ID: 908679428

View in Genome Browser
Species Human (GRCh38)
Location 1:66643233-66643255
Sequence ACTCATCTACAGAGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 278}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908679428_908679430 26 Left 908679428 1:66643233-66643255 CCTTCCTCTCTCTGTAGATGAGT 0: 1
1: 0
2: 3
3: 41
4: 278
Right 908679430 1:66643282-66643304 GCTGAGTATGACACAACAAATGG 0: 1
1: 1
2: 1
3: 16
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908679428 Original CRISPR ACTCATCTACAGAGAGAGGA AGG (reversed) Intronic
901342537 1:8508271-8508293 AGTCAAAAACAGAGAGAGGAAGG + Intronic
901417195 1:9125493-9125515 CCCCCTTTACAGAGAGAGGAGGG - Intronic
901437654 1:9257836-9257858 CCTCACCTACAGAGAGAGCCTGG - Intronic
901826909 1:11868018-11868040 AGTCATCTTCAGAAAGAGAAAGG - Intergenic
902242930 1:15100787-15100809 TCCCATCTGCAGAGCGAGGACGG + Intronic
902774717 1:18667331-18667353 CCGCATCTTCAGAGAGTGGAAGG + Intronic
906517073 1:46445898-46445920 ACTCAGGTCCAGAGAGATGAAGG - Intergenic
906555937 1:46713766-46713788 AATTAACTACAGAGAGATGACGG + Intronic
906922898 1:50083520-50083542 GCTCATCCAGTGAGAGAGGAAGG - Intronic
907116034 1:51969342-51969364 CCTCATAGACAGAGAAAGGAGGG - Intronic
907275342 1:53313877-53313899 ACTCAGCTGCAGAGCGAAGATGG + Intronic
908517209 1:64905225-64905247 CCTCATCTCCAGTGCGAGGACGG + Intronic
908679428 1:66643233-66643255 ACTCATCTACAGAGAGAGGAAGG - Intronic
909067150 1:70948858-70948880 ACTCATCCACAGAGAGAGTAGGG - Intronic
909118857 1:71575117-71575139 GCTGATCTACAGAGAGAGGAAGG + Intronic
910971146 1:92857167-92857189 ATTCCTCTAAAGAGGGAGGAAGG + Intronic
912073499 1:105842816-105842838 ACTCATCCACGGAGAGGGGATGG - Intergenic
912100238 1:106194539-106194561 AGTCATCTAGAGAGAAAGGCAGG + Intergenic
913462931 1:119107617-119107639 ATTCATCTAGAGAGAGAGAGAGG - Intronic
913692888 1:121296253-121296275 ACACATGCACAGAGAGGGGATGG + Intronic
915613904 1:157019807-157019829 ACTGATCTACTGTGAGAGAAAGG + Intronic
918821835 1:189266541-189266563 ATTCTTCTGCAGAGAGAGAATGG - Intergenic
919535988 1:198788583-198788605 CCTCAGCTACAGAGAGAGGTAGG - Intergenic
920202479 1:204268081-204268103 ACTCATTCACAGAGACAGCAGGG + Intronic
921214273 1:212923989-212924011 ACCCAACTTCAGAGAGGGGAGGG + Intergenic
921262591 1:213396966-213396988 AAGCCTCTACAAAGAGAGGAAGG - Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
922892248 1:229071142-229071164 ACTGATCCACACAGAGAGGGAGG - Intergenic
1064821689 10:19342829-19342851 ACACTGCCACAGAGAGAGGAGGG - Intronic
1068148032 10:53096699-53096721 ACTCATTAACAGAAAGAGGTTGG + Intergenic
1068753086 10:60619030-60619052 ACTAACCTAAAGAAAGAGGATGG - Intronic
1069832386 10:71289236-71289258 ACTGAGTCACAGAGAGAGGAAGG + Intronic
1072308543 10:94131851-94131873 GCTCTTCTGCAGAGAGATGAAGG - Intronic
1073167181 10:101466142-101466164 ACTCAATTACAGAGAAAGGCAGG - Intronic
