ID: 908685769

View in Genome Browser
Species Human (GRCh38)
Location 1:66717691-66717713
Sequence GTATGCATAAAGTTTAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908685769_908685772 23 Left 908685769 1:66717691-66717713 CCAATCTTAAACTTTATGCATAC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 908685772 1:66717737-66717759 TGTATAAAGTCTTTGAGCCTTGG 0: 1
1: 0
2: 2
3: 17
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908685769 Original CRISPR GTATGCATAAAGTTTAAGAT TGG (reversed) Intronic
901587805 1:10312769-10312791 GTATGAAGAAAGATAAAGATAGG - Intronic
907131239 1:52099108-52099130 GTATCCATAATGTTTTTGATCGG - Intergenic
907349840 1:53819611-53819633 GTATGCATTATCTTTAAGATTGG - Intronic
908685769 1:66717691-66717713 GTATGCATAAAGTTTAAGATTGG - Intronic
909694340 1:78449056-78449078 GAATGAATGAAGTTTAAGAAGGG - Intronic
911984543 1:104604033-104604055 TTAAGCATAAAGCTTAAAATAGG + Intergenic
915029043 1:152860367-152860389 GAATGCATAAATTAGAAGATAGG + Intergenic
916496315 1:165351281-165351303 ATAAGCAGAAAGTTAAAGATTGG + Intronic
922298818 1:224277420-224277442 GGAGACATAAAGTTTCAGATAGG + Intronic
924495212 1:244582149-244582171 GTATGTAGAAACTTTGAGATGGG - Intronic
1066613070 10:37269859-37269881 CTATGCCTAAAGTTACAGATTGG + Intronic
1068718200 10:60211624-60211646 GTATGCATAAAGCACAAGACTGG + Intronic
1068919968 10:62473158-62473180 GGATGCATAAAATTCAAGCTAGG + Intronic
1071464831 10:85929488-85929510 GTTTGTATAAAGTTTTAGAATGG - Intronic
1071679488 10:87690356-87690378 TTATGCATAAATTTTAAAATAGG - Intronic
1075036708 10:119075334-119075356 ATATGCATAAAACTTAAAATTGG - Intronic
1075744561 10:124717705-124717727 GTATGCATAAGGATTGAGCTTGG - Intronic
1076583262 10:131529012-131529034 GTATGCATGAAGTTTAAAGCAGG + Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1080556198 11:33419543-33419565 GTATGCATTAAATATAATATGGG + Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1091004727 11:131942648-131942670 GAATGCATAGAGTTTAGGCTGGG + Intronic
1094372463 12:29753047-29753069 TTATTCCTAAATTTTAAGATTGG - Intronic
1094754984 12:33457391-33457413 GAATCAATAAAGTTGAAGATAGG + Intergenic
1095466168 12:42490142-42490164 GTATGGTTAAATTTTAATATAGG + Intronic
1096375818 12:51109689-51109711 TACTGCATAAAGTCTAAGATTGG + Intronic
1099378966 12:81932587-81932609 GTATGCAGCATTTTTAAGATTGG + Intergenic
1099825896 12:87777894-87777916 GTATACATAGAGTCTAAAATTGG - Intergenic
1102846443 12:116189648-116189670 TTTTGCATAAAGTTTGAGACAGG + Intronic
1104165823 12:126228945-126228967 GTATGCAGAGAGTTTAAAATAGG + Intergenic
1104698708 12:130884532-130884554 TTTTGCATATAGTGTAAGATAGG + Intergenic
1105770900 13:23610851-23610873 TTATCAATAAACTTTAAGATGGG - Intronic
1106401419 13:29434902-29434924 GTTTGCAAAAAGTCTTAGATTGG + Intronic
1106623909 13:31399042-31399064 ATATGCAGCAATTTTAAGATAGG - Intergenic
1107850391 13:44566508-44566530 GAATACATAAATTTTAAGAGTGG - Intronic
