ID: 908688634

View in Genome Browser
Species Human (GRCh38)
Location 1:66752542-66752564
Sequence GCCGGAGGTCTGGGAGGCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 387}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908688626_908688634 17 Left 908688626 1:66752502-66752524 CCTGGGACGCGGGAGCCGCGCCG 0: 1
1: 0
2: 3
3: 17
4: 164
Right 908688634 1:66752542-66752564 GCCGGAGGTCTGGGAGGCTCCGG 0: 1
1: 0
2: 1
3: 31
4: 387
908688627_908688634 2 Left 908688627 1:66752517-66752539 CCGCGCCGCGCGCAGTGTCTGCA 0: 1
1: 0
2: 0
3: 5
4: 91
Right 908688634 1:66752542-66752564 GCCGGAGGTCTGGGAGGCTCCGG 0: 1
1: 0
2: 1
3: 31
4: 387
908688628_908688634 -3 Left 908688628 1:66752522-66752544 CCGCGCGCAGTGTCTGCAGTGCC 0: 1
1: 0
2: 0
3: 14
4: 109
Right 908688634 1:66752542-66752564 GCCGGAGGTCTGGGAGGCTCCGG 0: 1
1: 0
2: 1
3: 31
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908688634 Original CRISPR GCCGGAGGTCTGGGAGGCTC CGG Exonic
900207010 1:1435919-1435941 GCGGGCGGGCTGGGAGGCTGCGG + Intronic
900460227 1:2799080-2799102 GCTGGAAGTCTGGGAGGCTAGGG - Intronic
901010534 1:6199332-6199354 CCGGGAGGTCTCGGAGGCCCGGG - Intronic
901055786 1:6448160-6448182 GCCTGTGCTCTCGGAGGCTCCGG - Intronic
901746399 1:11376671-11376693 GGTGGAGGCCTTGGAGGCTCTGG + Intergenic
902053754 1:13583856-13583878 GCCTAGGGTCTGGGAAGCTCGGG + Exonic
902583953 1:17426567-17426589 GTGGGAGGGCTGGGGGGCTCAGG - Intronic
903765730 1:25733004-25733026 TCCGTGGGCCTGGGAGGCTCTGG + Intronic
903882385 1:26520333-26520355 CCCAGCGCTCTGGGAGGCTCAGG + Intergenic
904311610 1:29632837-29632859 GCCGGAGGGCTGAGGGGCTGAGG - Intergenic
905058664 1:35120970-35120992 GGCGGAGGTCTCGTAGGCGCGGG + Intergenic
905865771 1:41375789-41375811 CCCGGAGATCTGGCAGGCCCTGG + Intronic
906401517 1:45508208-45508230 TCTGCAGCTCTGGGAGGCTCTGG - Exonic
906695094 1:47818170-47818192 GATGGAGGGCTGGGAGGCCCTGG + Intronic
907381844 1:54097090-54097112 CCCTGAGGTGTGGGAGGCTTCGG - Exonic
908561408 1:65309984-65310006 GCCGGGCGACTGGGAGGCTCCGG - Intronic
908688634 1:66752542-66752564 GCCGGAGGTCTGGGAGGCTCCGG + Exonic
910550327 1:88467335-88467357 GCCGGGGGCTGGGGAGGCTCAGG - Intergenic
911084919 1:93968350-93968372 GACTGAGGTCTGGAAGGGTCTGG + Intergenic
912502827 1:110133469-110133491 GCCAGATCCCTGGGAGGCTCTGG + Intergenic
913085776 1:115435221-115435243 GCAGCAGATCTGGGATGCTCAGG + Intergenic
914919952 1:151839787-151839809 GCGGTAGGGCTGGGAGGCGCGGG - Intronic
915246334 1:154558577-154558599 GCCGGCGGGCCGGGAGCCTCCGG + Exonic
917452968 1:175162407-175162429 TCCAGAGGTCTGGGTGGGTCTGG - Intronic
918371936 1:183869811-183869833 GCCAGAGGTCTGGGATGACCAGG - Intronic
920035820 1:203064791-203064813 GCTGGGGGGCTGGGAGGCCCTGG - Intronic
920161758 1:204004048-204004070 GCAGCTGGTCTGGGATGCTCAGG - Intergenic
921389806 1:214606363-214606385 GGCGGAGGTAGGGGAGGCCCTGG + Intronic
922043285 1:221918176-221918198 GCCGAAGGCCTGAGAGCCTCTGG - Intergenic
922306946 1:224352609-224352631 CACGGAGGTCGGGGAGGCTCAGG + Intergenic
922603124 1:226871727-226871749 GCTGAAGGCCTTGGAGGCTCAGG - Intronic
924172606 1:241357329-241357351 GCGGGAGGCCGGGGAGGCCCGGG - Intergenic
1063463296 10:6227969-6227991 GACGGAGGTCTGTGCAGCTCAGG - Intronic
1064087523 10:12356379-12356401 GCCCGTGTGCTGGGAGGCTCTGG + Intronic
1064360877 10:14663123-14663145 GCCGAAGGCCTGGGAGCCCCTGG - Intronic
1066255347 10:33673151-33673173 CTCTGAGGTCTTGGAGGCTCAGG - Intergenic
1067450811 10:46380880-46380902 ATCTGAGGTCTGGGTGGCTCTGG - Intronic
1067586432 10:47478871-47478893 ATCTGAGGTCTGGGTGGCTCTGG + Intronic
1068192110 10:53666173-53666195 ACCTGAGGTTTGGGAGGCTGAGG - Intergenic
1069163525 10:65119495-65119517 GCCAGAGGCCTGAGAGCCTCTGG - Intergenic
1069582723 10:69576483-69576505 GCCGGAGGTCAAGGAGTCTTAGG + Intergenic
