG + Exonic
1083871026 11:65488605-65488627 AATCCACAGAGACCACCAGCTGG + Intergenic
1085589544 11:77746176-77746198 ACCCCCTTGGGACCACAAGCTGG + Intronic
1088920730 11:114258230-114258252 GTTCTCCAGGGACCTTAAGCGGG + Intronic
1090363226 11:126187399-126187421 ACTAACCAGGGACCACATGCTGG + Intergenic
1091102303 11:132886510-132886532 ATTACCCAGAGACCACATGCTGG - Intronic
1091120864 11:133056361-133056383 ATTCCCCAGAGACTCTAAGCAGG - Intronic
1202817713 11_KI270721v1_random:53381-53403 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG + Intronic
1097201903 12:57286231-57286253 ATTCCCCAGACCCAACAAGCTGG - Intronic
1097261289 12:57721650-57721672 ATTCCCCAGGTACTATAAACGGG + Intergenic
1100416415 12:94381542-94381564 ATTCCCCAAGGCACACAAGAGGG + Intronic
1101876499 12:108599715-108599737 CTCCCCCAGGGCCCACCAGCAGG + Intergenic
1103271147 12:119674811-119674833 ATTCTTCAGGCACCACAAGTGGG - Intronic
1104396407 12:128437451-128437473 ATGCCCCAGGGCTCACAAGATGG + Intronic
1113902386 13:113804297-113804319 ATTCCCCAGAAACCCCACGCTGG + Intronic
1117659388 14:57987915-57987937 AGTCCCCAGGGACTAATAGCAGG - Intergenic
1118141961 14:63093571-63093593 ATTCCCCAGGACACACTAGCAGG - Intronic
1120942733 14:89964291-89964313 ATTCCTCAGGGAGCACCTGCAGG + Intronic
1124403913 15:29377294-29377316 GTTTCCCAGGGACCACAAAATGG - Intronic
1124711356 15:32015111-32015133 ATTTCACAGGGACAACATGCAGG + Intergenic
1125734364 15:41913319-41913341 CTTCCCCAGGGACAACCACCAGG - Intronic
1126548466 15:49900033-49900055 ATTCCCCAGAGACCACAATATGG - Intronic
1127750410 15:62034957-62034979 TTGCTCCAGGGACAACAAGCAGG + Exonic
1128713993 15:69893708-69893730 AGTCCCCATGGAACCCAAGCAGG + Intergenic
1129329391 15:74819214-74819236 AACCTCCAGGGACCAAAAGCAGG - Exonic
1135404033 16:22185340-22185362 GTTCACCAGGGAACACATGCAGG + Intronic
1136471585 16:30484310-30484332 ATTCCCCTGGGACATCAGGCCGG + Intronic
1136515657 16:30766644-30766666 ATTCCCCAGGGACCCCTGGCTGG - Intronic
1137396964 16:48123025-48123047 CTTCCCCAGTGACCACAGCCAGG + Intronic
1139636565 16:68261718-68261740 ATACACCAGGGGCCACAAGAGGG + Intergenic
1141740271 16:85887066-85887088 CGTCCCCAGAGACCACAAGTTGG - Intergenic
1144929655 17:18848924-18848946 AGTCCACAGGGACTGCAAGCAGG + Intronic
1146608579 17:34284958-34284980 ATTCCCCAGGGAACACATTTAGG - Intergenic
1148342048 17:46878996-46879018 AGTCCCCAGGGGCCCCAAGAGGG - Intronic
1152633946 17:81422931-81422953 ATGCCCCAGTGTCCCCAAGCAGG + Intronic
1155403369 18:25462146-25462168 ACTCCACAGGGATCCCAAGCAGG + Intergenic
1156312678 18:35939282-35939304 ATTTCACAGGAACCACAAGCAGG + Intergenic
1159999645 18:75004486-75004508 ATTCCCGAGGAAGCACCAGCAGG - Intronic
1162200835 19:9018832-9018854 ATTCACCAGGGACCAAGCGCTGG + Intergenic
1162235142 19:9303182-9303204 ATTCCCCAGTGGACACCAGCTGG + Intronic