1108756216 13:53505381-53505403 ATATGAATATAATTTAAGATGGG + Intergenic
1108840071 13:54602285-54602307 TTTTGCATAAAGTGTAAGAAAGG - Intergenic
1108999569 13:56780658-56780680 GAATGTATAAATTTTAAGATAGG + Intergenic
1111126599 13:83917467-83917489 TTTTGCATAATGTTTAAAATAGG - Intergenic
1115775005 14:36705467-36705489 GTATGCATTAACTTTATAATAGG - Intronic
1117430405 14:55653430-55653452 ATATGCAGTAAATTTAAGATTGG - Intronic
1117922481 14:60739656-60739678 GTATGCATATAGAAGAAGATTGG + Intronic
1118044463 14:61951793-61951815 GTATATATATATTTTAAGATAGG + Intergenic
1120031264 14:79643936-79643958 GTATTCATTAAGTTTACAATTGG - Intronic
1124055396 15:26237177-26237199 GGCTGCAAAAAGTTTAGGATGGG + Intergenic
1128965997 15:72058276-72058298 GTATACATATATTTTAAAATGGG + Intronic
1131977026 15:97957297-97957319 GTGGCCAAAAAGTTTAAGATTGG + Intergenic
1139173358 16:64658059-64658081 GCATGCAGAAAGATTATGATAGG + Intergenic
1139443796 16:66984046-66984068 GTGTGCATAAAGTGTATTATTGG - Intergenic
1140122837 16:72098503-72098525 GTATCTATAACGGTTAAGATCGG - Intronic
1147940535 17:44044147-44044169 CTATGCAGAATGTTTAAGAATGG + Intronic
1153033655 18:738344-738366 GTATATATACAGTTTAAAATGGG - Intronic
1153729381 18:7993132-7993154 GAATGACTAAAGTTAAAGATAGG + Intronic
1156062751 18:33100249-33100271 TTATGCATAAAGTTTACTAACGG + Intronic
1158294030 18:55974189-55974211 GAAAACATAAAGTTTCAGATGGG - Intergenic
1159988920 18:74879076-74879098 GTATGTATAAATCTTAAAATAGG + Intronic
1161223169 19:3127919-3127941 GTGTGCATAAAGTTCAAAACTGG + Intergenic
1164793483 19:31007356-31007378 ATATGCAAAAGGTTTAAGACAGG + Intergenic
1168541064 19:57210823-57210845 GTTTGCATAAACTGTCAGATAGG + Intronic
927222536 2:20726664-20726686 TTATGCAGAAAGTTTAGAATGGG - Intronic
930966254 2:57331639-57331661 GTTTTCATAAATTTTAAGATAGG - Intergenic
935619277 2:105114586-105114608 CTATGCATAAGTTTTAAGAGGGG + Intergenic
937823970 2:126344425-126344447 GTATGCATAAAGATTAGTATAGG - Intergenic
941870181 2:170376138-170376160 CAATGCATAAATTTTAAAATAGG - Intronic
942190701 2:173466297-173466319 ATATGCATGAAGTCTAAGCTAGG - Intergenic
942666623 2:178326158-178326180 GAATGCATCAAGCTTAGGATTGG - Intronic
946943110 2:224790759-224790781 GTATGAATATAGGTGAAGATAGG - Intronic
948084534 2:235236516-235236538 GTATGCATAAAGATGAGGACAGG + Intergenic
948215598 2:236227809-236227831 GTATGCATGGAGGTTAAGAATGG - Intronic
948300294 2:236901252-236901274 GTTTGCACAAAGTTTAAAATAGG + Intergenic
1169974499 20:11308576-11308598 TTGTGCATATAGTGTAAGATAGG - Intergenic
1170038395 20:12014632-12014654 GTATAGATAAAGTTTAGGAGTGG - Intergenic
1177272264 21:18865120-18865142 TTATGCATATAGTGTAAGAAAGG + Intergenic
1177517297 21:22171657-22171679 GTAGGCCTAAAGGTTAAGACAGG + Intergenic
1177520388 21:22214147-22214169 GTATGCATAAACTGGAATATTGG + Intergenic
951587777 3:24232876-24232898 GGATGCAGATAGGTTAAGATTGG + Intronic