1069593069 10:69653758-69653780 GCCGGCTCTCTGGGAGGCTGTGG - Intergenic
1069752593 10:70753829-70753851 GCCGGAGCTGTGGGAAGCTGGGG + Exonic
1069778835 10:70942291-70942313 GCAGGATGTCAGGGAGGCTGAGG - Intergenic
1070724858 10:78780888-78780910 TCGGGAGGTGTGTGAGGCTCTGG + Intergenic
1071055717 10:81506043-81506065 CACGGAGGTGGGGGAGGCTCAGG - Intergenic
1072522189 10:96238479-96238501 TCAGGAGGTCTGGTGGGCTCTGG + Intronic
1073323825 10:102631162-102631184 GCCTGAAGGCTGGGAGGCCCAGG - Exonic
1073554246 10:104433336-104433358 GCCGGTGCTCTGGGAGGCTAAGG - Intronic
1074226865 10:111493477-111493499 GCCTGAGGTCTCGGTGGCTGTGG - Intergenic
1074732495 10:116393633-116393655 GTAGGGGGTCGGGGAGGCTCAGG - Intergenic
1076396401 10:130141190-130141212 GCCTGTAGTCTGGGAGGCTGAGG + Intronic
1076877833 10:133225384-133225406 ACCGGAGGTCTCGGAGTCCCTGG - Exonic
1077418993 11:2440723-2440745 GCCGGTGCTCTGCGAGGATCTGG + Intergenic
1078097657 11:8310462-8310484 GCTGGAGGTGTGGGTGGCTGGGG + Intergenic
1078316018 11:10293968-10293990 GCCGGGGGGCGGGGAGGCCCGGG + Intronic
1078467166 11:11558964-11558986 GCTGGAGCTCTGGCAGGCTATGG - Intronic
1078786487 11:14499551-14499573 GGCGGAGGGCTAGGAAGCTCCGG - Intronic
1078856808 11:15212348-15212370 ACCTGAGGTCAGGGAGGCTGAGG - Intronic
1078891382 11:15561229-15561251 GGCGGTCGTCGGGGAGGCTCAGG - Intergenic
1079451775 11:20604507-20604529 GCCGCCGGGCGGGGAGGCTCAGG + Intronic
1079751727 11:24207954-24207976 CCCGGAGCTTTGGGAGGCTGAGG + Intergenic
1081848006 11:46254304-46254326 GCCGCAGAGCTAGGAGGCTCAGG + Intergenic
1082001335 11:47395098-47395120 GCCTGAGGCCTGGGGGACTCTGG - Intergenic
1083163104 11:60867654-60867676 GCCGGAGGCCTGGGAGGCCAGGG - Exonic
1083262070 11:61528534-61528556 CAGGGAGGTCTGGGGGGCTCAGG - Intronic
1083340234 11:61954698-61954720 CCCAGAGCTCTGGGAGGCTAAGG - Intronic
1083994156 11:66263977-66263999 GCTGGGGGTCTGGGAGGCAGGGG + Intronic
1084797717 11:71519310-71519332 GCCCAAGGTCAGGGAGTCTCAGG + Intronic
1084889295 11:72228816-72228838 GCTGGAGCTGTGGGAGTCTCAGG - Exonic
1084963939 11:72733571-72733593 GCCGGAGCTCTGTGGGGCTAGGG + Intronic
1085408214 11:76276708-76276730 CTGGGAGGCCTGGGAGGCTCTGG + Intergenic
1088570921 11:111222283-111222305 GGCGCTGGTCGGGGAGGCTCCGG - Intergenic
1088622659 11:111702332-111702354 TCCAGTGGTCTGGGAGGCTGAGG + Intronic
1088890581 11:114041137-114041159 GCAGGAGCCCTGGGAGGCCCTGG + Intergenic
1089190685 11:116651182-116651204 GCTGGAGGCATGGGAGGCTAAGG - Intergenic
1089607941 11:119652399-119652421 TCCGGTGGCCTGGGAGGCACTGG - Intronic
1089757089 11:120695135-120695157 GCTGGAGGTCAGGGAGCCTTGGG + Intronic
1089975612 11:122729133-122729155 CTGGGAGGACTGGGAGGCTCTGG + Intronic
1090306053 11:125692311-125692333 CCCGGCAGTCTGGGAGGCTGAGG + Intergenic
1090820485 11:130337450-130337472 GGCGCTGGTCAGGGAGGCTCAGG + Intergenic
1090849610 11:130560736-130560758 GCCAGAAGCGTGGGAGGCTCAGG + Intergenic
1091402210 12:188171-188193 GGCGCTGGTCGGGGAGGCTCGGG + Intergenic
1091696337 12:2630584-2630606 GCTGGAGGACTGAGGGGCTCTGG + Intronic
1092241712 12:6839886-6839908 GCTGGAGGTGGGGGTGGCTCTGG + Intergenic
1092472997 12:8794993-8795015 GGAGGGGGTGTGGGAGGCTCAGG - Intergenic
1092732488 12:11547518-11547540 CACGGAGGTGGGGGAGGCTCAGG - Intergenic
1092834179 12:12472485-12472507 GGCGGCGCTCGGGGAGGCTCAGG + Intergenic
1092834189 12:12472521-12472543 CACGGAGTTCGGGGAGGCTCAGG + Intergenic
1097645866 12:62234771-62234793 GGAGCAGGTCTGGGATGCTCCGG + Intronic
1099191420 12:79565216-79565238 GGCGGGGGTGGGGGAGGCTCAGG - Intergenic
1104373910 12:128247512-128247534 GTCGGGGGTGGGGGAGGCTCAGG - Intergenic
1104954218 12:132456617-132456639 GCCGAGGGTCTGTGAGCCTCAGG - Intergenic
1105071580 12:133236820-133236842 ACCTGTGGTCTGGGAGGCTGAGG - Intergenic
