ID: 908690738

View in Genome Browser
Species Human (GRCh38)
Location 1:66776768-66776790
Sequence TTTCTATTTTTACAAACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908690737_908690738 11 Left 908690737 1:66776734-66776756 CCATCAAATACAGACATTGTGGT 0: 1
1: 0
2: 1
3: 18
4: 182
Right 908690738 1:66776768-66776790 TTTCTATTTTTACAAACCCCAGG 0: 1
1: 0
2: 0
3: 35
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908690738 Original CRISPR TTTCTATTTTTACAAACCCC AGG Intronic
903294240 1:22333522-22333544 TCTCTGTTTTTACCTACCCCAGG + Intergenic
904459461 1:30667395-30667417 TTTTTTTTTTTAAAAACCCTAGG - Intergenic
907978054 1:59452867-59452889 ATTCTAATTTTACAAACCTTTGG + Intronic
908116274 1:60943526-60943548 TTTCTATTTTTACATCCTCCTGG + Intronic
908459534 1:64336062-64336084 TTTCTATTTTTACAGAGACAGGG + Intergenic
908672424 1:66562892-66562914 TTTCTATTCTTAAAAATCACAGG - Intronic
908690738 1:66776768-66776790 TTTCTATTTTTACAAACCCCAGG + Intronic
909063822 1:70908671-70908693 TTACTATTCTTATAGACCCCTGG - Intronic
909156169 1:72079444-72079466 TTTCTATTTTTAAAAAATTCAGG - Intronic
910556326 1:88538074-88538096 TTTGTGTTTTTCCAATCCCCAGG + Intergenic
910798894 1:91125726-91125748 TTTATATTTTTGCAAATCTCTGG + Intergenic
911094199 1:94042573-94042595 TTTATATTTGTAAAAACCTCAGG + Intronic
915712922 1:157918457-157918479 TTTTTATTCTTTCAAACCTCTGG + Intergenic
918028753 1:180781598-180781620 TTTTTTTTTTTAAACACCCCTGG + Intronic
918764699 1:188464916-188464938 TTTCTATTTTAAAAAAGCACAGG - Intergenic
920804872 1:209223534-209223556 TTCCTATTCTTACTAAACCCAGG - Intergenic
922018899 1:221684007-221684029 TTTATATTTTTAATAACCACTGG - Intergenic
922611476 1:226932500-226932522 TTTCTATTTTTAAAAACTCTTGG - Intronic
923073473 1:230588178-230588200 TAGCTATTTTTACAAAGGCCAGG - Intergenic
924065658 1:240219206-240219228 TTTCTAGTATGACAAACCCGAGG - Intronic
1062959876 10:1564821-1564843 TTGCTATTATTACAAAGCTCTGG - Intronic
1063277986 10:4592366-4592388 TTTTTATTTTTACAAATTGCTGG + Intergenic
1064743797 10:18459699-18459721 ATTCTACTTTTACAAACAGCTGG - Intronic
1066015711 10:31241472-31241494 TTTCTATGATTCCAAACTCCAGG + Intergenic
1066581438 10:36886608-36886630 TTTCTATTTTTAAAATCTCATGG - Intergenic
1067108200 10:43379487-43379509 TTTCTATTTTTACTAGACACGGG - Intergenic
1067784814 10:49237757-49237779 CTTCTCTTTTTACAGACACCAGG + Intergenic
1068597668 10:58920682-58920704 GTCCTATTTTTTCAAACCCTGGG - Intergenic
1069689919 10:70343654-70343676 TTACTCTTTTTAGAATCCCCAGG - Intronic
1072587947 10:96799238-96799260 TCTCTATTTTTAAAAAGGCCAGG + Intergenic
1072909627 10:99488339-99488361 TTTTGATTTTCACAAGCCCCAGG - Intergenic
1073469088 10:103711737-103711759 TTTATATTCTTCCAAACTCCAGG - Intronic
1074040449 10:109783193-109783215 ACTCTATTTTCACAAAGCCCAGG - Intergenic
1074411018 10:113228718-113228740 TTTCTCTTTTCACAAAACCCTGG - Intergenic
1075437277 10:122454445-122454467 TTTTTTTTTTTTCAAATCCCTGG + Intergenic
1076552552 10:131292518-131292540 TTTCTATTTTTAAAAAACATTGG + Intronic
1078592139 11:12651663-12651685 TTACTCTTTTTACATAACCCTGG - Intergenic
