ID: 908679766

View in Genome Browser
Species Human (GRCh38)
Location 1:66647751-66647773
Sequence CTGCATAAACAGAGGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908679766_908679771 -1 Left 908679766 1:66647751-66647773 CCAGTGTCCCTCTGTTTATGCAG 0: 1
1: 0
2: 1
3: 17
4: 212
Right 908679771 1:66647773-66647795 GGTTCACTGTTTTTTAAGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 227
908679766_908679770 -5 Left 908679766 1:66647751-66647773 CCAGTGTCCCTCTGTTTATGCAG 0: 1
1: 0
2: 1
3: 17
4: 212
Right 908679770 1:66647769-66647791 TGCAGGTTCACTGTTTTTTAAGG 0: 1
1: 0
2: 1
3: 12
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908679766 Original CRISPR CTGCATAAACAGAGGGACAC TGG (reversed) Intronic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485675 1:2921524-2921546 CTGGATGGACAGACGGACACAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
902176259 1:14653233-14653255 CTGGATGAACAAAGGGTCACAGG + Intronic
902282597 1:15385217-15385239 CTGCCTAAACAGATGTATACAGG - Intronic
903294626 1:22335860-22335882 CTGAATAAGCAGAGTGCCACTGG + Intergenic
904125608 1:28236338-28236360 CTGCAGAGAGACAGGGACACTGG - Intronic
904199991 1:28813242-28813264 CTGCACAAACACAGGGACGACGG - Intronic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
909371169 1:74885057-74885079 CTGCACACACACAGGGACCCTGG - Intergenic
910706944 1:90139997-90140019 CTGCATAAACAGGGGGGCCCTGG + Intergenic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
912490495 1:110060194-110060216 CAGCATAGACTGAGGCACACTGG - Exonic
913529258 1:119721898-119721920 CTGCAGAAACACAGGGGCAGAGG + Intronic
914942166 1:152032807-152032829 CTGCAGAACCAGAAGGACCCTGG - Exonic
916094676 1:161338804-161338826 CTGGAGAAATAGAGGGACCCAGG + Intronic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920793120 1:209111559-209111581 CTGCACAAACAGACTGAGACAGG + Intergenic
921261688 1:213389916-213389938 ATCCATAAACACAGGGCCACTGG - Intergenic
923247446 1:232146159-232146181 CTGCAAACATAGTGGGACACTGG - Intergenic
923486335 1:234435090-234435112 CTGCTTAAAGAGAAGGACATAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1062865089 10:845731-845753 CTGCATAAACTGCTGGACTCCGG + Intronic
1063808106 10:9670934-9670956 CTGCATTAACAGAGGTAAACTGG + Intergenic
1064221143 10:13441040-13441062 CTTCATAAACACAGGAAGACCGG + Intronic
1066655177 10:37691987-37692009 TAGCATGAACACAGGGACACTGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067040238 10:42948119-42948141 TAGCATGAACACAGGGACACTGG + Intergenic
1067770316 10:49117800-49117822 CTGCATGAACACAGGAACAAGGG + Intergenic
1069298775 10:66880375-66880397 CTGCATAAAGAGAGCTACCCTGG + Intronic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1071469926 10:85976754-85976776 GAGCATACACAGAGGGAAACAGG - Intronic
1071717669 10:88113591-88113613 CTCCATCTACTGAGGGACACAGG + Intergenic
1074338371 10:112601219-112601241 CTGCTTAAACAAAGGTACAGAGG + Intronic
1074701552 10:116096995-116097017 CTGAATAAACAGAGACACACAGG - Intronic
1075940330 10:126386080-126386102 CGGAGTAAAAAGAGGGACACAGG + Intronic
1076282327 10:129258809-129258831 CCTCATAAACAGAGGGCCATCGG + Intergenic