1106485793 13:30171458-30171480 GCGGGAGGCATGGGAGGCACCGG + Intergenic
1107078193 13:36346224-36346246 GCCCGAGGTCTGGAAGGCGCAGG - Intronic
1107445889 13:40470294-40470316 GACGGAGGTCTGGGGAGATCGGG - Intergenic
1107959640 13:45546596-45546618 GCCCCAGGTCTGGGAGGTTTTGG + Intronic
1108856498 13:54799775-54799797 GGCGCTCGTCTGGGAGGCTCGGG + Intergenic
1110673549 13:78210482-78210504 CCCAGCAGTCTGGGAGGCTCAGG - Intergenic
1110751367 13:79119727-79119749 CACGGAGGTGGGGGAGGCTCAGG + Intergenic
1113413803 13:110112634-110112656 GCCGTGGGGCTGGAAGGCTCTGG - Intergenic
1113960106 13:114121458-114121480 GGTGGAGGTAAGGGAGGCTCCGG - Intronic
1114065810 14:19059270-19059292 GCTGGAGGCCTGGGAGTCACAGG + Intergenic
1116940395 14:50785220-50785242 GCTGGAGATCCAGGAGGCTCTGG - Intronic
1118404629 14:65411910-65411932 GCTGGCGGTCTGGGCTGCTCTGG + Exonic
1118877017 14:69794411-69794433 GCTCCAGGTCTGGGTGGCTCCGG - Intronic
1119167626 14:72508177-72508199 CCTGGAGGTCAGGGAGCCTCTGG - Intronic
1119827496 14:77669555-77669577 CCCAGAGCTTTGGGAGGCTCAGG + Intergenic
1119921503 14:78450613-78450635 GAAGGAGCTCTGGGAGGCTGGGG + Intronic
1120429721 14:84399477-84399499 CACGGAGGGCGGGGAGGCTCAGG + Intergenic
1121310776 14:92933959-92933981 GCAGGTGCTCTGCGAGGCTCGGG - Intronic
1121336286 14:93079419-93079441 GGCCGAGGCCTGGGAGACTCAGG + Intronic
1121434841 14:93912227-93912249 CCAGGAGGTATGGGAAGCTCTGG + Intergenic
1122588299 14:102826451-102826473 GCTGGAGGTCGGGGGAGCTCAGG + Intronic
1122759672 14:104013670-104013692 GCCGGTTGTTTGGGAGGCTGAGG + Intronic
1122831900 14:104402272-104402294 GGCTGAGGTTTGGGAGCCTCTGG + Intergenic
1123112261 14:105878469-105878491 TCAGGGGGTCTGGGAGGCTAGGG - Intergenic
1202900629 14_GL000194v1_random:34527-34549 GCCGGGGGCCTGAGAGCCTCGGG - Intergenic
1123474738 15:20581798-20581820 GCCCGAGTTCTGCGAGGCTGGGG + Intergenic
1123643273 15:22418559-22418581 GCCCGAGTTCTGCGAGGCTGGGG - Intergenic
1123735599 15:23180061-23180083 GGCGGGGGTCTGGGCGGCTCGGG + Intergenic
1124286315 15:28403044-28403066 GGCGGGGGTCTGGGCGGCTCGGG + Intergenic
1124296388 15:28508592-28508614 GGCGGGGGTCTGGGCGGCTCGGG - Intergenic
1127847509 15:62884073-62884095 GCTTTAGGCCTGGGAGGCTCAGG + Intergenic
1128013849 15:64324541-64324563 GCCGAAGGCCTGAGAGCCTCTGG - Intronic
1129270029 15:74414727-74414749 GCTGCTGGTCTGGGAGGCACTGG + Exonic
1129319718 15:74767809-74767831 GCCTGGGGTCTGCTAGGCTCTGG + Intergenic
1129753897 15:78084391-78084413 GATGGAGGTCTGGGTGTCTCTGG + Intronic
1129966069 15:79736873-79736895 GCTGGGGCTCTGGGAGGCTCTGG - Intergenic
1131329074 15:91479684-91479706 CCCGGAGGTCAGGGAGGCCCAGG - Intergenic
1131396300 15:92089274-92089296 CCCAGAGCTCTGGGAGGCTGAGG - Intronic
1131892144 15:96984229-96984251 GGCGCTGGTCAGGGAGGCTCGGG + Intergenic
1132243681 15:100278889-100278911 GCCCGAGAGCAGGGAGGCTCAGG - Intronic
1132619339 16:856954-856976 GCCGAAGGTCGGGGAGGGTGTGG - Intronic
1132697425 16:1208149-1208171 GCCGAGAGTCTGGGAGGCTGGGG - Exonic
1133745061 16:8680080-8680102 GCTGGAGGTGGGGGAGGGTCGGG - Intronic
1134544462 16:15097009-15097031 GCCAGAGCTTTGGGAGGCTGAGG + Intronic
1135133439 16:19871031-19871053 GCCAGAGTTTTGGGAGGCTGAGG + Intronic
1135362025 16:21823188-21823210 GCCAGAGCTTTGGGAGGCTGAGG + Intergenic
1136260621 16:29072982-29073004 GCCAGAGCTTTGGGAGGCTGAGG - Intergenic
1136526152 16:30832232-30832254 CCCGGTGCTCTGGGAGGCTGAGG + Intergenic
1136582091 16:31158887-31158909 CCCAGTGGTCTGGGAGGCTGAGG + Intergenic
1136625506 16:31459584-31459606 GGCGGCGGCCGGGGAGGCTCTGG + Exonic
1137379075 16:47981163-47981185 GCTGAAGGTCTGTGAGGGTCTGG - Intergenic
1138007985 16:53355275-53355297 CCCAGCGGTCTGGGAGGCTGGGG + Intergenic
1139241875 16:65401455-65401477 CCCAGAGCTCTGGGAGGCTGAGG + Intergenic
1139671686 16:68496763-68496785 GGCGGAGGTCAGGAAGGCTTTGG - Intergenic