1078725476 11:13926560-13926582 CTTGTTTTTTTCCAAACCCCAGG + Intergenic
1081815986 11:45942219-45942241 TTTCAATTTTTAAAAAAACCTGG + Intronic
1082219645 11:49618746-49618768 CTTCCATTGTTTCAAACCCCTGG + Intergenic
1086230459 11:84563368-84563390 TTTCTTTTTTTCAAAAACCCTGG + Intronic
1086629986 11:89006032-89006054 CTTCCATTGTTTCAAACCCCTGG - Intronic
1088873816 11:113916574-113916596 TGTCTATTTTTAAAAACTTCTGG + Intronic
1088935402 11:114394754-114394776 TTTATAATTTTAAAAAACCCTGG - Intronic
1089921649 11:122214685-122214707 TTTCTCTTTTTTCAAACCTTGGG + Intergenic
1091835974 12:3586050-3586072 GTTCTAAGTTTCCAAACCCCAGG + Intronic
1092669707 12:10849085-10849107 TTTGTATTTTTAGAAAGACCTGG - Intronic
1092754640 12:11752165-11752187 TTTTTACTTGTACAAACCACAGG + Intronic
1095661325 12:44740565-44740587 TTTCTTTTTTCACAAGCTCCTGG - Intronic
1095775470 12:46004821-46004843 TTTTTATTTTTACAAAGGCAAGG + Intergenic
1096299208 12:50411109-50411131 TTTCTACTGTAACAAACCCCTGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1098267975 12:68742673-68742695 TTTCTGTTTTTACAAATTCCAGG + Exonic
1098977414 12:76917680-76917702 TTTCTTTTTTTACAAAGACCAGG + Intergenic
1099143617 12:79011646-79011668 TTTTTTTTTTTACAAATCTCTGG - Intronic
1099274057 12:80552621-80552643 TTTTTTTTTTTACAAAGACCTGG - Intronic
1099287812 12:80736859-80736881 TTTCTAATTATGCAAACCCTTGG + Intergenic
1099425605 12:82519098-82519120 TTTTTGTTTTAACAAACTCCTGG - Intergenic
1099469648 12:83031855-83031877 TGTCTATGTTTACAAACCTAGGG + Intronic
1099537624 12:83864204-83864226 TTTATGTTTTGCCAAACCCCGGG + Intergenic
1100508293 12:95242699-95242721 TTTGTATTTTTACAAATACAGGG - Intronic
1100893480 12:99153114-99153136 TTTTTATTTTTAAAAACTCTTGG + Intronic
1101192344 12:102348042-102348064 TTTGTGTTTCTACAAACCCTGGG - Intergenic
1102890234 12:116552970-116552992 TTTCTATATTTAAGAAACCCAGG + Intergenic
1105602455 13:21899520-21899542 TTGCTTTTTTTTCAAACTCCAGG - Intergenic
1106699157 13:32210530-32210552 ATTTTATTTATACAAACCCTGGG - Intronic
1108518788 13:51226168-51226190 TTTTTATTTTTATAAACACAAGG + Intronic
1112322138 13:98417445-98417467 TTTTTTTTTTTTCAAACCTCTGG - Intronic
1113995258 14:16058791-16058813 TTTCCATTTTGACAAACCACTGG + Intergenic
1114163305 14:20192852-20192874 TTTCAGTTTTTACAAACAGCCGG - Intergenic
1116040866 14:39685151-39685173 TTTCTGTCTTTACAAGCCCATGG + Intergenic
1116587744 14:46730897-46730919 TTTCTATTATTACAAGCCATAGG + Intergenic
1116713007 14:48393192-48393214 TTTCTATTTTCAATATCCCCAGG - Intergenic
1118457157 14:65955232-65955254 CTTCTATTTATACAGACCCCTGG + Intergenic
1119094143 14:71813092-71813114 TTACTATTATTACCAACCACAGG - Intergenic
1119908330 14:78325763-78325785 TTTCCATTTGTACAAACATCTGG + Intronic
1120471654 14:84933291-84933313 TTTCTATTGCTACAAAACCTTGG + Intergenic
1121859716 14:97305884-97305906 TTTCTATTTTCAAAAACAGCAGG - Intergenic
1122472724 14:101982417-101982439 TTTGTATTTTTACAAACACGGGG - Intronic
1126537884 15:49786753-49786775 TTTCTCTTTTTTTAATCCCCAGG + Intergenic
1126782802 15:52152805-52152827 TTTCTATTTTTATAAAGACGAGG + Intronic
1126986079 15:54310435-54310457 TTGCTATTTTTCCTAACCCCTGG + Intronic