1073857655 10:107696142-107696164 CCTTATTTACAGAGAGAAGAGGG + Intergenic
1073896341 10:108164141-108164163 ATTCATCTTCAGAGACGGGAAGG + Intergenic
1075406737 10:122200378-122200400 CCACATCTACAGTGAGAGGACGG + Intronic
1075406755 10:122200468-122200490 CCACATCTACAGTGAGAGGACGG + Intronic
1075406784 10:122200603-122200625 CCACATCTACAGTGAGAGGACGG + Intronic
1075406793 10:122200648-122200670 CCACATTTACAGTGAGAGGATGG + Intronic
1075406836 10:122200828-122200850 CCACATCTACACTGAGAGGATGG + Intronic
1075406860 10:122200963-122200985 CCACATCTACAGTGAGAGGACGG + Intronic
1075406870 10:122201008-122201030 CCACATCTACAGTGAGAGGACGG + Intronic
1075406880 10:122201053-122201075 CCACATCTACAGTGAGAGGACGG + Intronic
1075406889 10:122201098-122201120 CCACATCTACAGTGAGAGGACGG + Intronic
1075406898 10:122201143-122201165 CCACATCTACAGTCAGAGGACGG + Intronic
1075406907 10:122201188-122201210 CCACATCTACAGTGAGAGGATGG + Intronic
1075406917 10:122201233-122201255 CCACATCTACAGTGAGAGGACGG + Intronic
1081049956 11:38326413-38326435 ACTACTCTACAGAGATAGAAGGG - Intergenic
1083297680 11:61723984-61724006 ACTGAGGTACAGAGAGATGATGG + Intronic
1083769314 11:64857553-64857575 CCTCATCTACAGGGTGAGGTGGG + Intronic
1085091415 11:73718151-73718173 CTTCCTCTACAGAGAGAGAATGG + Intronic
1085699105 11:78730436-78730458 GCTCATCCACAGAGAGAGGTTGG + Intronic
1085708036 11:78804338-78804360 ACTCTTCTAATCAGAGAGGATGG - Intronic
1086640685 11:89151775-89151797 ACTCAACTACAAAGGGATGAGGG + Intergenic
1086961477 11:92983244-92983266 AGTCATATACAAAGAAAGGAAGG + Intronic
1087961025 11:104349407-104349429 TTTCATGTACAGAGAGGGGAGGG + Intergenic
1088779827 11:113123558-113123580 GCACATCTCCAGAGAGAGGATGG - Intronic
1089022079 11:115226649-115226671 ACTTGTCTGCAGAGAGAGGACGG + Intronic
1089623167 11:119734432-119734454 AGTTATCTGCAGAGAGAGGTTGG + Intergenic
1090423943 11:126594172-126594194 ACTCATCTACCTGGAGAAGAAGG + Intronic
1090480030 11:127059856-127059878 ACTCAGCTAGGGACAGAGGAAGG + Intergenic
1090662059 11:128889968-128889990 CCCCCTCTACAGAGAGAAGAGGG + Intergenic
1091141733 11:133241050-133241072 ATTCATCGAGAGAAAGAGGAAGG - Intronic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1092830485 12:12439809-12439831 ACTCACCAACAGAGATAAGACGG - Intronic
1095177298 12:39107813-39107835 ACTAATCCATAGAGAGAGGTGGG + Intergenic
1095878737 12:47109265-47109287 CTCCATTTACAGAGAGAGGAAGG - Intronic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1096790245 12:54039877-54039899 GCCCGTCTACACAGAGAGGAAGG - Intronic
1100884351 12:99053261-99053283 ACTCAGCTACAGAGGTGGGATGG + Exonic
1101799073 12:108004782-108004804 ACACATCTACAGAGAGGGAGAGG + Intergenic
1101801892 12:108029564-108029586 ACTCATTTACAGAGACAGCAGGG + Intergenic
1102162946 12:110784055-110784077 ACCTATCTGCAGAGAGAAGAGGG - Intergenic