1139740823 16:69033675-69033697 GCGGGAGGTCCTGGAGGCCCTGG + Intronic
1139931082 16:70526622-70526644 CCTGGAGGTCTGGGTGGCTCAGG + Exonic
1141514149 16:84532032-84532054 GGCGGAGGTGTGGGTGGCGCCGG - Intronic
1142132111 16:88435877-88435899 GCCGGAGAGCTGGAAGTCTCGGG - Exonic
1142386607 16:89769252-89769274 GACAGAGGGCTGGGAGACTCTGG - Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142858966 17:2749568-2749590 GCCGGGGCTCCGGGGGGCTCGGG + Intergenic
1142958957 17:3540404-3540426 CGAGGAGGTCTGGGAGGCTGTGG - Intronic
1143323629 17:6084105-6084127 GGGGGAGGTCTGGGAGCCACTGG - Intronic
1143460476 17:7100648-7100670 GGCGCTGGTCGGGGAGGCTCGGG + Intergenic
1143460490 17:7100689-7100711 AGCGGGGGTCGGGGAGGCTCAGG + Intergenic
1144218085 17:13074515-13074537 GGCTGAGGACTGGGAGGCTGAGG - Intergenic
1144852015 17:18248621-18248643 CCCAGAGTTCTGGGAGGCACTGG - Exonic
1145999684 17:29123615-29123637 CCCGGAGATCTGGGAGCCACTGG - Intronic
1146057619 17:29589219-29589241 GCCGGAGGGCTGGGCGGGGCGGG - Intronic
1147006269 17:37406707-37406729 GCCCGAGGACTGGGAGGATGGGG - Intronic
1147238104 17:39072309-39072331 GCAGGAGGTCTGGGATGCTCAGG + Intronic
1147301297 17:39530642-39530664 GGTGGAGGTCCGGGGGGCTCAGG - Exonic
1147388076 17:40093337-40093359 ACCGGAGGTCTGCGAGGACCTGG + Exonic
1147425926 17:40345839-40345861 GCCGGAGGTGTGGGGAACTCCGG - Intronic
1147968973 17:44209598-44209620 CCTGGAGGTCGGGGAGGGTCAGG - Intronic
1148906929 17:50918033-50918055 GCAGGAGGTCTGGAAGGCGGGGG - Intergenic
1148911379 17:50944806-50944828 GCAGGAGCGCAGGGAGGCTCCGG - Intergenic
1149095743 17:52838347-52838369 GCCGAAGATCTGAGAGCCTCTGG + Intergenic
1149563888 17:57628257-57628279 CCTGGAGGTCTGGGAGTGTCAGG + Intronic
1149760039 17:59220777-59220799 GACGGAGGTGGGGGAGGCTGAGG + Intronic
1150414310 17:64975166-64975188 GCTGGAGGCCTGGGACGCTGTGG + Intergenic
1151383593 17:73741958-73741980 GGCAGAGGTTTGGGAGGCTGAGG - Intergenic
1152615236 17:81334760-81334782 GCCAGGGGTCAGGGAGGCTGGGG + Intergenic
1152622052 17:81369870-81369892 GTCGGAGGCCAGGCAGGCTCTGG - Intergenic
1152754866 17:82082991-82083013 GCTGGTGGTCTGGGTGGCTTCGG - Exonic
1152780821 17:82226779-82226801 GCCCAGGGTCTCGGAGGCTCTGG + Intergenic
1152784672 17:82241552-82241574 GCTGCAGGCCTGGGAAGCTCAGG + Intronic
1152899229 17:82930463-82930485 GCCTGAGGGGTGGCAGGCTCGGG + Intronic
1153052312 18:910596-910618 GCCCCAGGTCTGGGAAGCTGAGG + Exonic
1154255266 18:12776900-12776922 GGCGCTCGTCTGGGAGGCTCGGG + Intergenic
1154997591 18:21655587-21655609 GCCAGCAGTCTGGGAGGCTGAGG + Intronic
1155221440 18:23689595-23689617 GCTGCAGGTCCGGGAGGCGCAGG + Exonic
1155809997 18:30220245-30220267 GCTGGGGGTCTGGGGGGCTGGGG + Intergenic
1156025215 18:32645698-32645720 CCCAGAAGTCTGGGAGGCTGAGG - Intergenic
1156465438 18:37345643-37345665 GCTGAAGGCCTGGGAGGCTCTGG + Intronic
1160611492 18:80090757-80090779 GCAGGAGGAGTGGGAGGCTAAGG + Intronic
1160882093 19:1325531-1325553 GCCGTGGGCTTGGGAGGCTCAGG + Intergenic
1161135566 19:2617536-2617558 AGCGGAGGTCTGGGAGCCACGGG - Intronic
1161473720 19:4473406-4473428 GCAGGGTGTCTGGGAGGGTCTGG + Intronic
1161586717 19:5109667-5109689 GCTGAGGGTCTGGGAGGCTCAGG - Intronic
1161707793 19:5830132-5830154 GGCCGAGGTCCGGGAGGCCCCGG - Intergenic
1161783307 19:6307834-6307856 CCCAGAAGTCTGGGAGGCTGAGG + Intronic
1162119410 19:8453632-8453654 GCCCGTGGTCTGGGAGTCACTGG + Intronic
1162733800 19:12734609-12734631 GCCTCAGGGCCGGGAGGCTCCGG - Exonic
1163273668 19:16269137-16269159 GCAGGATGGCTGCGAGGCTCAGG + Intergenic
1163628120 19:18402389-18402411 TCCAGAGGTCTGGGAGTCTTGGG + Intergenic
1163628291 19:18403518-18403540 TCCAGAGGTCTGGGAGTCTTGGG + Intergenic
1163628325 19:18403614-18403636 TCCAGAGGTCTGGGAGTCTTGGG + Intergenic
