ID: 908690628

View in Genome Browser
Species Human (GRCh38)
Location 1:66775596-66775618
Sequence AAGTGGATTAGGAGCCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908690623_908690628 16 Left 908690623 1:66775557-66775579 CCATTTCACTGGAAACGCAGGTA 0: 1
1: 0
2: 1
3: 11
4: 96
Right 908690628 1:66775596-66775618 AAGTGGATTAGGAGCCAGGATGG 0: 1
1: 0
2: 0
3: 26
4: 281
908690620_908690628 29 Left 908690620 1:66775544-66775566 CCGAGCTTGCTTACCATTTCACT 0: 1
1: 0
2: 2
3: 16
4: 183
Right 908690628 1:66775596-66775618 AAGTGGATTAGGAGCCAGGATGG 0: 1
1: 0
2: 0
3: 26
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908690628 Original CRISPR AAGTGGATTAGGAGCCAGGA TGG Intronic
900426627 1:2583260-2583282 AAGTGATCTAGGAACCAGGAAGG + Intergenic
900553358 1:3267892-3267914 AAGTGGAATCCAAGCCAGGATGG + Intronic
901714765 1:11144553-11144575 AAGTTGAGTAAGAGCCAGGGTGG + Intronic
901929095 1:12585615-12585637 AGGGGGAAGAGGAGCCAGGAAGG - Intronic
903417258 1:23192346-23192368 AAGAGAATTTGGAGCCAGGATGG - Exonic
908263155 1:62354240-62354262 CACAGGATTAGGAGGCAGGAAGG + Intergenic
908690628 1:66775596-66775618 AAGTGGATTAGGAGCCAGGATGG + Intronic
909408128 1:75316030-75316052 ATGTGGATTAGGGGCCAAAAAGG - Intronic
912692901 1:111818194-111818216 GAGGGGATTTGGAGCAAGGATGG + Intronic
912998710 1:114557681-114557703 AAGTGATGTAGGAGCCAGGCAGG - Intergenic
913462806 1:119105920-119105942 AAGTGTATTAGGAGGGAGGGTGG + Intronic
914385202 1:147162473-147162495 AAGTAGATGAGGAGGAAGGATGG + Exonic
914876213 1:151514147-151514169 ATGTGGATCAGGGGCCAGGAGGG - Intronic
916282267 1:163064714-163064736 AAGAGGAGTAAGAGGCAGGAGGG + Intergenic
917452458 1:175158311-175158333 CATTGGATTAGGAGACAGCAGGG + Intronic
917491225 1:175500366-175500388 AAGTGGATTTGGGGCCTGGGAGG + Intronic
922578943 1:226682775-226682797 AAGTGGTATAGGAGACAGGCAGG + Intronic
922656463 1:227388776-227388798 AAGAAAATTAGGAGCCAGGAGGG - Intergenic
923160776 1:231312783-231312805 AACTGCATAAGGAGCCTGGAGGG + Intergenic
924657452 1:245985862-245985884 AAGTGGAATGAGAGCCAGAAAGG - Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1066436192 10:35398304-35398326 AAGTGGCTTAAAAGCCAGCAAGG + Intronic
1066930197 10:41749401-41749423 TAGTGGAGGAGGAGCCAAGATGG + Intergenic
1067036883 10:42927490-42927512 AACTGCATTTGCAGCCAGGATGG + Intergenic
1067749641 10:48962280-48962302 AAGTGGCTTTGGAGCCAAGAAGG - Intronic
1067795551 10:49318881-49318903 AAGGGGATGTGGAGCCAGGCAGG + Intronic
1068987227 10:63118588-63118610 AGGAGGAAAAGGAGCCAGGATGG - Intergenic
1069266045 10:66459026-66459048 AAGTGGAAGGGGAGGCAGGAGGG - Intronic
1069870849 10:71532068-71532090 AAGCTGTTTGGGAGCCAGGAAGG + Intronic
1070380722 10:75878355-75878377 AGGTGGATGGGGAGCCAGAAGGG + Intronic