1105801863 13:23911936-23911958 CCTAATATACAGAGAGAGGTGGG - Intergenic
1106369033 13:29113438-29113460 GCTGATCTAAAGAGACAGGAGGG - Intronic
1106510779 13:30410602-30410624 ACTCAAAGAAAGAGAGAGGAAGG + Intergenic
1109598426 13:64589978-64590000 ACCCATCTACAGAGAAGGTATGG - Intergenic
1110659055 13:78037107-78037129 AGTCCTCTAGAGAGAGAGGGAGG + Intergenic
1110990323 13:82034598-82034620 AATCATCAACAGACAGAGAAGGG + Intergenic
1112188340 13:97149865-97149887 ACTCCCCTGCAGAGAGAGGAGGG - Intergenic
1113574608 13:111385734-111385756 GCTCCTCAACAGAGGGAGGAGGG + Intergenic
1114149791 14:20025156-20025178 ATGTATCTAGAGAGAGAGGAGGG - Intergenic
1114523490 14:23352964-23352986 ACTCTTCGTCAGAGAGAGGAAGG + Intergenic
1114956375 14:27825084-27825106 AATCATTTACATAGAGATGATGG - Intergenic
1115227051 14:31114318-31114340 AATCATGTACAGAGAAATGAAGG - Exonic
1115469232 14:33750953-33750975 GCTCACCTACAGAGATATGAAGG + Intronic
1117828583 14:59727719-59727741 ACAGATGGACAGAGAGAGGAGGG + Intronic
1117995790 14:61477051-61477073 AGTCATCTACAGGGTGAGCAGGG - Intronic
1118032310 14:61830640-61830662 TCTCAACTAGAGAGTGAGGAAGG - Intergenic
1118787142 14:69055260-69055282 ACTCATCTACTGTGGGAGGCGGG + Exonic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1120086850 14:80285412-80285434 ACTCATGGACAGAGAGGAGAAGG + Intronic
1121321759 14:92995651-92995673 ACTTATGTGCAGGGAGAGGATGG - Intronic
1122383976 14:101331427-101331449 AGTCCTCTACAGGGTGAGGACGG - Intergenic
1124008115 15:25810801-25810823 ACTCATTTTCAGAGCCAGGAAGG + Intronic
1126274636 15:46862507-46862529 ACTGATCAACAGGGAGAGGTTGG + Intergenic
1127435686 15:58955930-58955952 ACTGATCTACAGAGAGACATTGG - Intronic
1128546913 15:68574469-68574491 GCTACTCTACAGAGTGAGGAGGG - Intergenic
1128727074 15:69996119-69996141 ATTCACCTACAGAAAGAGCAGGG - Intergenic
1131146707 15:90018672-90018694 ACTCAGCTACAGTGACTGGAAGG + Intronic
1132152252 15:99470752-99470774 ACCCACCTACATACAGAGGAGGG + Intergenic
1133006114 16:2882733-2882755 GCTGAACTACAGAGAGAGGGCGG + Intergenic
1133410829 16:5567413-5567435 ACTCATCTACCCAGAGAGATTGG - Intergenic
1133577671 16:7109522-7109544 ACTCACCTAAAAAGAGAGGGAGG + Intronic
1133837505 16:9379856-9379878 ACTAAACCACAGAGAGAGGGAGG + Intergenic
1134046471 16:11104608-11104630 ACTTCTCTCCAGAGGGAGGAAGG + Intronic
1134205451 16:12233796-12233818 GCACATCCACAGAGACAGGAAGG - Intronic
1136174551 16:28507923-28507945 TCCCATCTTCAGGGAGAGGATGG + Intronic
1136932934 16:34435366-34435388 ACACATCCCCAGAGAGAGGAGGG - Intergenic
1136971638 16:34976448-34976470 ACACATCCCCAGAGAGAGGAGGG + Intergenic
1137672415 16:50286757-50286779 ACTGAAATTCAGAGAGAGGATGG + Intronic
1137997619 16:53236269-53236291 AGTCATATACAGAGAGTGAAGGG - Intronic
1138756205 16:59488815-59488837 AGTTATCTAAAGAGAGAGGGGGG + Intergenic
1139939215 16:70592372-70592394 TCTCATGGGCAGAGAGAGGAGGG - Intronic
