ID: 908673860

View in Genome Browser
Species Human (GRCh38)
Location 1:66578916-66578938
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19220
Summary {0: 1, 1: 1, 2: 22, 3: 862, 4: 18334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908673860 Original CRISPR TGTACTTTGGGGAGCAGAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr