ID: 908689076

View in Genome Browser
Species Human (GRCh38)
Location 1:66756863-66756885
Sequence TACCCCATGGGGAAGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908689076_908689085 22 Left 908689076 1:66756863-66756885 CCATGTTGCTTCCCCATGGGGTA No data
Right 908689085 1:66756908-66756930 CTCTTCTTACACTATTCCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908689076 Original CRISPR TACCCCATGGGGAAGCAACA TGG (reversed) Intronic
No off target data available for this crispr