1073104988 10:101027397-101027419 AAGTGGTGTCTGAGCCAGGAGGG - Intronic
1074160765 10:110834762-110834784 CACTGGATTAGGAGACAGAAGGG - Intronic
1074738715 10:116463670-116463692 AAATGGGTGAGGACCCAGGAAGG + Intronic
1076244529 10:128936115-128936137 ACTTGGATAAGCAGCCAGGAAGG - Intergenic
1076408828 10:130231603-130231625 GAGTGGAGTCGGAGCCAGGCTGG - Intergenic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077810798 11:5634551-5634573 CAAGGGATTAGGAGCCAGTAGGG - Intronic
1078108613 11:8374078-8374100 AACTGGATTTGGAGGCAGCAAGG - Intergenic
1078156822 11:8806943-8806965 AAGTGGAGAAGGGGCCAGGAGGG - Intronic
1078748698 11:14139764-14139786 AAGAGGATTAGGAGTAGGGAGGG + Intronic
1079176981 11:18151335-18151357 ATGTGGATTAGAACCCAGCAGGG - Intronic
1080907171 11:36557619-36557641 AAGTTGAGGAGGAGCCAAGATGG - Intronic
1081296552 11:41397249-41397271 AGGTGGAAGAGGAGGCAGGAGGG - Intronic
1081658716 11:44874783-44874805 AAATGGATCAGGAGCCAGCCTGG - Intronic
1082152011 11:48750697-48750719 AAGTGGGGGAGGAGCCAAGATGG - Intergenic
1082789839 11:57339453-57339475 GAGTTGCTTAAGAGCCAGGAAGG + Intronic
1084464342 11:69313430-69313452 AAGTGGGTTGGGGGCCATGAAGG + Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085410781 11:76289146-76289168 AAGGGGAAGAGGAGGCAGGAAGG + Intergenic
1086786189 11:90972284-90972306 AACTGGAGGAGGAGCCAAGATGG - Intergenic
1089077032 11:115746403-115746425 AAGCGAAATAGGAGCCCGGATGG - Intergenic
1089738273 11:120564489-120564511 AAGGGTCTTAGGACCCAGGAAGG + Intronic
1090719488 11:129458812-129458834 GAGTGGAAAAGGAGGCAGGAAGG - Intergenic
1091941164 12:4483804-4483826 AAGAGGATTAGATGCTAGGAAGG - Intergenic
1092196448 12:6552380-6552402 AAGGGGGCTGGGAGCCAGGAAGG - Intronic
1093348951 12:18072629-18072651 AAATGGATGGGGAGCCAGAAGGG + Intergenic
1094417693 12:30234951-30234973 ATGTGTATTAGGAGCCAGTGAGG + Intergenic
1094861400 12:34470176-34470198 AAATGGAGGAGGAGCCAAGATGG - Intergenic
1095853738 12:46838765-46838787 AAGGGGAGTAGGAGGCAGAATGG - Intergenic
1096461326 12:51822575-51822597 AAGTGTATTTGGTGCCTGGAGGG - Intergenic
1097328362 12:58305014-58305036 GAGGAGATTAGGAGCCAGGGTGG + Intergenic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1099959162 12:89380297-89380319 ATGGAGTTTAGGAGCCAGGAGGG + Intergenic
1100478122 12:94952743-94952765 GAATGGATGAGGAGCCAGAAAGG - Intronic
1101502851 12:105320216-105320238 CAGTGGATTCGTAGGCAGGAGGG + Intronic
1102594704 12:113983595-113983617 CAGTGGTTCAGGAACCAGGATGG - Intergenic
1106118002 13:26833471-26833493 AAGCGGGGCAGGAGCCAGGAAGG + Intergenic
1107066335 13:36217480-36217502 AAGTGAATTAGCAGCTGGGAAGG - Intronic
1107186420 13:37527157-37527179 AAGTGGTTTACTAGCCTGGAAGG + Intergenic
1107359646 13:39603945-39603967 AAATTGATCAGGAGGCAGGATGG - Intergenic