1141082375 16:81063450-81063472 ACTCATCCACAAAGCGAGGCTGG + Intronic
1141789139 16:86221658-86221680 ACTCATCTACGGTGAGTCGACGG - Intergenic
1142682490 17:1558528-1558550 CCTCATCTACAGACACAGGCAGG + Exonic
1143282410 17:5764755-5764777 ACTAATGTACTGAGAGAAGAGGG - Intergenic
1146295621 17:31647842-31647864 ACTCCTCCATAGAGAGATGAGGG - Intergenic
1146902461 17:36597620-36597642 ACTCATCTCAAGGGAGGGGATGG + Intronic
1147219699 17:38921072-38921094 ACACACCCCCAGAGAGAGGAGGG + Exonic
1147551746 17:41448023-41448045 TCTCATCTGCAATGAGAGGAGGG + Intergenic
1149085227 17:52708860-52708882 ACCCATCTAAAGAGAAAGAAGGG - Intergenic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1152331084 17:79673409-79673431 ACTGTTCTACAGAGAGAAGTTGG + Intergenic
1152384833 17:79966184-79966206 ACCCATATACAGAGGGAAGAAGG - Intronic
1153822350 18:8843048-8843070 ACTCAACTCCAGAGAGGGCAAGG - Intergenic
1155403045 18:25459587-25459609 ACCCATCTACAAAGTGAGGCGGG + Intergenic
1155550527 18:26960186-26960208 AGTCTTCTGCAGAGAGATGATGG + Intronic
1156830978 18:41490823-41490845 AGTCATCAACGGAGAAAGGAGGG - Intergenic
1158569281 18:58583298-58583320 CCTAAACTACAAAGAGAGGAGGG + Intronic
1160961471 19:1723581-1723603 GCCCATCCACAGAGACAGGAGGG + Intergenic
1161041387 19:2112461-2112483 ACTGATCCACAGAGACAGGAAGG + Intronic
1161160477 19:2758931-2758953 GCCCATCCACAGAGACAGGAAGG + Intronic
1161167001 19:2793353-2793375 GCCCATCCACAGAGACAGGAGGG - Intronic
1161306334 19:3570934-3570956 GCCCATCCACAGAGACAGGAGGG - Intronic
1161509833 19:4664125-4664147 GCCCATCCACAGAGACAGGAGGG + Intronic
1161534113 19:4808336-4808358 GCTCATCCACAGAAACAGGAAGG + Intergenic
1162340666 19:10089807-10089829 ACTCGTCTGTAGGGAGAGGAGGG + Intronic
1165026488 19:32966359-32966381 ACCCATCTCCAGAGAGACCAAGG - Exonic
1165883388 19:39059355-39059377 ACTCATGGACATAGAGAGGCTGG - Intergenic
1166050041 19:40253511-40253533 ACTCATCCACAGAGAAAGAAAGG + Intronic
1167017004 19:46847637-46847659 ACACATCCACAGAGACAGAAAGG - Intronic
1167124803 19:47542179-47542201 ACACATCCACAGAGACAGAAAGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168363618 19:55765114-55765136 ACTCATCCACATATAGAAGAAGG - Intergenic
1168379805 19:55910492-55910514 ACTCATCAAAAGAGAGAAGTTGG + Intronic
924977051 2:187317-187339 CCTCATCTAAAGACTGAGGAAGG - Intergenic
925360358 2:3276304-3276326 ATTCATCTCCAGACAGAGAACGG + Intronic
925550205 2:5065535-5065557 AGTGATCTACACAGGGAGGAGGG - Intergenic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
925882410 2:8363806-8363828 CCTCATCAGCAGAGACAGGAAGG - Intergenic
926071629 2:9898603-9898625 AATGACTTACAGAGAGAGGAAGG - Intronic
926500672 2:13649168-13649190 ACTCATCCACAAAGAGAGGATGG + Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927916471 2:26939829-26939851 ACTCATCTACAGAATGAGTGTGG - Intronic