1080797240 11:35576099-35576121 GTGGACAAACAGAGAGACACCGG - Intergenic
1080940710 11:36914517-36914539 CAGCATAAACAAAGGTACAGAGG - Intergenic
1081135320 11:39433132-39433154 CTGTATAAAGAGAGACACACGGG - Intergenic
1081672083 11:44948124-44948146 CAGGATAAACAGTGAGACACAGG + Intronic
1085237219 11:75024336-75024358 CTGCAGAAACTGAGGGAAAGTGG + Intergenic
1088834271 11:113564540-113564562 CTGCATGTGAAGAGGGACACTGG + Intergenic
1090879495 11:130821120-130821142 CTGCAGAAACAGGAGGAAACAGG + Intergenic
1091311125 11:134576008-134576030 CTGCATGAGCCGACGGACACAGG - Intergenic
1095753042 12:45730660-45730682 CTGTATAAACCGAGGGCGACGGG - Intronic
1098869152 12:75797483-75797505 TTGCATATACAGTGGGAGACAGG + Intergenic
1101111625 12:101492125-101492147 CTCCACACACAAAGGGACACAGG - Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107224881 13:38036608-38036630 CTGCATAGACTGAGGGAGAGAGG - Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109893407 13:68650249-68650271 CTGCAAAAACACAGGCACGCAGG + Intergenic
1110546093 13:76757051-76757073 CTGCATAGTCTGAGGTACACAGG + Intergenic
1114593732 14:23893169-23893191 CTGCAAAAACAGTATGACACTGG - Intergenic
1115430805 14:33316432-33316454 CTGCAGACTCAGAGAGACACAGG + Intronic
1116787289 14:49301609-49301631 CTGAAAACACAGAGGGACTCAGG + Intergenic
1120352733 14:83383646-83383668 CTGCATAAACAGATTAACAGTGG - Intergenic
1121145168 14:91576617-91576639 CTTGACAAACAGTGGGACACAGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121676899 14:95760655-95760677 CAGCATAAATAGAGGGGTACGGG + Intergenic
1122993802 14:105251612-105251634 CTGCAGCAGCAGAGGGGCACCGG - Intronic
1125920568 15:43523109-43523131 CTGGCTGAACAAAGGGACACAGG + Exonic
1127005351 15:54562925-54562947 ATGCATCAACAGAGGTAGACAGG - Intronic
1129056693 15:72825570-72825592 ATGCACACACAGAGAGACACAGG - Intergenic
1131056869 15:89380027-89380049 CTGCACATACACAGGAACACAGG + Intergenic
1131820036 15:96263150-96263172 CTGCATAAGCAGACGGGCATTGG - Intergenic
1133301290 16:4784225-4784247 CTGCATCATCAGAGACACACAGG + Intronic
1133496792 16:6326079-6326101 CTCCTTAAACAGAGGGACTGAGG - Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1137708912 16:50553250-50553272 GAGCATATACAGAGGCACACAGG - Intronic
1137710305 16:50562297-50562319 CTGCAGATACACAGTGACACAGG - Intronic
1138047152 16:53737084-53737106 CTGCAGAAACAGGCGCACACAGG - Intronic
1139079321 16:63495834-63495856 CCGGAAAAACAGAGGTACACTGG - Intergenic
1140276316 16:73512090-73512112 CTGCAGGAACAGCCGGACACGGG + Intergenic
1140739988 16:77932917-77932939 CTACAGAAACAGAGGGACATTGG + Intronic
1142320632 16:89380516-89380538 CTGCATAAGAAACGGGACACAGG + Intronic
1142799303 17:2335606-2335628 CTGCTTCAAGATAGGGACACTGG - Exonic
1144655522 17:17032904-17032926 GTGCATACACACAGGGACACAGG - Intergenic
1144864850 17:18328883-18328905 CTGCAGATCCAGAGCGACACTGG - Exonic
1145719591 17:27057640-27057662 CTACATAAACAGAGTGACGACGG + Intergenic
1148992393 17:51677636-51677658 GTACATAAAAAGAGGGAGACAGG + Intronic
1153723179 18:7928192-7928214 ATGAAAAAACAGAGTGACACTGG - Intronic
