ID: 908674779

View in Genome Browser
Species Human (GRCh38)
Location 1:66591554-66591576
Sequence CCCCCTTCACACTCTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908674779_908674793 16 Left 908674779 1:66591554-66591576 CCCCCATTAGAGTGTGAAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 908674793 1:66591593-66591615 TGTGGGTGTTTCTCGTCAGGTGG 0: 30
1: 355
2: 309
3: 222
4: 278
908674779_908674791 13 Left 908674779 1:66591554-66591576 CCCCCATTAGAGTGTGAAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 908674791 1:66591590-66591612 ACCTGTGGGTGTTTCTCGTCAGG 0: 34
1: 388
2: 350
3: 189
4: 166
908674779_908674794 17 Left 908674779 1:66591554-66591576 CCCCCATTAGAGTGTGAAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 908674794 1:66591594-66591616 GTGGGTGTTTCTCGTCAGGTGGG 0: 19
1: 175
2: 182
3: 175
4: 258
908674779_908674784 -2 Left 908674779 1:66591554-66591576 CCCCCATTAGAGTGTGAAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 908674784 1:66591575-66591597 GGCCAGCCCCTCCACACCTGTGG 0: 80
1: 333
2: 198
3: 348
4: 509
908674779_908674785 -1 Left 908674779 1:66591554-66591576 CCCCCATTAGAGTGTGAAGGGGG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 908674785 1:66591576-66591598 GCCAGCCCCTCCACACCTGTGGG 0: 81
1: 322
2: 191
3: 352
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908674779 Original CRISPR CCCCCTTCACACTCTAATGG GGG (reversed) Intronic
902583984 1:17426709-17426731 CCCCCTTCACACCCTATTAGAGG + Intronic
904453297 1:30630707-30630729 GCACCTTCACAGTCTCATGGTGG + Intergenic
908354077 1:63314795-63314817 ACACATTCTCACTCTAATGGGGG - Intergenic
908674779 1:66591554-66591576 CCCCCTTCACACTCTAATGGGGG - Intronic
908823166 1:68108524-68108546 CCCCCTTCCCACTCCACTGTGGG + Intronic
911096951 1:94062531-94062553 CCTCCATGACACGCTAATGGGGG - Intronic
912566134 1:110588914-110588936 CCCCCTTTACTCTCTGAGGGAGG + Intergenic
913225244 1:116693349-116693371 CCCCCTTCACCCTCTGAGGTGGG + Intergenic
915010084 1:152677267-152677289 CCCCCCTCACATTCTGAGGGTGG - Intergenic
919897406 1:202017983-202018005 GCCCCTTCACCCTCTTCTGGAGG + Intergenic
921480393 1:215658303-215658325 CCCCCATCCGACTCTCATGGAGG + Intronic
922481576 1:225943068-225943090 CCCCCTTCACCTTCTAAATGGGG + Intergenic
922481593 1:225943146-225943168 CCCCCTTCACCTTCTAAATGGGG + Intergenic
923010519 1:230084256-230084278 CCCACTTCACACTCTGATATTGG - Intronic
1066053375 10:31658546-31658568 TCAGCTCCACACTCTAATGGTGG - Intergenic
1070101988 10:73397190-73397212 CCACCTTCACAGTCTTATGGAGG - Exonic
1072581740 10:96745739-96745761 TCCCCTTCACACTCTCCAGGTGG + Intergenic
1074683066 10:115930101-115930123 CCCAATTCACACTTTAATGCCGG + Intronic
1075817660 10:125277815-125277837 CCCCCTTGACAATCAAATGAAGG - Intergenic
1081993515 11:47349971-47349993 CCCCCTTCCCACCCCAATGCTGG + Intronic
1088712679 11:112522860-112522882 CCACCTTCTCACTCTTAAGGAGG + Intergenic
1091670663 12:2449928-2449950 CCCCATTCTCACTCTACAGGGGG + Intronic