929393788 2:41499326-41499348 ACTCCTCTACAGAGACTGAATGG + Intergenic
929696912 2:44125323-44125345 ACTGATCCCCAGAGAGATGAGGG + Intergenic
931177377 2:59867704-59867726 ACTCATCATGAGAGAGAGGAAGG - Intergenic
932264596 2:70356653-70356675 ACCAATCTACAGAGAGAAGCAGG + Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
934480902 2:94642903-94642925 ACTCATTTACATAGAGATGATGG + Intergenic
935875843 2:107506181-107506203 ACTCCCCCTCAGAGAGAGGAGGG - Intergenic
936109778 2:109655474-109655496 ACTCATGCACAGGAAGAGGATGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
939605143 2:144245873-144245895 ACTAATCTACTGGGAGAGGGAGG - Intronic
940968836 2:159871786-159871808 ACATATATACACAGAGAGGAAGG - Intronic
941348571 2:164402481-164402503 ACTCATGGACAGAGAGTAGAAGG + Intergenic
941885831 2:170526178-170526200 ACTGAGGTTCAGAGAGAGGAAGG - Intronic
941975030 2:171394372-171394394 ACTCATCTATATATAGAAGAGGG + Intronic
946063414 2:216965746-216965768 AATCAGAGACAGAGAGAGGAAGG + Intergenic
946425359 2:219592276-219592298 ACACATGGCCAGAGAGAGGAGGG - Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948697500 2:239739796-239739818 ACTCCTCCACAGACAGAGGAAGG + Intergenic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1169867657 20:10218385-10218407 AGTCATCTAAGGAGAGGGGAAGG - Intergenic
1170838834 20:19907487-19907509 ACTTATCACCAGAGCGAGGAAGG + Intronic
1172101411 20:32485754-32485776 TCTCATTTTCAGAGTGAGGATGG - Intronic
1172822184 20:37746673-37746695 ACACATCTACAAAGAGAGACAGG - Intronic
1172840494 20:37900314-37900336 ACTCAGCTAGACAGAGGGGAAGG + Intergenic
1175087822 20:56475314-56475336 AGTCATTTACAGTGAGATGAAGG - Intronic
1175374568 20:58515331-58515353 CCTCATTTACAGACAGAGGCCGG - Intergenic
1179169188 21:38959544-38959566 ACTCTTCTTCAGAGGGAGCAGGG + Intergenic
1179428833 21:41304552-41304574 ACTCATCCCCAGACAGGGGATGG + Intronic
1179798408 21:43798969-43798991 CCTCAGCTACTGAGAGAGAAGGG - Intronic
1180191431 21:46165983-46166005 ACTCTTCTAGATAAAGAGGAGGG + Intronic
1183069678 22:35387333-35387355 ACTGAGGTACAGAGAGATGAAGG - Intronic
950934677 3:16826278-16826300 TCCCATCTAAAGAGAGTGGATGG - Intronic
952810342 3:37396895-37396917 ATTCAACTACAGAAACAGGAGGG - Intronic
953274633 3:41482763-41482785 ACTTGTCTGCAGAGAGAGGAAGG - Intronic
954756842 3:52845333-52845355 ACTCATGGACAGAGAAGGGAGGG - Intronic
955216956 3:56992013-56992035 ACACACACACAGAGAGAGGAGGG - Intronic
955496150 3:59534837-59534859 TATCATCTACCGAGACAGGAAGG + Intergenic
955522026 3:59784319-59784341 ACTCACCTTCAGTGAGAGAATGG - Intronic
956119757 3:65954580-65954602 AGTTATCTACAGAGAGAAGGAGG + Intronic
956611722 3:71130551-71130573 ACCCATCTACAGCAAGAAGACGG - Exonic
956703029 3:71975591-71975613 TCTCATCTATACAGTGAGGAAGG + Intergenic
956718540 3:72098983-72099005 CCTCAACTACAGAGACAGCATGG - Intergenic