953494543 3:43374774-43374796 GTGTGCATACAGATCAAGATAGG - Intronic
954771837 3:52977613-52977635 GTAAGCATAAAGTTCATGCTGGG + Intronic
957525104 3:81370469-81370491 CTATGCATAGAGTTTTAGTTCGG - Intergenic
957742228 3:84285832-84285854 GAAGGCATAAAGTTTCTGATTGG + Intergenic
958473904 3:94556196-94556218 GTATACATAAACATAAAGATGGG + Intergenic
959753601 3:109868970-109868992 GTATGCTTAAATTTTAATAATGG + Intergenic
959929810 3:111967661-111967683 TTATGCATAATGTTTAGGAACGG + Exonic
960206617 3:114908666-114908688 GTACGCATTAAGTTCAAAATAGG + Intronic
964132180 3:153301911-153301933 ACATTCATAAATTTTAAGATTGG + Intergenic
964496345 3:157294868-157294890 GTATGTTTACATTTTAAGATGGG + Intronic
965172645 3:165287158-165287180 GTGTGCATAAAGTCTAGGTTTGG - Intergenic
966173721 3:177112492-177112514 TTATGCATACAGATTGAGATCGG + Intronic
969394628 4:6912093-6912115 GTATAAATAAAGTTTCAGCTGGG + Intronic
976637401 4:87300708-87300730 CTTTGCATACAGTTGAAGATTGG + Intergenic
977651410 4:99473836-99473858 GTATGCAAAATGTTTAGAATAGG + Intergenic
977803480 4:101267522-101267544 ATAAGCATAAAGTTTAATAATGG + Intronic
978927809 4:114270417-114270439 TGATGTATAAAGTATAAGATAGG + Intergenic
979234976 4:118389604-118389626 GTATGCCTAAAGTTTAATGTTGG - Intergenic
979411296 4:120383151-120383173 TTAGGCATAATGTTTGAGATTGG - Intergenic
981911157 4:149982956-149982978 ATATGCAAAGAGTTTAAAATAGG + Intergenic
983042314 4:162944199-162944221 CTATGTATACAGTTTAAAATGGG + Intergenic
983490964 4:168388693-168388715 GTATGTATAATGATTAATATGGG - Intronic
984544604 4:181086752-181086774 GAATGCATAAAGTTGATTATGGG - Intergenic
986061190 5:4192795-4192817 ATATTCATAATGTTTAAAATAGG - Intergenic
987617721 5:20298145-20298167 CTATGCAAAAAGTTAAAGAAAGG - Intronic
988029839 5:25749774-25749796 GTTGGCATAAAATTTAACATAGG + Intergenic
992561972 5:77961400-77961422 GTATGTATAAAATTGAATATAGG - Intergenic
993563510 5:89443079-89443101 GTATGCAAAAAGTCCAAGATTGG + Intergenic
994319668 5:98378464-98378486 GTATGTATACAGTTGAAGTTTGG + Intergenic
996865721 5:128119375-128119397 CTATGCATCAAGTTTAAAATGGG - Intronic
999896342 5:156038024-156038046 ATATGAAAGAAGTTTAAGATAGG - Intronic
1001887501 5:175308087-175308109 GTTTCCATAAATTTTAAAATTGG + Intergenic
1003812363 6:9798948-9798970 GTATGCATACTGGTTGAGATTGG - Intronic
1005277701 6:24237872-24237894 GTATGCATAGACATAAAGATGGG + Intronic
1007539648 6:42629351-42629373 GTAGGCATAAAAATTAAGAAAGG + Intronic
1008643926 6:53494189-53494211 GTATGTATAAATATTAAGATTGG + Intergenic
1008734132 6:54521330-54521352 ATCTGCATAAAATTTAAGGTAGG - Intergenic
1009003982 6:57758600-57758622 TAATGCATAAAATTTTAGATTGG + Intergenic
1009333857 6:62460143-62460165 GTATGTCTAGAGTTTAAAATGGG + Intergenic
1009372217 6:62919782-62919804 GAATTCATAAAATGTAAGATAGG - Intergenic
1009648393 6:66440097-66440119 GTATACATAAACATAAAGATAGG + Intergenic
1010938685 6:81890034-81890056 GGATGAAGGAAGTTTAAGATGGG - Intergenic