1108147522 13:47495262-47495284 AAGTGGATTAGGAAGGATGAAGG + Intergenic
1109134000 13:58624945-58624967 GACTGGCTGAGGAGCCAGGAGGG + Intergenic
1111184860 13:84720428-84720450 AGGTGGATGGGGAGCCAGGAGGG - Intergenic
1112210983 13:97376857-97376879 AATTGGAATAGGAGCCCAGATGG + Intronic
1112855020 13:103757888-103757910 AGGTGGAGGAGGAGGCAGGAGGG - Intergenic
1112929243 13:104714029-104714051 AAATGGATGGGGAGCCAGAAGGG - Intergenic
1114401196 14:22412393-22412415 TAGTGGAGGAGGAGCCAGCAAGG - Intergenic
1115186248 14:30690819-30690841 AAGTGGGCGAGGAGCCAAGATGG - Intronic
1116695980 14:48178914-48178936 AAGAGGATTAGTAGACATGATGG - Intergenic
1118867538 14:69715262-69715284 AAGAGGTGGAGGAGCCAGGATGG + Intergenic
1119405375 14:74395453-74395475 GAGTGGATTTGGAGCCTGTAGGG + Intergenic
1119657314 14:76426231-76426253 GAGAGGAATAGGAGACAGGAGGG + Intronic
1120292043 14:82587632-82587654 AACTGGAGTATAAGCCAGGAAGG - Intergenic
1120678493 14:87451039-87451061 AAGTGGAAGAGTGGCCAGGATGG - Intergenic
1120863372 14:89274896-89274918 AAGAGGACTTTGAGCCAGGAAGG + Intronic
1122035337 14:98945099-98945121 AAGAGGAGGAGGAGGCAGGATGG + Intergenic
1124391910 15:29267007-29267029 AAGGGGACCAGGAGGCAGGAAGG + Intronic
1125423480 15:39527421-39527443 AAGTGGAAGGGGAGGCAGGAGGG - Intergenic
1125587581 15:40831994-40832016 AACTGGCCTAGGAGCCAGCAGGG + Intergenic
1126003936 15:44238802-44238824 AAGTGCAAGAGAAGCCAGGAAGG + Intergenic
1126231048 15:46325486-46325508 AACTGGGTAAGTAGCCAGGAAGG + Intergenic
1128859372 15:71052861-71052883 AAGTGGATTAGGAACGACCATGG - Intronic
1128946081 15:71822243-71822265 AGTTGGAGTGGGAGCCAGGATGG + Intergenic
1129451895 15:75655827-75655849 AAGAAGATTAGGAGCAGGGAAGG - Intronic
1129671049 15:77607802-77607824 AGGTGGGTTGGGGGCCAGGATGG + Intergenic
1130144071 15:81259304-81259326 ATGTGGATAGGGAGCCTGGAAGG - Intronic
1130510714 15:84587064-84587086 AAGTTGATTATGAGAGAGGATGG - Intergenic
1131242337 15:90757659-90757681 AAATGGTTTACAAGCCAGGAAGG - Intronic
1131375583 15:91920354-91920376 AATTGCAGCAGGAGCCAGGAAGG + Intronic
1131847181 15:96500491-96500513 AATTGGAATAGGAGGCAGAAGGG - Intergenic
1132403896 15:101530731-101530753 ATGTGGATTACAAGCCTGGAAGG + Intergenic
1133681823 16:8126926-8126948 GAGGGGATAAGGATCCAGGAGGG + Intergenic
1134307888 16:13049764-13049786 AAGTGGAGGTGGAGGCAGGAGGG - Intronic
1134383690 16:13751906-13751928 CAATGGATGAGGAGCCAGCATGG - Intergenic
1135229637 16:20693711-20693733 AAGTGGAGAAGCAGGCAGGAGGG - Intronic
1135695575 16:24583298-24583320 AAATGGATTAGGAGTCAGAATGG - Intergenic
1136061354 16:27728807-27728829 AAGTGGACTCAGAGCCAGCATGG + Intronic
1136456668 16:30383518-30383540 AAGTGGACCAGAAGCCATGATGG + Intronic
1137705665 16:50534162-50534184 AAGAGGTGTAGAAGCCAGGATGG + Intergenic