1155257112 18:24008415-24008437 CTGCATAAACAGAAGGCAAATGG - Intronic
1155272656 18:24155861-24155883 CAGCATAAACTGATGGAAACTGG - Exonic
1156783314 18:40878619-40878641 CTGCATAAACAGGTGAAGACAGG + Intergenic
1156885163 18:42126880-42126902 CTTCATAAACAGTGGGAGAGTGG + Intergenic
1157498501 18:48172871-48172893 CTGCAGAGACAGAGGAGCACAGG + Intronic
1158547772 18:58410590-58410612 CTGAATAAACAGTCAGACACTGG + Intergenic
1160855240 19:1214357-1214379 CAGCATAGACCAAGGGACACTGG - Intronic
1161790649 19:6357922-6357944 CTGATTAAACAAAGGGAGACAGG + Intergenic
1162577703 19:11508325-11508347 CTGGAGAAACTGAGGCACACAGG - Intronic
1163133799 19:15294567-15294589 CTGCAAAAACAGTGGGAAAGGGG - Intronic
1163328428 19:16620187-16620209 CAGCATAAACAGCTGGACCCAGG + Intronic
1165218959 19:34298976-34298998 CTGCACACCCAGAGGGAAACTGG + Intronic
1165981675 19:39729427-39729449 CTGCATGAAGACAGGGACAGGGG + Intergenic
1166253593 19:41587111-41587133 ATGCATTCACAGAGGGACCCAGG - Intronic
1166257775 19:41618728-41618750 ATGCATTCACAGAGGGACCCAGG + Intronic
1166720447 19:44993094-44993116 CTGGAAACACAGAGGGACAGAGG - Exonic
1167852757 19:52214432-52214454 CTGCATAAACTGTGTCACACTGG + Intronic
1168214164 19:54912971-54912993 CTGCAGGGAAAGAGGGACACTGG + Exonic
925923228 2:8652146-8652168 CTGCATATGCAGAGGGCCTCAGG + Intergenic
926040370 2:9667880-9667902 CTGCAGGAACAAATGGACACAGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
928630063 2:33182154-33182176 CTTTATAACCAGAGAGACACAGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930539646 2:52689753-52689775 CTGCATAAATAAAGAGAGACAGG + Intergenic
930587861 2:53291085-53291107 CTCCATAAACACACGCACACAGG + Intergenic
933671744 2:85014452-85014474 ATGGATAAACTGAGGCACACAGG - Intronic
933839358 2:86274151-86274173 CTGCATAAACATAGGAAGAAAGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
942931303 2:181496548-181496570 TTGCCTATACAGAGGGACATAGG - Intronic
944004261 2:194883653-194883675 CTACATAAACACAGTGAAACTGG - Intergenic
944062515 2:195584045-195584067 CTGCATAGAGTGGGGGACACAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1169482841 20:6000967-6000989 CTGCAGGACCAGAGGGAAACAGG + Intergenic
1171282501 20:23912464-23912486 CTGAATAAACAGAGAGACCCTGG - Intergenic
1172092364 20:32442743-32442765 GTGCAGACACAGAGGCACACGGG - Intergenic
1174645402 20:52081038-52081060 CTGCATTTAAAGAGGGACAGGGG + Intronic
1175214891 20:57386920-57386942 CTGCAAAGACAGAAAGACACTGG - Intergenic
1175856738 20:62124790-62124812 CAGCATGCACAGAGGGACAGTGG - Intronic
1176168185 20:63685435-63685457 CCGCATACACAGAAGGTCACAGG - Intronic
1176288157 21:5029862-5029884 TTGCATAAACAGAGTCCCACAGG - Intronic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178347551 21:31844406-31844428 CTGCATAAGTAGAGGTTCACTGG + Intergenic
1178902236 21:36606813-36606835 CTGCATCCACAGGGGGACACCGG - Intergenic
1179869024 21:44233613-44233635 TTGCATAAACAGAGTCCCACAGG + Intronic
1181159183 22:20947131-20947153 CTGCTTAGACAGAGGGAACCTGG - Intronic
1181857851 22:25794987-25795009 TTGCATAAACAGAAGCACATGGG + Intronic