1011512442 6:88115839-88115861 GAAAGCATAAAGTTGAACATAGG - Intergenic
1011930560 6:92706372-92706394 GTTTGCGTAAAGTTTATAATGGG + Intergenic
1012168333 6:95987413-95987435 ATATGCATAAATATTAACATTGG + Intergenic
1013721661 6:113037611-113037633 GAATGAGTAAAGTTAAAGATTGG + Intergenic
1014534913 6:122603403-122603425 GGATACATAAAATCTAAGATTGG - Intronic
1014711803 6:124815203-124815225 GTATATATATAGTTTAAGACTGG - Intronic
1016211807 6:141545056-141545078 GTATGTTTAAAATTTAAAATGGG - Intergenic
1016389747 6:143562634-143562656 ATATACATAAATTTTAAGACAGG - Intronic
1016810541 6:148257218-148257240 CAATCCATAAGGTTTAAGATCGG - Intergenic
1017206750 6:151810206-151810228 TAATGCAGAAAGTGTAAGATAGG - Intronic
1020446617 7:8275586-8275608 GAATGCATAATGTTTGAGCTGGG - Intergenic
1020933143 7:14426263-14426285 TTATGTATAAAGGATAAGATTGG + Intronic
1021498141 7:21298804-21298826 GTATGCAAAAACTGTAAGACTGG - Intergenic
1021512328 7:21447642-21447664 GCATGCATAGAGTTTAATGTTGG + Intronic
1031568422 7:123328049-123328071 ATATGCAGAAAGTTTAATAGGGG + Intergenic
1041574000 8:59371989-59372011 GTATGTATTAAGTATAATATAGG - Intergenic
1044461380 8:92448642-92448664 GTATGTATATATTTTAAGACAGG + Intergenic
1044671421 8:94684867-94684889 GCATGCAAAAAATTTAAGTTGGG + Intronic
1045741774 8:105368742-105368764 GTATCCATAAATTTCAAGATAGG + Intronic
1045804307 8:106139257-106139279 TTATGCATAAATTGAAAGATGGG - Intergenic
1046018295 8:108632908-108632930 GCATGAGTAAAATTTAAGATTGG + Intronic
1046020619 8:108660311-108660333 TTAACCATCAAGTTTAAGATAGG - Intronic
1050836933 9:10093888-10093910 GTATGCATGAATATAAAGATAGG + Intronic
1053398111 9:37793551-37793573 GTTTTTATATAGTTTAAGATAGG - Intronic
1054731077 9:68703774-68703796 GTATTAACAAAGTTCAAGATGGG - Intergenic
1054738057 9:68776188-68776210 GTATGTATATAATCTAAGATGGG - Intronic
1055060467 9:72063439-72063461 GAATGTATGAAGTTCAAGATAGG + Intronic
1055600692 9:77914983-77915005 GAATGGATAAAGTTCAAGAAAGG + Intronic
1056152985 9:83805766-83805788 CATTGCATAAAGTTTAAAATAGG - Intronic
1058127977 9:101218322-101218344 GTATGCATAATGATAAATATTGG + Intronic
1058690643 9:107517529-107517551 CTCAGCATAAAGTTTGAGATCGG - Intergenic
1059781690 9:117535489-117535511 ATTTGAATAATGTTTAAGATTGG - Intergenic
1059893816 9:118836762-118836784 GTATGTATACAGATTAAAATGGG + Intergenic
1187474054 X:19594089-19594111 TTATGAATAAATTTCAAGATTGG - Intronic
1192273893 X:69610731-69610753 GCATACTTAAAGTTTGAGATAGG - Intergenic
1192719852 X:73682554-73682576 TTAGGCATAAATTTTAAGAGTGG - Exonic
1196830789 X:119773927-119773949 GGATACATTAAGTTTGAGATTGG + Intergenic
1196887339 X:120260755-120260777 TTATGCATAAAGTTTTACAATGG - Exonic
1197459395 X:126721980-126722002 GTATGAATGAAGTATAAAATAGG + Intergenic
1199558613 X:149137486-149137508 GGAGGCTTAAAGTCTAAGATTGG - Intergenic
1202108325 Y:21393720-21393742 AACTGCATAAAGTTTCAGATGGG - Intergenic