1138874700 16:60935929-60935951 AAGTGGATTTGAAGCAAGTAGGG + Intergenic
1139967513 16:70754022-70754044 GAATGGATTGGGGGCCAGGAGGG - Intronic
1140748138 16:77999140-77999162 AAGTGGATGGGCAGCCAGAAGGG + Intergenic
1140948071 16:79789509-79789531 AATTAGATTAGGTGACAGGAAGG - Intergenic
1142112458 16:88339715-88339737 AAGGGGATGAGGAGACAGGATGG + Intergenic
1143299854 17:5901258-5901280 AAGTGAATCAGGAGACAGGCTGG - Intronic
1143734303 17:8899676-8899698 AAGTGGAGAAAGAGCTAGGATGG - Intronic
1143769430 17:9158590-9158612 CAGTGGACCAGGAGCCAGAAGGG + Intronic
1144351043 17:14396653-14396675 AGGTAGTTTAGGAGACAGGAAGG + Intergenic
1144579612 17:16450945-16450967 AAGTGGGTGAGAAGGCAGGAGGG + Intronic
1146800087 17:35811938-35811960 AAATGAAGTAGGAGCCAGCATGG + Intronic
1147146117 17:38485503-38485525 AATTGGGTTAAGCGCCAGGAAGG + Intronic
1150901420 17:69282289-69282311 CAGTGGAGAAGGAGCCAAGAGGG - Intronic
1152466905 17:80471654-80471676 AAGGGGAAGAGGAGCAAGGAGGG - Intronic
1155400816 18:25437330-25437352 AAGTGGAATAGAAGCGTGGAGGG - Intergenic
1155607879 18:27628555-27628577 AAGTAGATTACAAGCCAGTAAGG + Intergenic
1155825543 18:30437736-30437758 TGGTGGATTAGCACCCAGGATGG + Intergenic
1156418690 18:36926921-36926943 AAGGTGATGGGGAGCCAGGACGG + Intronic
1156635842 18:39028706-39028728 AAGTGTATAAGAAGCCAGGCAGG - Intergenic
1157637708 18:49177185-49177207 GAGTGCAAGAGGAGCCAGGATGG + Intronic
1158965833 18:62621584-62621606 AAGTAGAAAAAGAGCCAGGAAGG + Intergenic
1159126714 18:64232457-64232479 AACAGGAATAGGAGCCAAGATGG - Intergenic
1160863062 19:1245739-1245761 AAGTGGAGGGGGAGCCAGGCAGG - Intergenic
1161434852 19:4257115-4257137 AAGTGGCTTTGGAGCCAGGCAGG - Intronic
1164030190 19:21396774-21396796 CAAAGGACTAGGAGCCAGGAAGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165294070 19:34911980-34912002 AAGTGGAGTAGGTGACAGCAAGG + Intergenic
1167786889 19:51644537-51644559 AAGTGGGATAGGAGGCAGGGAGG + Intronic
926902115 2:17763519-17763541 CAGTGGATTAGGAGGAAGCAGGG - Intronic
927092922 2:19726254-19726276 AAGGGGCTTAGGAGGCAAGAGGG + Intergenic
927968363 2:27286890-27286912 AAGTGGTTGAGGAGGCAGGCTGG - Intronic
929557764 2:42936258-42936280 AATTGGGTCTGGAGCCAGGAAGG - Intergenic
931923792 2:67048883-67048905 AAGTGCATGAGGAGCCTTGAAGG - Intergenic
934833478 2:97558333-97558355 AAGAGGATTATCAGGCAGGAAGG - Intronic
935977052 2:108588434-108588456 AATAAGAGTAGGAGCCAGGAGGG + Intronic
936655649 2:114483677-114483699 AATTTCATTAGAAGCCAGGATGG + Intronic
938321966 2:130371949-130371971 AAGTGGCATAGAAGACAGGAAGG - Intronic
938379258 2:130827412-130827434 CAGTGGAGGAGGAGCCACGAAGG - Intergenic
938631799 2:133175776-133175798 AATTGGGTTAGGAGCCACCATGG + Intronic
941331838 2:164186934-164186956 ATGTGGAATAGCACCCAGGAAGG + Intergenic