956971332 3:74530428-74530450 ACTCTTCCTCACAGAGAGGAAGG + Intergenic
957483917 3:80833040-80833062 ACTAAACTACAAAGAGAGGAGGG - Intergenic
957521708 3:81326890-81326912 ACTCATGAACATAGAGAGTAGGG + Intergenic
959932986 3:112002910-112002932 ACTCCTCTAAAGAAAGAGGGAGG + Intronic
960166170 3:114404174-114404196 ACTGATATACAAAGAAAGGAAGG - Intronic
960605997 3:119505856-119505878 ACACATATACACAGAGAAGAGGG - Intronic
961804732 3:129481370-129481392 ACTCATCAAAAGAAAGAGGGGGG - Intronic
962074662 3:132068870-132068892 TGTCCTCTACAGAGAGAAGATGG + Intronic
962963542 3:140333215-140333237 ATTAATCTGCAGAGAGATGAAGG - Intronic
965328855 3:167344166-167344188 GCTAATCTAGAGAGAGAGAAAGG + Intronic
965463153 3:168993749-168993771 ACTCAGCTACAGATACAGCATGG - Intergenic
969891636 4:10265192-10265214 ACACATCTGCAGAAAGAGCAAGG - Intergenic
972039501 4:34574604-34574626 CCTCAGCTCCAGAGAAAGGAAGG - Intergenic
974084425 4:57244332-57244354 CCTCATCTACAGAAAGAGAAGGG - Intergenic
975645416 4:76541492-76541514 ACTCAGCTTCAAAGAGGGGATGG - Intronic
975808194 4:78135453-78135475 ACTGATCTGCAGAGAAAGCATGG + Intronic
975831926 4:78378257-78378279 ACTCATCTACAGAAAGAAAAAGG - Intronic
976862212 4:89678997-89679019 ACTCATATACTGAGAGATAAAGG - Intergenic
978221398 4:106279633-106279655 ACTCATGGAGATAGAGAGGATGG - Intronic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
979172857 4:117623705-117623727 ACCAATGTACAGAGAGAGTAGGG - Intergenic
980626121 4:135376860-135376882 ATTCAAATAGAGAGAGAGGAAGG - Intergenic
982253432 4:153430158-153430180 ACTGATCTAAAAAGAGAGGGTGG - Intergenic
984243103 4:177241543-177241565 ATTCATCTAGAGAGAGAGGCGGG - Intergenic
986477758 5:8153127-8153149 ATTCATCTACAAAGAGTGCATGG - Intergenic
986617341 5:9631866-9631888 ACACAACTACAGTGAGATGAAGG + Intronic
986970423 5:13328591-13328613 ACCCTTCTACAGATAGGGGAAGG + Intergenic
995714890 5:115072661-115072683 ACTCCCATACAGAGGGAGGAGGG + Intergenic
995800631 5:115989972-115989994 ACTCACCTCCTCAGAGAGGAGGG - Intronic
995848267 5:116517834-116517856 CATTTTCTACAGAGAGAGGAAGG - Intronic
996147511 5:119993862-119993884 GCTGATCTGCAGAGAAAGGAGGG - Intergenic
996491384 5:124101840-124101862 AATCATTTAAAGAGAAAGGAAGG - Intergenic
996708774 5:126523403-126523425 TCTGATGCACAGAGAGAGGATGG - Intergenic
997634056 5:135391514-135391536 ACTCAGCTAGAGTCAGAGGAGGG - Intronic
997912923 5:137894091-137894113 ACTCATATAAGGAGAGAAGAAGG + Intronic
998114403 5:139525145-139525167 ACACATCTTCAGAGAGGGGGTGG + Intergenic
998301011 5:141020340-141020362 ACTCATCTCCAGTGAGAGTCAGG + Intergenic
999038903 5:148384940-148384962 TCTCAAGTTCAGAGAGAGGAAGG - Intronic
999242232 5:150134565-150134587 ACTCAGGCGCAGAGAGAGGATGG - Intronic
999501655 5:152152552-152152574 ACTGAAACACAGAGAGAGGAAGG - Intergenic
1001503154 5:172254959-172254981 ACTCATGTACATAAAGGGGATGG + Intronic