1182022437 22:27091968-27091990 CTGCAGAAACAGAAAGAGACAGG + Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182600387 22:31458696-31458718 CTGAAGCCACAGAGGGACACTGG - Intronic
1183628906 22:39021472-39021494 CTTCAAAAAAAGAGGGAGACTGG + Exonic
950626173 3:14248747-14248769 CTGCCACAAAAGAGGGACACAGG - Intergenic
950644946 3:14371525-14371547 ATGCAGAAACAGAGACACACAGG - Intergenic
951605966 3:24435337-24435359 ATGCGTAGGCAGAGGGACACAGG + Intronic
953901543 3:46846566-46846588 CTGCATCCACTCAGGGACACAGG - Intergenic
954665058 3:52247143-52247165 CTCCACAAACTGAGGGTCACTGG - Intronic
954759977 3:52866991-52867013 CTGCATAAAGACAGGGAAGCCGG + Intronic
956867611 3:73384931-73384953 CTGCATAAACACAAGAACAAAGG + Intronic
958428960 3:94015174-94015196 CTACAGAAACAGAGGAACAAGGG - Exonic
960663904 3:120092176-120092198 CTCCATAAATAGAGATACACTGG + Intronic
962980797 3:140487713-140487735 CAGCCTAAACAGAGGGACAAGGG - Intronic
964849915 3:161084519-161084541 CTGCATAAACCCAGGAACAGGGG + Exonic
966928943 3:184663349-184663371 TTGCTTAAACTGAGGCACACCGG - Intronic
970962471 4:21888852-21888874 CTGCATAAAAAGAGCTAAACTGG - Intronic
971255542 4:25010385-25010407 CTGAATAAACAGTGGGTGACTGG + Intronic
971545938 4:27886900-27886922 TTGCATAAACAGAGCCAAACAGG + Intergenic
974688079 4:65257595-65257617 CTGCATAAACAGGGGAAGAAGGG + Intergenic
976610079 4:87021374-87021396 CTGGATAAACTGAGGCAAACAGG - Intronic
978505429 4:109451221-109451243 CTGTATATAGAGAGGGAGACAGG + Intronic
979964240 4:127058683-127058705 ATCAATAACCAGAGGGACACTGG + Intergenic
985255026 4:188061358-188061380 CTGCAGAAACAGAGGCCCGCTGG - Intergenic
985914015 5:2903965-2903987 CTGCATAGACAGTGGGGCTCCGG + Intergenic
986144304 5:5063079-5063101 GTGCACATACAGAGGCACACGGG + Intergenic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
986720016 5:10554283-10554305 CTGCACAATCAGAGGGCCGCAGG - Intergenic
986859176 5:11905389-11905411 CTGCTGAATCAGAGGGACAGGGG - Intergenic
986937814 5:12913019-12913041 CTATATAACCAGAGGGACAGAGG - Intergenic
992593496 5:78321312-78321334 TTGCATAAACAGTGGGACTCGGG + Intergenic
993312786 5:86357669-86357691 CTGCATGAAAAGAGGGAGAGTGG - Intergenic
993884556 5:93400300-93400322 CTGCAGACACAGACGGCCACTGG - Intergenic
997804713 5:136905720-136905742 CTGAATACACAGAGGCAGACAGG - Intergenic
999174494 5:149622229-149622251 CTTCACTAACAGAGGGAGACTGG - Intronic
1001874277 5:175185913-175185935 CTGCATAAAGTCAGGGACAGTGG - Intergenic
1002106707 5:176882848-176882870 GTGCATAAACAGCTGGACAGAGG - Intronic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003237062 6:4304286-4304308 CCCCACAAACAGAGGGACTCTGG + Intergenic
1003988317 6:11460338-11460360 CAGCATAAGCAGAGAGACACAGG + Intergenic
1006024759 6:31139704-31139726 CTGCAGAAAAGGAAGGACACAGG + Exonic
1006605465 6:35253411-35253433 CTGCATACAAAGAATGACACTGG - Intergenic
1006863459 6:37189415-37189437 CTTCAAAGACAGAGGGAAACAGG + Intergenic
1007761404 6:44135604-44135626 CTGCATAGGCAGGGGCACACAGG - Intronic
1012019414 6:93898314-93898336 CTGGAGACACAGAGAGACACAGG - Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013187170 6:107769772-107769794 CTCCATACACAGCTGGACACTGG - Intronic