1163628375 19:18403750-18403772 TCCAGAGGTCTGGGAGTCTTGGG + Intergenic
1163637611 19:18444715-18444737 GGCGGGGATCTGGGAGGGTCGGG - Exonic
1163688511 19:18725672-18725694 GCCAGAGAGGTGGGAGGCTCAGG - Intronic
1165307095 19:35009467-35009489 GCTGGAGGGCTGGGAGGACCGGG + Intronic
1165413312 19:35675805-35675827 GCAGGGGGTCAGGCAGGCTCGGG - Intronic
1165828840 19:38720501-38720523 GTGGGAGGCCTGGGAGACTCTGG - Intronic
1165858058 19:38891905-38891927 GCCGCAGGAGAGGGAGGCTCAGG + Intronic
1166060233 19:40321305-40321327 GCCGGAGGTACAGGAGGGTCGGG + Exonic
1166571041 19:43797611-43797633 GCAGGAGGACTGGGAGGAGCAGG + Exonic
1167430902 19:49453842-49453864 TCAGGAGGTCTGGGGTGCTCTGG - Intronic
1167438946 19:49497098-49497120 GCATGGGGTCTGGGAGGTTCTGG + Intronic
1167593454 19:50416234-50416256 GTCGGAGGTCACGGAGTCTCTGG - Intronic
1167625624 19:50586534-50586556 GCTGCAGGTCTGGCTGGCTCAGG - Intergenic
1167713051 19:51124204-51124226 GCAGGAGGTCTGGGAAACTGAGG - Intergenic
1168095847 19:54114557-54114579 TCAGGTGGTCTGGGCGGCTCAGG - Exonic
926388563 2:12363200-12363222 GCCGAAGGCCTGAGAGGCCCTGG - Intergenic
927670236 2:25062841-25062863 GCCGGAGGCCTAGGAGAGTCAGG - Intronic
928181842 2:29073508-29073530 GCAGGAAGTCAGGGAGGATCTGG - Exonic
928518256 2:32063886-32063908 GGCGGAGGCCTGGGAGGCACCGG - Exonic
929148270 2:38725960-38725982 CCCAGAGGTTTGGGAGGCTGAGG - Intronic
929775383 2:44928345-44928367 GCCGGGGGTCGGGGAGGCGGAGG - Intergenic
931253040 2:60550452-60550474 GCAGGAGGTGGGGGAGGCTCTGG + Intronic
931256241 2:60576402-60576424 GCTGGAGGTAAGGGAGCCTCTGG + Intergenic
934664915 2:96163452-96163474 GCCCAAGCTCTGGGAGGCTCTGG - Intergenic
936556696 2:113503079-113503101 CGCGGAGGGCTGGGAGGCGCGGG + Intergenic
937985853 2:127637769-127637791 ACAGGGGGCCTGGGAGGCTCTGG + Intergenic
938067409 2:128288738-128288760 CAGGGAGGCCTGGGAGGCTCAGG + Intronic
938097516 2:128473305-128473327 GAAGGAGGACTGGGAGGCCCAGG - Intergenic
938418738 2:131126128-131126150 GCCAGAGCTCTGGGAACCTCAGG + Intronic
941508509 2:166376467-166376489 GCCCAAGGTCGGGGAGGCGCTGG - Intergenic
942541755 2:177022323-177022345 GCCGGGGGTCTGGGCGGGTGGGG - Intergenic
943024247 2:182608704-182608726 GGCGCTGGTCGGGGAGGCTCCGG - Intergenic
945783733 2:214207932-214207954 GCCGAAGGCCTGAGAGCCTCTGG - Intronic
946248805 2:218401023-218401045 GTCGGAGGTCTGGGCGGGGCAGG + Intronic
947795252 2:232890325-232890347 GCTGGAGGCATGGGAGACTCAGG - Intronic
948806617 2:240455946-240455968 GGCGAAGGCCTGGGAGCCTCGGG - Intronic
948928608 2:241116061-241116083 GCTGGAGGACTGGGTGTCTCTGG - Intronic
1168914702 20:1476328-1476350 CCAGGAGGCCTGGGAGGCACAGG + Exonic
1170433142 20:16295265-16295287 GCCTGAGGTCTGTGGAGCTCTGG + Intronic
1170553133 20:17494294-17494316 GCCGCAGGCTTTGGAGGCTCAGG + Exonic
1170566579 20:17611297-17611319 GCCGGTGGCCTGGCAGACTCAGG + Intergenic
1170846952 20:19970209-19970231 TCCAGAGGTCTGGGAGGGACTGG - Intronic
1173596272 20:44260574-44260596 GCAGGAGATCAGGGAGGTTCTGG + Intronic
1175972604 20:62694302-62694324 GGGGGAGGTCCGGGAGGCCCCGG + Intergenic
1176384095 21:6128443-6128465 GCCGGAAGACTGTGAGGCTCAGG + Intergenic
1176426947 21:6553736-6553758 GGCGGTGGTGTGGGAGGCACAGG + Intergenic
1176620004 21:9049305-9049327 GCCGGGGGCCTGAGAGCCTCGGG - Intergenic
1178066347 21:28908510-28908532 GCGGGAGGCCAGGGAGGCTCAGG - Intergenic
1178196276 21:30348363-30348385 GCAGGAGGTCTGGCAGGGGCTGG + Intronic
1178198140 21:30371974-30371996 GCAGGAGGTCTGGCAGGGGCTGG + Exonic
1178200366 21:30396304-30396326 GCAGGAGGTCTGGCAGGGGCTGG - Exonic
1179702438 21:43162058-43162080 GGCGGTGGTGTGGGAGGCACAGG + Intronic
1179739379 21:43409801-43409823 GCCGGAAGACTGTGAGGCTCAGG - Intergenic
1180092903 21:45542038-45542060 GCCTGGGGTCTGGGGGGCCCTGG - Intronic
1180092928 21:45542098-45542120 GCCTGGGGTCTGGGGGGCCCTGG - Intronic