1129045670 15:72731860-72731882 TTTCTATTTCTTCAAGCTCCAGG - Intronic
1130343164 15:83016446-83016468 TATTTATTTTTAAAAACTCCAGG + Exonic
1130761806 15:86828568-86828590 TTTCTACTTCTAGAGACCCCTGG - Intronic
1132287284 15:100672662-100672684 TTTCAATTTTCCCTAACCCCTGG + Intergenic
1134107697 16:11495550-11495572 TTTCTATTTTTAGTAAAGCCGGG + Intronic
1134572466 16:15303085-15303107 TATTTATTTTTACAAAACCAAGG - Intergenic
1134573129 16:15308908-15308930 TTTACATCTTTAAAAACCCCTGG - Intergenic
1134729254 16:16447048-16447070 TTTACATCTTTAAAAACCCCTGG + Intergenic
1134729916 16:16452955-16452977 TATTTATTTTTACAAAACCAAGG + Intergenic
1134937516 16:18258941-18258963 TATTTATTTTTACAAAACCAAGG - Intergenic
1134938181 16:18264816-18264838 TTTACATCTTTAAAAACCCCTGG - Intergenic
1135055968 16:19232346-19232368 TTTGCATTTTAACAAATCCCTGG - Intronic
1135869443 16:26136032-26136054 TTTCTATTTCAACAAAACCAAGG + Exonic
1136914039 16:34164276-34164298 TTTCCATTTTGACAAACCACTGG + Intergenic
1137048271 16:35687869-35687891 TTTTTTTTTTTGCCAACCCCAGG - Intergenic
1137340578 16:47599346-47599368 TTTCTAGTTGTACTAAACCCAGG - Intronic
1138707286 16:58929575-58929597 TTTCTATTTTTACAAAAACTAGG + Intergenic
1140057643 16:71539188-71539210 TTTCTATTCTTTCCAACCCAAGG - Intronic
1140867613 16:79077645-79077667 TTTTTTTTTTTTCAAACCACAGG + Intronic
1141367401 16:83456385-83456407 TTTGGATTTTTCCAAAGCCCGGG - Intronic
1143364294 17:6395912-6395934 TCCTTATTGTTACAAACCCCAGG - Intronic
1144722993 17:17485251-17485273 TTTGTATTTTTACAAAGGCGTGG - Intronic
1145118787 17:20236845-20236867 TTTCTATTTTCACAGCTCCCTGG + Intronic
1145925979 17:28646972-28646994 TTTTTATTTTTAGAAACTTCCGG - Intergenic
1148682960 17:49485249-49485271 ATTCTACTTTTAGAAAACCCAGG - Intergenic
1148710985 17:49680607-49680629 TTTTTTTTTTTTCAAACCCCTGG - Intergenic
1149300038 17:55296842-55296864 TTTTTTTTTTTACAGAGCCCAGG + Intronic
1150554453 17:66241473-66241495 TTTGTATTTTTACAAAAGCAGGG + Intronic
1151859004 17:76745012-76745034 TTACAATTTTTACAAAACACAGG - Intronic
1152006801 17:77687468-77687490 TTTCTCTTTTTCCACACTCCGGG - Intergenic
1152693665 17:81733304-81733326 TATCTGTTTTTACAAACTTCAGG + Intergenic
1153067061 18:1058167-1058189 TTTCTTTTTTTAAAAAACCGTGG + Intergenic
1153589949 18:6663105-6663127 TTTTTATTATTCCAAAGCCCAGG + Intergenic
1154983678 18:21527261-21527283 CTTCTCATTTTACAAACCCCAGG + Intergenic
1155160471 18:23191221-23191243 TTTCTTTTTTAAGAAACTCCAGG - Intronic
1155207147 18:23569747-23569769 TCTCTATCTTTACAAACCATGGG - Intronic
1155884612 18:31192531-31192553 TTACTATTTCTACATACCTCAGG - Intergenic
1155895262 18:31317212-31317234 TATTTATTTTCACAAACCTCAGG + Intergenic
1156439180 18:37166803-37166825 TATTTATTTTTTTAAACCCCAGG - Intronic
1156905206 18:42344348-42344370 TATTTATTCTTACAAACCACAGG - Intergenic
1157036669 18:43983820-43983842 TTTCTTCCTTTTCAAACCCCTGG - Intergenic
1158990057 18:62859086-62859108 TTTTTCTTTTACCAAACCCCAGG - Intronic
1159547573 18:69858899-69858921 TTTCTATTTTTACTAAGACAGGG + Exonic
1162704203 19:12543126-12543148 TTTGTATTTTTACAAAGACAAGG - Intronic