1100664176 12:96732803-96732825 CTCCCTTCAAACTCCAATGGAGG - Intronic
1101597175 12:106177814-106177836 GCCTCTTCCCACCCTAATGGCGG - Intergenic
1103799942 12:123531708-123531730 ACCTCATCACATTCTAATGGGGG + Intronic
1106022910 13:25931720-25931742 GCCACTTCACACTCTGATGAAGG - Intronic
1112436914 13:99397039-99397061 CCACCTTCCCCCTCTTATGGAGG - Intergenic
1113004875 13:105688977-105688999 CCTCCTTCACACTGAAATGCTGG + Intergenic
1118082845 14:62381809-62381831 AGCCCTTCACACACAAATGGGGG - Intergenic
1118247549 14:64125968-64125990 CACCCTCCACATTCTAATGTAGG - Intronic
1122204440 14:100141576-100141598 CCCCCTTCCCACGCTGAGGGGGG - Intronic
1123803332 15:23845060-23845082 CCCCTTTCAACTTCTAATGGAGG + Intergenic
1129159109 15:73737368-73737390 CCCCCTTCTCACTCTCAGGGTGG + Exonic
1133027603 16:2995488-2995510 CTCCCTTCCCAGTCTCATGGGGG + Intergenic
1138185503 16:54973912-54973934 TCCCCTTCACACTATCATGATGG + Intergenic
1139943880 16:70625315-70625337 CCCCCTTCCCACTTTTCTGGAGG - Intronic
1140230358 16:73112754-73112776 CCCCTTTCTCAGTCTACTGGGGG - Intergenic
1140673394 16:77301633-77301655 CACCCACCAAACTCTAATGGAGG - Intronic
1143523901 17:7461828-7461850 GCCCCTTCACACTCTTGTGCAGG - Exonic
1146570068 17:33944818-33944840 CCTCCATCACACTCTTCTGGAGG - Intronic
1148541540 17:48484379-48484401 CCTCCTTCAAAATCTGATGGGGG + Intergenic
1157311746 18:46557963-46557985 CCCTCTTCACACCTAAATGGTGG - Exonic
1167749826 19:51372806-51372828 CCCCCATCACACACTAAGCGGGG - Intergenic
1168295453 19:55375416-55375438 GCCCCTTCTCCCTCTAATGCAGG + Intergenic
925555427 2:5125987-5126009 CCCCCTTCTCTCTCCAAGGGTGG - Intergenic
926315934 2:11709505-11709527 ACCCATTCACAGTCCAATGGAGG - Intronic
926407609 2:12570936-12570958 CCCCCTTCCCACTTTTCTGGAGG + Intergenic
927321241 2:21748238-21748260 CCCCCTTCACTCTCAAAGTGTGG + Intergenic
929492715 2:42410032-42410054 CCCCCTTCCCACACAAAAGGTGG + Intronic
929635323 2:43513609-43513631 CCCCCTTCACAGTGAAATTGGGG - Intronic
937573242 2:123389860-123389882 CCCTCATCACACTCTCATTGAGG - Intergenic
1170589587 20:17761777-17761799 TCCCATTCACATTCTAGTGGTGG + Intergenic
1174515837 20:51091870-51091892 CCCCCTTCACACTGAGAGGGAGG - Intergenic
1175280423 20:57800639-57800661 CCCACTTCCAACTCTAAGGGTGG - Intergenic
1177850923 21:26347769-26347791 CCACCTTCACAGTCTAGTGAAGG + Intergenic
1183165186 22:36142362-36142384 CCCTCTCCACACACTATTGGAGG - Intronic
958041423 3:88230844-88230866 CCCCCTTCTCAGTCTACAGGGGG + Intergenic
961674066 3:128554495-128554517 ACCCCATCACGCCCTAATGGGGG - Intergenic
962070628 3:132030085-132030107 TCCTCCTAACACTCTAATGGAGG + Intronic
962413217 3:135159730-135159752 GCCCATTCTCACTCTAATGAAGG - Intronic
965492037 3:169349397-169349419 GCCACTTCACGCTCTAGTGGGGG + Intronic
967244332 3:187470818-187470840 CCCCTTTCCCACTTTACTGGAGG - Intergenic
968144225 3:196285041-196285063 CCCCCTACACTCTGTAATAGGGG - Intronic
971462900 4:26921475-26921497 GCCGCTTCACACTATAGTGGCGG - Intronic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
