ID: 908689762

View in Genome Browser
Species Human (GRCh38)
Location 1:66765516-66765538
Sequence GACATGCCTTGTGTTTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908689761_908689762 2 Left 908689761 1:66765491-66765513 CCATCTCTAACTGTCATAATAAA No data
Right 908689762 1:66765516-66765538 GACATGCCTTGTGTTTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908689762 Original CRISPR GACATGCCTTGTGTTTATCT AGG Intronic
No off target data available for this crispr