1164031255 19:21407841-21407863 TTTCTATTTTAACATAGCACTGG - Intronic
1164048868 19:21567003-21567025 TATTTTTTTTTACAAACCACTGG - Intergenic
1164233059 19:23308047-23308069 TTTCTATTTTGGCAAGACCCAGG - Intronic
1165185093 19:34012419-34012441 TTTCTGTCCTTACTAACCCCTGG + Intergenic
1166465277 19:43026213-43026235 TTTTTATTTTTTAGAACCCCAGG + Intronic
1166467929 19:43050413-43050435 ATTAAATTTTTACAAACCTCTGG + Intronic
925111183 2:1339546-1339568 TTTATATTTTTCCAGACTCCAGG + Intronic
925264616 2:2558261-2558283 TTTCTAGTTTAACGAACCCATGG + Intergenic
925474865 2:4202008-4202030 TTTCTATTATTCCTAACCCCTGG - Intergenic
925778050 2:7354377-7354399 TTTCTGTTTTTTAATACCCCTGG - Intergenic
926406664 2:12560157-12560179 TTTCTATTTTTAAAGACACAGGG + Intergenic
926783042 2:16493036-16493058 TTTTTATTTTTAAAAATCCAAGG - Intergenic
926946087 2:18188932-18188954 TTTTTATATTCACAAAACCCAGG + Intronic
927045722 2:19276204-19276226 TTCCCATGGTTACAAACCCCTGG + Intergenic
928337179 2:30407959-30407981 TTTCAATTTTTAAAGCCCCCTGG - Intergenic
929209337 2:39336967-39336989 TTTCTGTTTTTTGAAACTCCAGG - Exonic
930451488 2:51543996-51544018 TTTCTATTTTTAGAAGACACAGG - Intergenic
930701328 2:54460007-54460029 TTTCTATTTTTAAACATCTCTGG + Intronic
931129164 2:59313965-59313987 TTTTAATTTTAACAAACCGCAGG - Intergenic
932049335 2:68383342-68383364 TTTCTCTTTTTTTGAACCCCTGG - Intronic
932125829 2:69144927-69144949 TCTCTATTTTAACTAACCCCAGG - Intronic
932596618 2:73097605-73097627 TTTCTACTGCTACAAACCCATGG + Intronic
933218944 2:79665800-79665822 TTTTTATTTTTAGAATCTCCTGG + Intronic
933752684 2:85612974-85612996 TTTCTATTTTTTCTGACCACTGG + Intronic
934485299 2:94702715-94702737 TATATGTTTTTACAAACCCTTGG + Intergenic
935591554 2:104850482-104850504 CCTCAATTTTTACAAAACCCAGG + Intergenic
935805034 2:106737227-106737249 TTTTTAGTTTAACAAACCGCAGG + Intergenic
936374613 2:111929961-111929983 TTTCTATTTAAGCAAACCACTGG + Intronic
936627173 2:114160909-114160931 TTTCTTTTTTTTGAAGCCCCAGG + Intergenic
936810103 2:116388206-116388228 TTTCCATTGTTATAAACCCCAGG + Intergenic
936853044 2:116924630-116924652 TTTCTATTTCTGCAAAACCCTGG + Intergenic
938536222 2:132251967-132251989 TTTCCATTTTGACAAACCACTGG - Intronic
938949331 2:136242670-136242692 TTTCTAATTTTACACACACTGGG - Intergenic
939038204 2:137158011-137158033 TTTCTATTTATACAATGCTCTGG + Intronic
941612520 2:167678959-167678981 TTTCTATTTTTCCAAAGACTTGG + Intergenic
942233210 2:173878830-173878852 TTTCTTATTTTAAATACCCCTGG - Intergenic
942570123 2:177305448-177305470 TTTTTATTTTTACAGACACGGGG - Intronic
942722196 2:178965720-178965742 ATTCTTTTTTTCCACACCCCAGG + Intronic
943441597 2:187933424-187933446 TTTCTCTTCTCACAAACCCTGGG - Intergenic
943580229 2:189675158-189675180 TTTGTATTTGAACAAGCCCCAGG + Intronic
943904958 2:193487278-193487300 TTTATATTTTTAGAAAACACAGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944318860 2:198312433-198312455 TTTCTGTTTTTCCAAACAACTGG + Intronic
944388786 2:199195255-199195277 TTTTTTTTCTTACATACCCCTGG + Intergenic
944913109 2:204329347-204329369 TATATATTTTAACAAACCTCTGG + Intergenic
945294595 2:208158095-208158117 TTTTTTATTTTACATACCCCTGG - Intergenic