1180484291 22:15781862-15781884 GCTGGAGGCCTGGGAGTCACAGG + Intergenic
1180972573 22:19823024-19823046 GCAGGAGGCCTGGGAGGGGCCGG + Intronic
1181670627 22:24424073-24424095 CCGGGAGGACTGGGAGGCTGGGG + Intronic
1181695915 22:24592787-24592809 TCTGGGGGTCTGGGAGGCGCGGG - Intronic
1181732560 22:24858228-24858250 CCCAGAGGTTTGGGAGGCTGAGG - Intronic
1183162028 22:36120904-36120926 GCCGGAGGCCTGAGAGCCCCTGG + Intergenic
1183406007 22:37631012-37631034 TGCGGAGGCCTGGGGGGCTCTGG - Exonic
1184118805 22:42437477-42437499 GCCAAGGTTCTGGGAGGCTCGGG + Intergenic
1184254644 22:43280198-43280220 GCTGGAGGTCTGGGAGACCTGGG - Intronic
1184791631 22:46703785-46703807 GCAGGAGGTCTTGGAGGCGGTGG - Intronic
1184937663 22:47736810-47736832 GCCTGTGGTCAGGGAGGCCCTGG + Intergenic
1185334119 22:50263909-50263931 GCCGGAGATCTGAGGTGCTCTGG - Exonic
1185341024 22:50291179-50291201 GGAGGTGGTCAGGGAGGCTCAGG - Intronic
1185362349 22:50415913-50415935 GACTGAGTTCTGGGAGGTTCTGG - Intronic
950095045 3:10324172-10324194 GCCCGGGCTCTGGGGGGCTCTGG - Exonic
950185911 3:10945412-10945434 GCCTGAGCTCTGGGAGCCCCTGG + Intergenic
950431854 3:12955435-12955457 GCAGGGGGGCTGTGAGGCTCTGG + Intronic
950452570 3:13073448-13073470 GCGGGGGGTGGGGGAGGCTCCGG - Intergenic
950453468 3:13078767-13078789 GCCGGAGGTCTGGGCTGGGCAGG + Intergenic
952649429 3:35707338-35707360 GCTGCATGTCTGGGAGGGTCGGG + Intronic
953902090 3:46849209-46849231 GCTGGAGGTGTTGGAGACTCTGG - Intergenic
954148335 3:48645346-48645368 GTCAGAGGTCAGGGATGCTCAGG - Intronic
954216861 3:49129460-49129482 GCCTCAGGTCTGGGAGGCCAAGG - Intronic
954446480 3:50549625-50549647 GCCGGAGGTTAGGGAGGGTGAGG - Intergenic
954809847 3:53241096-53241118 GGCAGAGGCATGGGAGGCTCTGG + Intronic
957386487 3:79502528-79502550 GGCGCTCGTCTGGGAGGCTCAGG - Intronic
957404343 3:79757561-79757583 GCCCGAGCTTTGGGAGGCTGAGG + Intronic
958762847 3:98329115-98329137 GCAGGGGCTCTGGGAGGGTCTGG - Intergenic
960675693 3:120192756-120192778 GCCTCAGGTCTGGAAGGCTGTGG - Intronic
961087593 3:124082372-124082394 GCCTGAGCTATGGAAGGCTCTGG + Intronic
961462617 3:127062106-127062128 GCAGAAGCCCTGGGAGGCTCAGG - Intergenic
961808911 3:129510174-129510196 CCCAGTGCTCTGGGAGGCTCAGG - Intronic
962449762 3:135503243-135503265 GCCAGAGGACTCTGAGGCTCTGG - Intergenic
962919853 3:139940894-139940916 GCCAGAGGTGTGGGAGGTTCTGG + Intronic
964037583 3:152217608-152217630 GGCGCTGGTCGGGGAGGCTCTGG - Intergenic
966040796 3:175485521-175485543 GCTGCAGGTCTGAGAGCCTCTGG + Intronic
966861507 3:184233360-184233382 CCCGGAGGCCTGGGGGGCCCCGG - Exonic
967867756 3:194204211-194204233 GCCCGGGGTCTCGGAGGCTCGGG + Intergenic
968317421 3:197736592-197736614 GCCGGAGCCCCGGGAGGCTTGGG - Intronic
968450675 4:674677-674699 GCCTGAGGTCAGGGCGGCTCGGG + Intronic
968640345 4:1711694-1711716 GCAGCAGGCCTGGGAGGCGCTGG - Intronic
969405306 4:6987420-6987442 GCCGCAGGGCTGGCAGGCCCAGG - Intronic
969605299 4:8199399-8199421 GCCGCAGGTATGGGGGGCTCCGG + Exonic
969685660 4:8672612-8672634 GTCGGAGGCCAGGGAGTCTCAGG + Intergenic
970194690 4:13542651-13542673 AGCGGAGGTCTGGGAGGCCCTGG + Intronic
971790737 4:31167274-31167296 GCCGAAGGTCTGAGAGCCCCTGG + Intergenic
972621221 4:40749995-40750017 GCCCGGGGTCTGGCTGGCTCAGG - Exonic
973736438 4:53876053-53876075 GTCGGAAGTCTGGGAGCCTTGGG - Intronic
975120491 4:70722802-70722824 GGGGGAGGGCTGGGAGGATCAGG + Intronic
979703969 4:123698645-123698667 TCTGGTGGTCTGGGAAGCTCGGG + Intergenic
979888245 4:126059461-126059483 GCCAAAGGTCTGAGAGCCTCTGG + Intergenic
980489457 4:133506206-133506228 GTCGGAGGTGTGGGTGGCACAGG - Intergenic
982863412 4:160482030-160482052 GGGGGAGGGGTGGGAGGCTCAGG - Intergenic
985587457 5:748292-748314 GCCCCAGGTGTGGGGGGCTCAGG + Intronic
985801219 5:2006401-2006423 GCTTGAGGTCTGGCAGGCTGAGG + Intergenic