941421795 2:165291738-165291760 AAGTGGAGTTGGAGCTGGGAAGG - Intronic
941956203 2:171207372-171207394 AAGTGCATTAGCAGGAAGGAGGG + Intronic
941985258 2:171504438-171504460 TGGTGGATTAGCAGCCAAGATGG - Intergenic
942241571 2:173967103-173967125 AAGTGGACTGGGAGGGAGGAAGG + Intergenic
943468481 2:188261944-188261966 ATGGGAATTATGAGCCAGGAAGG - Intergenic
947634730 2:231674222-231674244 ACGTGGATGTGGAGCCAGGTAGG - Intergenic
948292897 2:236840620-236840642 AAGTGGAGTTGGAGCCTGGATGG + Intergenic
948932108 2:241138531-241138553 GAGAGGATGAGGAGCCTGGAGGG - Intronic
949061329 2:241959591-241959613 AAGTGCAGTAGGAGACAGAATGG + Intergenic
1169526845 20:6437676-6437698 AAGTGGATGGGGAGCGAGGTTGG + Intergenic
1171007289 20:21478993-21479015 ACGGGGTTTAGTAGCCAGGATGG + Intergenic
1171203238 20:23258350-23258372 AAGTGGCTTAGGAGTGAGCAGGG - Intergenic
1172292268 20:33784509-33784531 AGGTGGATCAGGGGCCAGGAAGG - Intronic
1173869151 20:46330827-46330849 GTGTGGATTAGGAGCCATCACGG - Intergenic
1174523699 20:51154910-51154932 AAGTGGACTAAGAGTGAGGAAGG - Intergenic
1177665226 21:24147946-24147968 AAGAGGATAAGGAGAAAGGAGGG - Intergenic
1177972475 21:27807695-27807717 TACTGGACTAGTAGCCAGGATGG + Intergenic
1180634447 22:17253271-17253293 AAAAGGATTAGCAGCAAGGATGG + Intergenic
1181106057 22:20576393-20576415 AAGTGGAGGCTGAGCCAGGATGG + Intronic
1181752337 22:24997499-24997521 AAGTGAGTTAGGAGCTGGGAGGG + Intronic
1182620531 22:31616190-31616212 AAGGGGATGAGGGGACAGGAAGG + Intronic
1184402435 22:44281870-44281892 AACTGAGTTAGGAGCCAGCAGGG - Intronic
949879430 3:8649865-8649887 AAGTGATTTTGCAGCCAGGAAGG - Intronic
950095376 3:10326405-10326427 ATGTTCATTCGGAGCCAGGAGGG - Exonic
952002983 3:28808605-28808627 ATGTGGATAGGGAGCCAGAAGGG + Intergenic
952003335 3:28810853-28810875 AGGTGGATAGGGAGCCAGGAGGG + Intergenic
952585097 3:34882909-34882931 AAGTAGATGAGGGGCCAGGAGGG + Intergenic
953134357 3:40169984-40170006 AAGTGGAAGAAGAGCCAGGATGG + Exonic
953360053 3:42288059-42288081 AATTGGAGGAGGAGCCAAGATGG - Intergenic
954080258 3:48209440-48209462 AGCTGGATGAGGAGACAGGAGGG - Intergenic
954213379 3:49110911-49110933 AAGTAGATAAGGGGGCAGGATGG - Intronic
954432214 3:50476840-50476862 AGGTGGATTGTGAGGCAGGATGG - Intronic
954924519 3:54220690-54220712 AAGTGGTTCAGTAGCCAGGGAGG - Intronic
956515193 3:70038919-70038941 AAGTGGTTTAGGAGCCAGTCCGG + Intergenic
957301764 3:78400579-78400601 AAAAGGATTAGGAGACAGTATGG - Intergenic
958475071 3:94569752-94569774 AAGTGGAGGAGGAGCCTGGTGGG + Intergenic
958916836 3:100059584-100059606 AACAGCGTTAGGAGCCAGGAAGG + Intronic
959494184 3:107030350-107030372 AAGTGGATGACGAACAAGGAAGG + Intergenic
959625406 3:108444199-108444221 ATGTTGATTTGGACCCAGGAAGG + Intronic
962659085 3:137582687-137582709 AAGCGGATTAGGAGAGAGGCAGG - Intergenic