1001589759 5:172857335-172857357 ACTCCTCTACTGAGGAAGGATGG - Intronic
1001843799 5:174903362-174903384 ACTCATTTTCAGAGACAGGCTGG - Intergenic
1002795712 6:469706-469728 ACACAGAGACAGAGAGAGGAGGG - Intergenic
1003520493 6:6854545-6854567 AGTGGTCTGCAGAGAGAGGAAGG - Intergenic
1006255667 6:32830207-32830229 GAGCATGTACAGAGAGAGGATGG - Intronic
1008860147 6:56139127-56139149 GCACTTCAACAGAGAGAGGAAGG + Intronic
1008974890 6:57413631-57413653 ACTCATTTACATAGAAAGGAGGG + Intronic
1009163775 6:60315137-60315159 ACTCATTTACATAGAAAGGAGGG + Intergenic
1009242038 6:61195722-61195744 ATTCCTCTGCAGAGAGAGAATGG - Intergenic
1009705512 6:67245356-67245378 ACTAATCTACAGAGACAGTTTGG - Intergenic
1009873457 6:69475884-69475906 AATAATCTAGAGAGAGATGATGG - Intergenic
1009913459 6:69962814-69962836 CCTCTTCTACAGGGAGAGCAAGG + Exonic
1010048764 6:71478834-71478856 ACTGATGTACAAAGTGAGGAAGG + Intergenic
1010060962 6:71622242-71622264 AAGCATCTACAGAGACAGAAAGG - Intergenic
1011731268 6:90266341-90266363 GACCAACTACAGAGAGAGGAAGG + Intronic
1014809369 6:125868809-125868831 ACTCTACTAAAGAGGGAGGATGG - Intronic
1015701220 6:136037946-136037968 ACTCAGTGCCAGAGAGAGGAGGG + Intronic
1016860772 6:148716601-148716623 ACTCATATAGAGAGGGAGCAGGG - Intergenic
1018588123 6:165385501-165385523 ACTCACCGTCAGAGTGAGGAAGG - Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1021254944 7:18380521-18380543 AGTCATCTGTATAGAGAGGAAGG + Intronic
1022740549 7:33116240-33116262 ACTCATGGATATAGAGAGGAGGG - Intergenic
1023340766 7:39216940-39216962 ACACACCCACAGAGAGAGGGAGG + Intronic
1024622126 7:51169660-51169682 ACTCATTGACAGAGAGTAGAAGG + Intronic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1028318992 7:89437211-89437233 TCTCGCCTACAGAGAGAGGTGGG - Intergenic
1028759295 7:94477292-94477314 ACTTATCTACACAGACAGAATGG + Intergenic
1029193193 7:98786270-98786292 ACTGATCTACAAAGAATGGAAGG - Intergenic
1030323299 7:108192551-108192573 ACTGCTCTAGAGGGAGAGGAAGG + Intronic
1031016708 7:116583260-116583282 CCTTCTCTACAGAGAGTGGATGG + Intergenic
1032118187 7:129135268-129135290 ACTTATCTTCAGGGAGTGGATGG + Intergenic
1032478465 7:132228000-132228022 ATGCATGTACAGAGAGAGAAAGG - Intronic
1032976992 7:137236562-137236584 AGTGGTCTACAGATAGAGGAAGG - Intronic
1035603385 8:912622-912644 GCTCAGCTCCACAGAGAGGAAGG - Intergenic
1035622527 8:1044635-1044657 AGTCATCTACTGAGAAAGGATGG - Intergenic
1036434583 8:8722031-8722053 ACTGAAGTCCAGAGAGAGGAAGG - Intergenic
1038795685 8:30707312-30707334 TCTCTTCTGCAGAGAGAGGGTGG - Intronic
1040699274 8:50041327-50041349 ACTCATCAACTGGGAGAGAATGG - Intronic
1043794483 8:84519333-84519355 ATTCATATTAAGAGAGAGGATGG - Intronic
1045137655 8:99238927-99238949 AAAAATCTACTGAGAGAGGAAGG + Intronic
1046200940 8:110926913-110926935 AATAATATAGAGAGAGAGGAGGG + Intergenic
1046552423 8:115733444-115733466 ATTTATATACAGAGAGAGAAGGG - Intronic