1162326573 19:10003136-10003158 TGTCCCCAGTGACCCCAAGCAGG + Intronic
1164735245 19:30536306-30536328 AGTCCCCAGGGACCACCTGGAGG - Intronic
925282536 2:2694825-2694847 ATTCCCCACTGACCACCCGCAGG - Intergenic
927477204 2:23423125-23423147 ACTTCCCAGGGACCACCTGCGGG - Intronic
927864505 2:26580085-26580107 TCTCCACATGGACCACAAGCAGG - Intergenic
928254856 2:29713357-29713379 AATCCCCAGGGACCATAGTCTGG + Intronic
928436908 2:31260711-31260733 CTTCCCCAAGGACCACATGAGGG - Exonic
929617972 2:43327352-43327374 ATATCCTAGGGACCACCAGCAGG + Intronic
935098757 2:99972101-99972123 ATCCACCAGGGACCAAAAGCAGG + Intronic
935524819 2:104152743-104152765 CTTCCTCAGAGACCACAAGTTGG - Intergenic
936117521 2:109713912-109713934 ATTCTCCAGGGGACACCAGCTGG + Intergenic
944136885 2:196409446-196409468 ATTCTCCAGGAACCAAAAGCTGG + Intronic
945256124 2:207804559-207804581 ATTCCCAAGGGATGACAACCTGG - Intergenic
947324107 2:228955901-228955923 CTGCCCCAGGGCCCACAAGGAGG - Intronic
947916790 2:233837855-233837877 CTCCCCCAGGGAGCACAAGCTGG + Intronic
1169305326 20:4484866-4484888 GCTCCCCAGGGACCATAGGCGGG - Intergenic
1170485363 20:16810298-16810320 CTTCCCCACTGACCACAGGCTGG - Intergenic
1173282643 20:41643167-41643189 ATTCCCCACTGAACTCAAGCAGG + Intergenic
1174035075 20:47663823-47663845 ACTCCCAAGGGGGCACAAGCTGG + Intronic
1174395287 20:50243302-50243324 AGTCCCCGCCGACCACAAGCGGG - Intergenic
1175384985 20:58589033-58589055 ATTCCCAAGGGCCCATAAACAGG - Intergenic
1175404815 20:58719078-58719100 ATTCGCCAGGGAACACAGTCTGG - Intronic
1175955518 20:62607044-62607066 ATTCCCCAGGGAGCGAGAGCTGG - Intergenic
1179627224 21:42655511-42655533 CTTCCCCAGGGCCCACCTGCAGG - Intronic
1182133279 22:27875314-27875336 ATTACCCAGGAACGACAAACTGG + Intronic
1185013462 22:48329883-48329905 CTTCATCAGGGATCACAAGCTGG + Intergenic
1185195654 22:49467750-49467772 ATGTCCCAGGGACAGCAAGCTGG - Intronic
950095721 3:10329154-10329176 ACTGCCCAGGGACCACAGCCAGG + Intronic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
954745964 3:52787753-52787775 CTCCCCCAGGGACCTCAGGCTGG - Intronic
955370529 3:58347393-58347415 AGTTCCCAGGGACCAGAAGGAGG - Intronic
957813064 3:85253920-85253942 ATTCTCCAGGGAACACCAGCTGG + Intronic
959657424 3:108824676-108824698 ATCACACAGGGACCATAAGCTGG + Intronic
960550261 3:118968326-118968348 ATTCCCTGGGGACCCAAAGCAGG - Intronic
962658437 3:137574020-137574042 ATTCTCCACAGACCACAACCAGG + Intergenic
968004011 3:195226959-195226981 CCTCTCCAGGGTCCACAAGCAGG + Intronic
968919408 4:3514978-3515000 GTTCACCCGGGACCACAAGATGG - Intronic
969470601 4:7385379-7385401 CTTCCTCAGGGACCACAGGATGG + Intronic
969595589 4:8147809-8147831 GGTCACCAGTGACCACAAGCTGG - Intronic
975905888 4:79211618-79211640 ATTCCCCACCCCCCACAAGCTGG + Intergenic
982194660 4:152898979-152899001 ATTGCCCAGTGTCCAAAAGCTGG + Intronic