963844245 3:150139437-150139459 AAGTGGCTTATGGGTCAGGAAGG - Intergenic
964746732 3:160019581-160019603 AACTGCATAAGGAGCCTGGAAGG - Intronic
965185272 3:165454892-165454914 AGGTGGACTGGGAGCCAGAAGGG + Intergenic
966878084 3:184335039-184335061 AAGTGGCTGAAGAGGCAGGATGG + Exonic
968438708 4:610481-610503 GAGTGGCAGAGGAGCCAGGAGGG + Intergenic
968665069 4:1816504-1816526 AAGAGGAAGAGGGGCCAGGAAGG + Intronic
968818589 4:2834158-2834180 AAGTGGGCTGGGAGCCAGGCAGG + Exonic
968869974 4:3236817-3236839 AAGTGGGTTAGGAGCTTGGTAGG + Intronic
969393438 4:6906138-6906160 AAGGGGATTGGGAGGGAGGATGG + Intergenic
971968630 4:33593990-33594012 ATGTGGATTGGGGGCCAGGAAGG - Intergenic
972969978 4:44562124-44562146 AAGTTCATTATGAGGCAGGAAGG - Intergenic
974023102 4:56709050-56709072 ATGTGGATTGTGAGCCAGGGTGG + Intergenic
975467363 4:74723569-74723591 AAGCGGAGGAGGAGCCAAGATGG - Intergenic
976215763 4:82714204-82714226 AAATGGAATAGGATCCAGGTGGG - Intronic
976738456 4:88334269-88334291 AAGTGGATGAGGAGGGATGAGGG - Intergenic
976890388 4:90039642-90039664 AGATGGATGAGGAGCCAGAAGGG + Intergenic
977516278 4:98024164-98024186 AAGTTGGTAAGGAGCCAAGATGG - Intronic
978607198 4:110493696-110493718 AAGTGGGTAGGGAGCCAGGAGGG - Intronic
980731640 4:136832053-136832075 AGGTGGATGGGGAGCCAGAAGGG + Intergenic
981007070 4:139886122-139886144 AAAGGGATTAGGAGACAGAATGG + Intronic
981019074 4:140006287-140006309 AAGTGAATTAGGAAACAGGCCGG + Intronic
981921340 4:150087961-150087983 AATGGGACTAGCAGCCAGGAGGG + Intronic
982474628 4:155834977-155834999 AGATGGATCAGGAGCCAGAAGGG - Intronic
983840683 4:172454249-172454271 AACTGGAATAGGACCAAGGATGG - Intronic
984443564 4:179804696-179804718 GAGTGGATGAGGAGGCAGGCTGG - Intergenic
985054413 4:186023927-186023949 AACAGGAGCAGGAGCCAGGACGG - Intergenic
985102340 4:186470865-186470887 AAGGGGAAAAGGAGGCAGGAGGG + Intronic
985103499 4:186480391-186480413 AAGGGGATTAGGAGAAAGGAGGG - Intronic
985651808 5:1111176-1111198 ACTGGGATTTGGAGCCAGGATGG + Intronic
987005708 5:13707259-13707281 AGGTGGATGGGGAGCCAGAAGGG - Intronic
988331711 5:29850118-29850140 AAATGGATGGGGAGCCAGAAAGG + Intergenic
988648434 5:33122367-33122389 AACTGGAGGAGGAGCCAAGATGG + Intergenic
989183447 5:38600668-38600690 GAGAGGAAAAGGAGCCAGGAAGG - Intronic
989539885 5:42606284-42606306 AAGTGGACTAAGAGCCAGTGGGG - Intronic
990131877 5:52596077-52596099 CAGTGGATTAGGTGCCAGTATGG - Intergenic
990365369 5:55065168-55065190 AAGTAGATTAGAAGCTATGAGGG - Intergenic
992328917 5:75695695-75695717 AAGTGGGGGAGGAGCCAAGATGG + Intronic
993143911 5:84070112-84070134 AGGTGGATGGGGAGCCAGGAGGG - Intronic
993606716 5:90000046-90000068 AAGTGGCTTAGGAAGCAGAAAGG - Intergenic
993623765 5:90198778-90198800 AAATGGAGCAGGACCCAGGAGGG + Intergenic