989170201 5:38466015-38466037 GCTGGTGACCTGGGAGGCTCAGG + Intergenic
990323148 5:54649111-54649133 GCGGGGGGTGGGGGAGGCTCAGG + Intergenic
994647735 5:102491480-102491502 CACGGAGGTGGGGGAGGCTCAGG + Intronic
995733000 5:115265459-115265481 CCCGGAGGCCCGGGGGGCTCTGG - Intergenic
996082785 5:119273762-119273784 GCGTGAGGTCCGGGAGGCCCAGG + Intronic
996847480 5:127915887-127915909 GCTGAAGGTCTGGGGGGCTGTGG + Intergenic
998134605 5:139668150-139668172 CCCAGAGGTCTGGGAGGCGGAGG - Intronic
998228574 5:140345186-140345208 GCAGGAGAGCTGGCAGGCTCTGG + Intronic
1001692516 5:173643689-173643711 GCCACAGGTCTGGGGGCCTCTGG + Intergenic
1002180750 5:177429914-177429936 GACCCAGCTCTGGGAGGCTCAGG + Intronic
1002796324 6:473917-473939 GCCCTAGGCCTGGGAGGCTGTGG - Intergenic
1002833148 6:842380-842402 GCCGGAGGGCGGGGAGCTTCTGG - Intergenic
1002897028 6:1385189-1385211 CCCGGAGGTCTGGGGGTTTCTGG + Intergenic
1003224437 6:4191380-4191402 GCAGGAGGGCGGGGAGGCTCAGG + Intergenic
1004438588 6:15623431-15623453 GCCAGAGCTTTGGGAGGCTGAGG + Intronic
1005198471 6:23316108-23316130 GCTTGAGGTCTGTGAGGTTCAGG + Intergenic
1005348272 6:24910899-24910921 GCCGGAGGTGCGGGCAGCTCCGG - Intronic
1005585563 6:27273197-27273219 TCCGGAGATCTTGGAGCCTCAGG - Intergenic
1005945259 6:30590647-30590669 GCGGGAGGTGTTGGAGGCCCTGG + Exonic
1006258988 6:32853128-32853150 CCCGGCGGTCAGGGCGGCTCTGG - Exonic
1006391603 6:33761979-33762001 CACAGAGGGCTGGGAGGCTCAGG + Intergenic
1007298650 6:40848809-40848831 GCCTCAGGCCTGTGAGGCTCTGG - Intergenic
1007482821 6:42161321-42161343 GCTGGAGGGCTGTGAGGCTGGGG + Intronic
1009004396 6:57765037-57765059 GCCTGTAGTCTGGGAGGCTGAGG + Intergenic
1012158294 6:95848898-95848920 GCCGAAGGCCTGAGAGCCTCTGG + Intergenic
1012352499 6:98269953-98269975 GCCTGTAGTCTGGGAGGCTGAGG - Intergenic
1012892228 6:104908987-104909009 GCCTGAGCTCTGGGCAGCTCAGG + Intergenic
1013048815 6:106512361-106512383 GCCGTAGGTCGGGGAGGCGGAGG + Exonic
1015572205 6:134633596-134633618 GGCGCTCGTCTGGGAGGCTCAGG + Intergenic
1016825212 6:148382245-148382267 GGCGGAGATCTGGCGGGCTCTGG - Intronic
1019049492 6:169172155-169172177 TCCGGAGGTCTGGGAAGCACTGG + Intergenic
1019060539 6:169254680-169254702 GCCTGAGGTGTGGGAGGGGCGGG - Intergenic
1019445008 7:1066636-1066658 GCTGGTGGTCTGGGAGCCTCTGG - Intronic
1019494103 7:1329570-1329592 GCTGGGGGCCTGGGAGGCTGGGG + Intergenic
1019620623 7:1990195-1990217 GCCAGGGTTCTGTGAGGCTCTGG - Intronic
1019623448 7:2003593-2003615 ACCAGAGGCTTGGGAGGCTCAGG - Intronic
1019689484 7:2402675-2402697 CCCAGAGCTCTGGGAGGCTGAGG + Intergenic
1020260255 7:6526889-6526911 GGCGGAGGGCTGGGGGGATCGGG + Intronic
1020367822 7:7399289-7399311 GGCTGAGGTCAGGGAGGATCAGG - Intronic
1021518616 7:21515670-21515692 CCCGGAGCTTTGGGAGGCTGAGG + Intergenic
1023379848 7:39596321-39596343 GCAGGAGAACTGGGAGGCTGAGG - Intronic
1023394618 7:39741390-39741412 TCCAGAGGTTTGGGAGGCTGAGG - Intergenic
1024655537 7:51448465-51448487 GCCGGAGTTCTGCAAGGCACAGG + Intergenic
1024690003 7:51789803-51789825 GAAGGAAGTGTGGGAGGCTCAGG + Intergenic
1024691327 7:51806142-51806164 GGCGGTCGTCGGGGAGGCTCGGG - Intergenic
1025022097 7:55488271-55488293 GCCTGAGGTCTGTGAGACCCAGG - Intronic
1025638934 7:63349603-63349625 ACTGGAGGTCTGGGAAGGTCTGG + Intergenic
1025643765 7:63398489-63398511 ACTGGAGGTCTGGGAAGGTCTGG - Intergenic
1026096033 7:67347207-67347229 GCCAGTACTCTGGGAGGCTCAGG + Intergenic
1026596517 7:71738132-71738154 GGCGCTCGTCTGGGAGGCTCGGG + Intergenic
1026725801 7:72869089-72869111 GCCAGCAGTCTGGGAGGCTGGGG - Intergenic
1028229744 7:88292311-88292333 GTAAGAGGTCTGAGAGGCTCAGG + Intronic
1029552464 7:101244741-101244763 GTCTGAGGTGTGGGGGGCTCAGG + Intronic
1030102094 7:105955862-105955884 GGCGCTGGTCGGGGAGGCTCAGG + Intronic