985293156 4:188406838-188406860 AATCCCCAGGCTCCAGAAGCAGG + Intergenic
986139177 5:5013670-5013692 ATACCACAGGCACCAGAAGCTGG + Intergenic
987690797 5:21264103-21264125 ATGCCCCATGTACCATAAGCTGG + Intergenic
991341510 5:65615915-65615937 GTTCCCCACTGACCACAAACAGG + Intronic
1001088809 5:168721802-168721824 CTACCCCAGAGATCACAAGCTGG - Intronic
1001411543 5:171515753-171515775 AGTCCGCAAGGACCACAGGCTGG - Intergenic
1003271796 6:4613977-4613999 ATTAGCCAGAGACCAGAAGCTGG - Intergenic
1004755815 6:18608967-18608989 ATTGCCAAGGGAACTCAAGCAGG - Intergenic
1007833449 6:44656115-44656137 TTTCCCCTGTGACCAGAAGCTGG - Intergenic
1008124790 6:47656087-47656109 ATGCCCCACTGACCACAAGGAGG + Intergenic
1011373487 6:86665755-86665777 ATTCCTCAGGGACCTAGAGCTGG - Intergenic
1013353166 6:109324115-109324137 ATTCCCCTGGGACCACCACGAGG + Intergenic
1013375683 6:109511678-109511700 ATTGACCAGGGACCACCATCAGG + Intronic
1013989423 6:116236470-116236492 ATTCCCCACCCACCCCAAGCTGG + Intronic
1014473543 6:121845224-121845246 ATTCCCTATGGACAAAAAGCAGG - Intergenic
1015488555 6:133799824-133799846 AGTCCACAGGGACCAGGAGCTGG - Intergenic
1016729042 6:147407733-147407755 GTTCCCCAGAGCCCACAAGGAGG + Intergenic
1019682590 7:2359817-2359839 GTTCTCCAGGGGCCACCAGCTGG - Intronic
1026658599 7:72278759-72278781 ATTCCCCTTGTACAACAAGCCGG + Exonic
1029551278 7:101238305-101238327 ATTCACCAGGGAACTCAGGCGGG + Exonic
1032705050 7:134414294-134414316 ATTCCCCAGACACCACCAGAGGG - Intergenic
1033681750 7:143602137-143602159 ATTCATCAGGGACTTCAAGCCGG + Intergenic
1033703139 7:143859776-143859798 ATTCATCAGGGACTTCAAGCCGG - Intronic
1037693341 8:21202431-21202453 CTTGCCCAGGGACCACACACAGG - Intergenic
1037742186 8:21616620-21616642 ATGCCCCAGTGACCTCTAGCTGG - Intergenic
1038335150 8:26640138-26640160 ATTTCCCATGGACGAGAAGCAGG - Intronic
1047957279 8:129985406-129985428 ATTCCCCAGGCTCCATGAGCCGG + Intronic
1048418837 8:134256982-134257004 ACTCCCCAGAAACCAGAAGCAGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG + Exonic
1051841568 9:21403361-21403383 CTTCCCCAGGGACGACACACTGG + Intergenic
1059652939 9:116332733-116332755 ATTCCCCACAGACCCCAAGAAGG + Intronic
1186999103 X:15156875-15156897 ATTCCCCAGGTCTTACAAGCAGG - Intergenic
1188242990 X:27811167-27811189 CTTCCCCAGGGACCCCTATCAGG - Intronic
1189249642 X:39590461-39590483 TTTCCCCAGGAGCCACAGGCAGG - Intergenic
1192750690 X:73987462-73987484 ATTCCTCAGGTACCAGAAACAGG - Intergenic
1192923552 X:75733541-75733563 ATTCTTCAGGGACCAGAGGCTGG - Intergenic
1199252112 X:145675475-145675497 ATTCCCCAGAGACCACAATGTGG + Intergenic
1199984059 X:152937819-152937841 CTTCCCCAGGGAACCCAAGTTGG + Intronic
1200697856 Y:6376883-6376905 ACTACCCAGGGCCCACAATCAGG + Intergenic
1200759621 Y:7025973-7025995 ATGCCCAAGGGACCACAGACTGG - Intronic
1201036256 Y:9787816-9787838 ACTACCCAGGGCCCACAATCAGG - Intergenic