996562211 5:124843096-124843118 AGGTGGTTAAGGAGCGAGGAGGG + Intergenic
997440361 5:133904874-133904896 AGGTGGACCAGGAGCCAAGAAGG + Intergenic
997633750 5:135389710-135389732 ATGGGGATTGGGAGCAAGGAAGG - Intronic
998592370 5:143490856-143490878 AAGTGAATTAGGACACAGAAGGG - Intergenic
998876904 5:146609476-146609498 AACTGGATGTGGAGCCAAGATGG + Intronic
999537001 5:152528676-152528698 TGGTGGATAAGGAGCCAGAAGGG + Intergenic
1000654458 5:163859495-163859517 TAGTGGATTAGCACCCAAGATGG + Intergenic
1000679115 5:164160992-164161014 GAGAGGATTAGGACCCAGGAGGG + Intergenic
1000884302 5:166734002-166734024 AAGAGGCTAAGGAACCAGGAAGG + Intergenic
1001662829 5:173408810-173408832 AAGGGGAGGAGGAGCCAAGATGG - Intergenic
1001781685 5:174374228-174374250 GTTTGTATTAGGAGCCAGGATGG + Intergenic
1001949499 5:175806307-175806329 AAGTGGATAGTGAGGCAGGAAGG - Intronic
1005214596 6:23510415-23510437 AAGTGGATGTGGATTCAGGAAGG + Intergenic
1005516226 6:26556947-26556969 AAAAGGTTTAGGAGGCAGGAAGG + Intergenic
1006260943 6:32869944-32869966 AAGTGAATAGGGAGTCAGGATGG + Intergenic
1007176803 6:39902737-39902759 CTGTGGATTAGTAGACAGGATGG - Exonic
1007858655 6:44884621-44884643 ATGTGGATCAGGAGCCAAGATGG + Intronic
1008096756 6:47346921-47346943 ATGTGGATTAGCATCCAAGATGG - Intergenic
1008870350 6:56265454-56265476 AAGTGGAATAGGAGGAAGGACGG - Intronic
1009546662 6:65029675-65029697 AAGAGGAGAAGGAGCCAAGATGG + Intronic
1011252679 6:85389410-85389432 AAGTGAGTTAGGGGACAGGAGGG + Intergenic
1011508577 6:88074902-88074924 GAGTGAATTAGGAGCCATTATGG - Intergenic
1011863296 6:91787666-91787688 AAGTGGTTTAGGGACCAGGTAGG + Intergenic
1011878543 6:91993141-91993163 AAGGGTAGTAGGAGCCTGGAGGG + Intergenic
1012017624 6:93871765-93871787 ATGTGGAGAAGGAGCCAAGATGG - Intergenic
1012396273 6:98801075-98801097 AAGGGGACTAGGAGACAGGAAGG + Intergenic
1012533267 6:100264237-100264259 AAGTTGTATTGGAGCCAGGAGGG - Intergenic
1014168691 6:118253977-118253999 AAAGGGATGAGGATCCAGGAGGG + Intronic
1016213249 6:141566102-141566124 AACTGGAGGAGGAGCCAAGATGG + Intergenic
1016993880 6:149947487-149947509 AGGTGGGTGAGGAGGCAGGATGG + Intronic
1017004453 6:150020050-150020072 AGGTGGGTGAGGAGGCAGGATGG - Intronic
1017396030 6:154001314-154001336 AATTGTATTAGATGCCAGGAAGG + Intergenic
1018140324 6:160827211-160827233 GAGTGGCTTAAGAGCCAGTATGG + Intergenic
1018434772 6:163750263-163750285 AAGTGTAATGGGAGCCAAGATGG - Intergenic
1021434779 7:20601679-20601701 TGGTGGATTAGCAGCCAAGATGG + Intergenic
1022992763 7:35724916-35724938 AGGTGGATGGGGAGCCAGAAGGG - Intergenic
1024114449 7:46179137-46179159 ATGTGAATTAGGGGTCAGGAGGG - Intergenic
1024750719 7:52462138-52462160 AAGGGGATTTGAAACCAGGAGGG - Intergenic
1027058198 7:75064846-75064868 AAGTGGATCTAGGGCCAGGAGGG - Intronic