1030215688 7:107042414-107042436 GGCGGTCGTCGGGGAGGCTCGGG + Intergenic
1031046423 7:116893377-116893399 CCCAGAGCTCTGGGAGGCTGAGG - Intronic
1032786982 7:135208734-135208756 TCCTGAGGTCTGGGTGCCTCAGG + Intronic
1034345560 7:150383496-150383518 GCAGGAGGGCAGGGAGGCGCTGG + Intronic
1036129409 8:6094707-6094729 CCCAGAGCTCTGGGAGGCTGAGG - Intergenic
1036356219 8:8045657-8045679 TCCTGTGGCCTGGGAGGCTCAGG - Intergenic
1037681162 8:21098709-21098731 GCAGGAGGATTGGGAGGCTGAGG + Intergenic
1038540352 8:28385877-28385899 TCCGGGGGTCTGGGAGGCCGGGG - Intronic
1039574439 8:38612019-38612041 CCCAGAGCTCTGGGAGGCTGAGG + Intergenic
1039875111 8:41578374-41578396 GCCTGCGGTCTGGGACGCCCCGG + Intronic
1039920618 8:41891724-41891746 TCTGGAGCTCTGGGAGGCGCCGG - Intronic
1046954565 8:120049708-120049730 ACTGGAGGGCTGGGAGGCCCAGG - Exonic
1047493777 8:125395328-125395350 GCTGGAGGCTTGGGAGCCTCTGG + Intergenic
1049377206 8:142294978-142295000 CCCGGAGTCCTGGGAGGCTCGGG + Intronic
1049654761 8:143792638-143792660 GCCGGAGGGCAGGGTGGGTCAGG + Intronic
1049798474 8:144507044-144507066 TCAGGAGCCCTGGGAGGCTCTGG + Exonic
1049961552 9:742432-742454 GCCAGGGGTCTGGGGGACTCTGG + Intronic
1054764426 9:69031648-69031670 GCTGGAAGACTGGGAGGCTGGGG + Intergenic
1056505511 9:87254415-87254437 GCCTGGGGCCGGGGAGGCTCAGG - Intergenic
1056538927 9:87554818-87554840 ACCGGAGGTCTGAGAGTGTCAGG + Intronic
1059285246 9:113166711-113166733 GCTAGAGGTGTGGGAGGCTGTGG - Intronic
1059330682 9:113533669-113533691 GAAGCAGGGCTGGGAGGCTCGGG + Intronic
1059378901 9:113908097-113908119 TCCTGAGAACTGGGAGGCTCGGG + Intronic
1059715759 9:116911777-116911799 GCCTGTTGTCTGGGAGGCTGAGG + Intronic
1059758100 9:117312638-117312660 GCCTGAGGTTTGGGATTCTCTGG + Intronic
1060224610 9:121783315-121783337 GCCAGAGATCTGGGCGGATCTGG + Intronic
1060739961 9:126091585-126091607 ACCTGAGCTCTGGGAGGCCCTGG + Intergenic
1061231931 9:129320356-129320378 GCCCGAGCTCTGGGGGGCCCGGG + Intergenic
1061620483 9:131808367-131808389 GCCAGCGGTTTGGGAGGCTGAGG - Intergenic
1061860292 9:133464452-133464474 GCCTGGTGTGTGGGAGGCTCGGG + Intronic
1062035979 9:134382725-134382747 GCCGGGTCTCTGGGAGGCCCTGG + Intronic
1062261804 9:135666623-135666645 GGCGTATCTCTGGGAGGCTCAGG - Intergenic
1062289862 9:135789646-135789668 CCAGGAGGTCTGGAAGCCTCTGG + Intronic
1062335156 9:136061696-136061718 ATCGGAGGTCTAGCAGGCTCAGG + Intronic
1062532756 9:137009110-137009132 GCTGTAGGGCTGGGAGGCTGGGG - Intronic
1203566901 Un_KI270744v1:99752-99774 GCCGGGGGCCTGAGAGCCTCGGG + Intergenic
1185778985 X:2829378-2829400 GGCGTAGGGCTGGGAGGCTTGGG + Intronic
1185826589 X:3257052-3257074 GCCGAAGGCCCGAGAGGCTCTGG + Intergenic
1185831030 X:3303276-3303298 GACAGAGGACTGGGAGGCTGAGG + Intergenic
1186180097 X:6965225-6965247 GCCGAAGGTCAGAGAGGCTCTGG + Intergenic
1187759232 X:22561679-22561701 CCCAGAGCTCTGGGAGGCTGAGG + Intergenic
1188769003 X:34130585-34130607 TCTGGAGCTTTGGGAGGCTCCGG + Exonic
1188769220 X:34131620-34131642 ACCGGAGTCTTGGGAGGCTCCGG + Exonic
1189007213 X:37009008-37009030 ACCGGAGTCTTGGGAGGCTCCGG - Exonic
1189007566 X:37010628-37010650 ACCCGAGGCTTGGGAGGCTCTGG - Exonic
1189040870 X:37541756-37541778 ACTGGAGCTTTGGGAGGCTCTGG + Intronic
1189041289 X:37543719-37543741 ACCGGAGTCTTGGGAGGCTCCGG + Intronic
1189327728 X:40123034-40123056 CTCGGAGGCCTGGGAGTCTCGGG + Intronic
1190916867 X:54817540-54817562 GTCGGTGGTCTGGGAGGCCAGGG + Intergenic
1195909583 X:109875984-109876006 CACGGAGGGCGGGGAGGCTCAGG + Intergenic
1197497900 X:127208473-127208495 GCCTGAGGCCTGAGAGGCCCTGG + Intergenic
1197749221 X:129953288-129953310 GCCGGAGGTCTGGGGAGTTCGGG + Intergenic
1200051001 X:153431674-153431696 GCCTGAACTCTGGGAGGCTGGGG + Intergenic
1200086943 X:153611617-153611639 GCCAGAGGTCTGAGGGGGTCCGG - Intergenic