1046668017 8:117026505-117026527 TATCATGTACAGAGAGAGGGAGG - Intronic
1047965566 8:130043913-130043935 ACGAATCTACAGAAACAGGAAGG + Intergenic
1048606039 8:135969936-135969958 GCAGATCTAGAGAGAGAGGATGG + Intergenic
1050165550 9:2761123-2761145 TCTCTTCTACAGAGAGAGAGAGG - Intronic
1050766741 9:9143742-9143764 ATCCATCCTCAGAGAGAGGAAGG + Intronic
1050951162 9:11596209-11596231 ACTCATGTAGAGATGGAGGAGGG + Intergenic
1053396796 9:37782583-37782605 ACAGATTTACAGAGAAAGGAAGG + Intronic
1053602985 9:39629732-39629754 CCTCTTCTACATAGAGAGGCGGG + Intergenic
1053676934 9:40441066-40441088 ACTCATTTACATAGAGATGATGG - Intergenic
1053860634 9:42383480-42383502 CCTCTTCTACATAGAGAGGCGGG + Intergenic
1053926700 9:43067164-43067186 ACTCATTTACATAGAGATGATGG - Intergenic
1054250553 9:62712704-62712726 CCTCTTCTACATAGAGAGGCGGG - Intergenic
1054286782 9:63183841-63183863 ACTCATTTACATAGAGATGATGG + Intergenic
1054290005 9:63276589-63276611 ACTCATTTACATAGAGATGATGG - Intergenic
1054388035 9:64581133-64581155 ACTCATTTACATAGAGATGATGG - Intergenic
1054507688 9:65935236-65935258 ACTCATTTACATAGAGATGATGG + Intergenic
1054564661 9:66747216-66747238 CCTCTTCTACATAGAGAGGCGGG - Intergenic
1055176514 9:73324189-73324211 ACAAGTCTAGAGAGAGAGGAAGG - Intergenic
1057369335 9:94455795-94455817 ACCCCTCAACAGAGAGAGCATGG - Intronic
1057811801 9:98263114-98263136 ACACATCTACAAAGCAAGGAGGG + Intergenic
1057899072 9:98933609-98933631 ACTCATGCCCAGAGAGAAGAAGG - Intergenic
1059634608 9:116158513-116158535 CCTCATGTACAGAGTGATGATGG + Intronic
1059925912 9:119208936-119208958 ACTCATCTAGTGAGAGACAAAGG + Exonic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1061177763 9:129007945-129007967 ACTCTTCCACAGAGTGAGCAGGG - Intronic
1062704455 9:137928821-137928843 ACAAATCTACAGAGACAGAAAGG - Intronic
1185659161 X:1713147-1713169 ACTCAAAGACAGACAGAGGAGGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186567978 X:10684923-10684945 ACAGATCTATAGAGACAGGAAGG - Intronic
1188617834 X:32180479-32180501 TCCCATTTACAGAGAGAGGTGGG + Intronic
1190199332 X:48346684-48346706 TCACATCTAGGGAGAGAGGAGGG + Exonic
1192033696 X:67542863-67542885 AGTCTTCTACAGAGAAAAGATGG - Intergenic
1192218097 X:69177841-69177863 ATTCCTCAACAGAGAGAGAAGGG + Intergenic
1193553827 X:82930396-82930418 ATTCCTCTGCAGAGATAGGATGG + Intergenic
1195759572 X:108231561-108231583 ACTCAAATACAGAGAGATTAAGG + Intronic
1195955216 X:110321304-110321326 AGTCAGTTACAAAGAGAGGAAGG - Intronic
1197336638 X:125216960-125216982 AATCATCTAAAAAGATAGGAGGG + Intergenic
1199226258 X:145378224-145378246 ACTCATCAACTGAGAGAAAATGG + Intergenic
1199441570 X:147874523-147874545 TTTCATTTACAGAGAAAGGATGG + Intergenic
1200808459 Y:7457617-7457639 ACTCATCTACAGAAACATCATGG + Intergenic
1202039845 Y:20669929-20669951 ACACATACACAGAAAGAGGATGG - Intergenic