1027689490 7:81325051-81325073 CAGAGGATCAGGAGCCAGGGGGG - Intergenic
1030406198 7:109117228-109117250 AAGTGTATTTGAAGCCAAGAAGG + Intergenic
1032436754 7:131907147-131907169 AAGTGGAAATGGAGCCAGGGTGG + Intergenic
1032504544 7:132425494-132425516 AAGGGGAGGAGGAGCCAGGAGGG - Intronic
1032583927 7:133129327-133129349 GAGTGGCTTAGGAGACAGGCTGG - Intergenic
1032704205 7:134408090-134408112 AAGTGGATAAGGAGGTAGGTAGG + Intergenic
1033478915 7:141719168-141719190 AAGTGCATTAAGAGGCTGGATGG + Exonic
1033635714 7:143209752-143209774 AGGTGGATGAGGAACCAGAAGGG + Intergenic
1035589291 8:800958-800980 AGGTGGATGGGGACCCAGGAAGG - Intergenic
1036408872 8:8479817-8479839 AGCTGGATTTGGAGCCAGGCTGG + Intergenic
1036504999 8:9347273-9347295 AAGTGGAGGTGGAGCCAGGCAGG - Intergenic
1037720423 8:21439131-21439153 AAGTGGTTTGGGGGCCATGAGGG + Intergenic
1039698348 8:39936717-39936739 CAGTGGATTAGCATCCAAGATGG + Intronic
1039870661 8:41542449-41542471 ATGGGGTTTAGTAGCCAGGATGG - Exonic
1042487312 8:69361044-69361066 AAGAGGGTCAGGAGACAGGAGGG - Intergenic
1043859693 8:85301779-85301801 GAGTTGGTTTGGAGCCAGGAGGG + Intergenic
1046138704 8:110062481-110062503 CAGTGAATTTGGAGCCAGTAAGG + Intergenic
1047586522 8:126279696-126279718 AGGTGGATGGGGAGCCAGAAGGG - Intergenic
1051296480 9:15601265-15601287 AAGTGGCTGTGGAGCCAAGATGG - Intronic
1052460547 9:28757396-28757418 TACTGGTTTTGGAGCCAGGATGG + Intergenic
1052859357 9:33427348-33427370 GAGTGGATGTGGACCCAGGAGGG - Intergenic
1055898899 9:81211990-81212012 TGGTTGATTAGGAGCCTGGAAGG + Intergenic
1056871908 9:90289632-90289654 AGGTGGATGGGGAGCCAGAAGGG - Intergenic
1060248246 9:121964657-121964679 GAGTGTATTAGGAGAGAGGAAGG - Intronic
1062724908 9:138066534-138066556 AAGTGCATTGGGAGCCAGTGTGG + Intronic
1203772656 EBV:57521-57543 AAGTGGAGAAGGAGCCGGGGCGG + Intergenic
1203772667 EBV:57572-57594 AAGTGGAGAAGGAGCCGGGGCGG + Intergenic
1185746614 X:2578441-2578463 ATGTGGATTTGGAGCTAGGAGGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187530797 X:20094897-20094919 AAGTGGCTTGGGTGCAAGGAAGG - Intronic
1187707867 X:22025446-22025468 AAATGGATGCGGAGCCAGAAGGG + Intergenic
1189291289 X:39887728-39887750 GCCTGGACTAGGAGCCAGGATGG + Intergenic
1189991130 X:46596245-46596267 TAGTGGATTAGCATCCAAGATGG - Intronic
1194398134 X:93411761-93411783 TAGTGAGATAGGAGCCAGGATGG + Intergenic
1195123881 X:101785690-101785712 AAGGGAGTTAGGAGCCATGATGG - Intergenic
1195943010 X:110180562-110180584 AAGGGGTTTAAGAGCCAGGGAGG + Intronic
1196046071 X:111257808-111257830 GGGTGGCTTAGGAGCAAGGAGGG + Intronic
1196324399 X:114385267-114385289 AAGATGACTAGGAGCCAGGCAGG - Intergenic
1196998216 X:121407500-121407522 AGGTGGATAGGGAGCCAGAAGGG - Intergenic
1198883410 X:141306534-141306556 AGGTGGATGGGGAGCCAGAAAGG - Intergenic