1014297345 6:119636201-119636223 ATGCATACTCAAAGGGACACTGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018479580 6:164176553-164176575 GTCCATAGACAGAGGGACATGGG - Intergenic
1018631460 6:165826351-165826373 ATGCAAGGACAGAGGGACACGGG - Intronic
1020320220 7:6934431-6934453 CTGCCTGCACAGAGAGACACGGG - Intergenic
1020985020 7:15122345-15122367 CTGCAGATACAGAAGTACACAGG - Intergenic
1021712664 7:23431535-23431557 GTGGATTAACAGAGGGTCACAGG + Intronic
1022129990 7:27396102-27396124 GTGCTTTAACAGAGGGACATTGG + Intergenic
1022469397 7:30672985-30673007 CTGCTGAAACACAGGGTCACAGG - Intronic
1026921961 7:74162345-74162367 CTGCAGAGACAGAGGGGCACTGG + Intergenic
1026965715 7:74438585-74438607 CAGCACAAACAGAGTGAGACAGG - Intergenic
1027548887 7:79565822-79565844 CTCTATAAACACAGGAACACTGG - Intergenic
1031916079 7:127564244-127564266 CTACATAAACAGAGGGCTAGAGG + Intergenic
1032293762 7:130615766-130615788 CTGCATACAAAGAATGACACTGG + Intronic
1032427454 7:131833172-131833194 CTTCATAAACAGTGGGGCACTGG + Intergenic
1032695479 7:134332406-134332428 CAGCACAAACAGAGGCACAGAGG - Intergenic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1034054600 7:148021440-148021462 CTACATAAATAGGGAGACACGGG + Intronic
1034588494 7:152118008-152118030 CTTCATAAAAGAAGGGACACTGG - Intronic
1038833470 8:31090856-31090878 CTACATAAACAGGTGGATACTGG - Exonic
1039913962 8:41846072-41846094 CTCCATAAACTGAGGGATGCTGG + Intronic
1040879309 8:52188345-52188367 ATGCAGAAACAGTGGGGCACAGG + Intronic
1040888131 8:52287684-52287706 TTGCATATACAAAGGGAGACAGG + Intronic
1041289975 8:56299438-56299460 CTGAGGAAACAGAAGGACACAGG - Intergenic
1041526982 8:58817220-58817242 CTGCATCAACAGTGTGACACAGG - Intronic
1042706738 8:71671284-71671306 CTGCAGAAACAGAGTGCCTCTGG - Intergenic
1043422646 8:80114705-80114727 CTACATCAACAGAGGCACAGGGG - Intronic
1044944113 8:97375135-97375157 CTTTTTAAACAGAGGGACTCTGG + Intergenic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047970610 8:130081224-130081246 CAGCAAAACCAGAGGCACACAGG + Intronic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048970676 8:139643466-139643488 CTGCAGGGACTGAGGGACACAGG + Intronic
1049339852 8:142106261-142106283 ATGCAGAAACAGAGGGACACAGG + Intergenic
1049941602 9:551253-551275 CTGGACAAAAAGAGGGAAACAGG - Intronic
1050649735 9:7763107-7763129 CTGAAGAAACGGAGAGACACAGG - Intergenic
1053399867 9:37809532-37809554 CAGAATAAAAAGAGGGACATAGG + Intronic
1058427896 9:104891600-104891622 CTGCATGATCAGAGTGAGACTGG + Intronic
1059469318 9:114492564-114492586 ATGCATACACAGATGCACACAGG + Intronic
1061819533 9:133218572-133218594 CACCACAAACAGAGGGAAACTGG + Intergenic
1061995088 9:134179140-134179162 CTGGAAAGACAGAGGAACACGGG - Intergenic
1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG + Intronic
1187912111 X:24120594-24120616 CTGGATAATTAGAGGGACAGAGG - Intergenic
1191215726 X:57930754-57930776 CTGCACAAATGGAGGTACACAGG + Intergenic
1196409847 X:115406785-115406807 CTGCAGAAACAGAGCCACAAAGG - Intergenic
1197172906 X:123454298-123454320 ATGCAGAAACAGAGGCACAGAGG - Intronic
1197561268 X:128024853-128024875 CTGCACACACAGAGGGACCCTGG + Intergenic