978001282 4:103558299-103558321 CCCCCTTCCCACTTTTCTGGAGG - Intergenic
985582184 5:703951-703973 CCCCCTTCCCACTTTTCTGGAGG + Intergenic
985856624 5:2433105-2433127 CACCCTTCACATTGTAAGGGGGG + Intergenic
993858830 5:93109148-93109170 ACCCCTCCACACACTGATGGGGG - Intergenic
995410534 5:111852379-111852401 TCCCCTTCACACTCTGACGAGGG + Intronic
997990892 5:138543504-138543526 CCCCCGTCAGGCTCGAATGGGGG + Intergenic
1003386915 6:5677396-5677418 GCCCCTTCACACTGTAATATTGG + Intronic
1003477650 6:6498770-6498792 CCCCCTTACCACTCCAATGCAGG + Intergenic
1007589504 6:43012982-43013004 TCATCTTCACTCTCTAATGGTGG + Exonic
1008607205 6:53151877-53151899 CTGCCTTCACACTCTGATAGAGG + Intergenic
1014391512 6:120871720-120871742 CCTCCTTCCCACTCTACTTGGGG - Intergenic
1015097418 6:129432237-129432259 CACCATTCACACTCTAAAGGAGG - Intronic
1017409403 6:154152485-154152507 GCCCCCTCACACTGTCATGGGGG + Intronic
1017827662 6:158094076-158094098 CCCCCCTCACACTCTCTAGGGGG - Intronic
1018421504 6:163644218-163644240 CCCCCCTCACACTCCAAGGGAGG + Intergenic
1020372928 7:7454039-7454061 CCTCCTTCACAATATAAAGGAGG + Intronic
1020842547 7:13237803-13237825 CTCCCCTCACATTCTAATGAAGG + Intergenic
1023600398 7:41876543-41876565 CCCCCCTCACCCTGTAATGAAGG + Intergenic
1029508554 7:100978235-100978257 ACCCCTGCACACACCAATGGCGG - Intronic
1031020758 7:116625316-116625338 CACCCTTCACACTATCATGGAGG + Intergenic
1033172165 7:139093854-139093876 CCCCCTTCAAGCTCTGATCGTGG - Intronic
1033252945 7:139777010-139777032 CCCCTTCCACACGCTAATGAGGG + Intronic
1034105467 7:148486198-148486220 CCCCATCCACACACTAAAGGAGG + Intergenic
1037330415 8:17738458-17738480 CCGCCTTCACTCTCTTTTGGAGG - Intronic
1038389643 8:27183468-27183490 CCCCCTTCACACTCCTACAGTGG + Intergenic
1043983170 8:86663995-86664017 CCCCCTTGTGAGTCTAATGGAGG + Intronic
1044921817 8:97176255-97176277 CCCCCTTCCCACTTTTCTGGAGG + Intergenic
1046116279 8:109787936-109787958 CCCCCTTCTTACTGTCATGGTGG + Intergenic
1047598487 8:126403120-126403142 CCACCTACGCACTCTGATGGTGG - Intergenic
1048061739 8:130925929-130925951 TCCCCTTGACACTGGAATGGAGG - Intronic
1050706907 9:8410531-8410553 AATCCTTCACACTCTAATGTTGG - Intronic
1051843069 9:21420241-21420263 CTGCCTTCACTCTCTAGTGGTGG + Intronic
1054740790 9:68804039-68804061 ACCCCTCCACACGCTCATGGAGG - Intronic
1061889817 9:133612702-133612724 TCCCCTGCACACTCGAATGGAGG + Intergenic
1062053332 9:134458331-134458353 CCCCCTTCCCACTCTGCAGGTGG + Intergenic
1062683963 9:137800425-137800447 CCTCCTTCAGCCTCCAATGGTGG - Intronic
1186515236 X:10161796-10161818 GCCCCTTTACACCCTCATGGTGG - Intronic
1200287367 X:154836379-154836401 AACCCTTCACAATCTTATGGGGG + Exonic
1201455050 Y:14160421-14160443 CCCCCTTCAAGCTGTAGTGGGGG + Intergenic
1202277616 Y:23140882-23140904 CCCCCTTCACACCCAAAGTGTGG - Intronic
1202288412 Y:23279806-23279828 CCCCCTTCACACCCAAAGTGTGG + Intronic
1202430606 Y:24774606-24774628 CCCCCTTCACACCCAAAGTGTGG - Intronic
1202440186 Y:24895481-24895503 CCCCCTTCACACCCAAAGTGTGG + Intronic