945430488 2:209757815-209757837 TTTCTATTTTTACTGAGCCGTGG - Intergenic
945576371 2:211534959-211534981 TTTCTATTGTTACCATCACCAGG + Intronic
946058777 2:216923630-216923652 TTTTTTTTTTTAATAACCCCAGG + Intergenic
946965819 2:225036652-225036674 CTACTATTTGTAAAAACCCCAGG + Intronic
947527586 2:230888423-230888445 TTTCAATTTTTAAAAACCTTTGG - Intergenic
948794900 2:240397510-240397532 TTTTTTTTTTACCAAACCCCAGG + Intergenic
1169415247 20:5410515-5410537 TTTTTATTTTTGCAGACCTCTGG + Intergenic
1170545117 20:17429418-17429440 TTTATATTTTTCCAAAGCCACGG + Exonic
1171767008 20:29295911-29295933 TTTCCATTTTGACAAACCACTGG - Intergenic
1171810033 20:29740325-29740347 TTTCCATTTTGAAAAACCACTGG - Intergenic
1171865117 20:30483785-30483807 TTTCCATTTTGACAAACCACTGG - Intergenic
1171908946 20:30922849-30922871 TTTCCATTTTGACAAACCACTGG + Intergenic
1172419485 20:34803105-34803127 TTTCTAATTTTATAAATCGCTGG - Intronic
1174461613 20:50686981-50687003 TTGCTATTTTTAGAAACTCTAGG - Intronic
1174491567 20:50901310-50901332 TTTTTTTTTTTAAATACCCCAGG - Intronic
1176661735 21:9642566-9642588 TTTCCATTTTGACAAACCATTGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178070738 21:28963344-28963366 TTTCTCATTTTAAAAATCCCAGG + Intronic
1178328617 21:31665841-31665863 TTTCTATTATTAAAATCCCATGG - Intronic
1178676937 21:34639052-34639074 TTTGTGTTTTTGCAAATCCCAGG + Intergenic
1179673657 21:42967115-42967137 TTTGTATTTTTACAAACATGGGG + Intergenic
1180311834 22:11248618-11248640 TTTCCATTTTGACAAACCACTGG - Intergenic
1184975874 22:48061506-48061528 TTTCTATTTTTCCAAAACAATGG + Intergenic
949323494 3:2838549-2838571 TTTTTTTTTTTACAAACCATAGG - Intronic
949958599 3:9291700-9291722 TTTCCATTTCTACATACCTCTGG + Intronic
950970817 3:17185685-17185707 TTTTTATTTTTACAAAGTCTAGG - Intronic
952323700 3:32301428-32301450 TTTCTAGTTTTAAAAACAACAGG - Intronic
958107016 3:89088341-89088363 TCTCTATTTTTACAAAGCTGAGG - Intergenic
958781940 3:98553091-98553113 GTTTTGTTGTTACAAACCCCAGG - Intronic
959139482 3:102468596-102468618 TTTCTATTTTCATATACCCTGGG + Intronic
959202521 3:103266571-103266593 TTTCTATTTTGTCTAACCCTAGG - Intergenic
960387267 3:117035501-117035523 TTTCCATTTTTCCCATCCCCTGG + Intronic
962837044 3:139198745-139198767 TTTCTATTTTTATGGACTCCTGG - Intronic
962910313 3:139842584-139842606 TTTTTATTATTACAAATCTCTGG + Intergenic
964494850 3:157277374-157277396 GATCTATTTTTTCCAACCCCAGG - Intronic
965023165 3:163261532-163261554 TTTGCATTTTGACAAATCCCAGG + Intergenic
965138779 3:164808588-164808610 TTGCTATGTCTATAAACCCCAGG + Intergenic
966277435 3:178191355-178191377 TTTATATTTATACAACTCCCTGG + Intergenic
967783759 3:193468004-193468026 TTTGTATTTTTACAAAACTGGGG - Intronic
968204583 3:196787915-196787937 TTTCTATGTTTACAAAAGCACGG - Intronic
969069463 4:4523445-4523467 TTTCTATATTTACAACTGCCTGG + Intronic
969563067 4:7961598-7961620 TTTCTATTTTTAGAAAAGACGGG - Intergenic
970934892 4:21557824-21557846 TTTCTATAGTTACAAAGCCCAGG - Intronic
971181740 4:24334892-24334914 TTTCTATATTTAGAAACCCAAGG + Intergenic
971182297 4:24340035-24340057 TTTCTATTTTTTAAAAACCTAGG - Intergenic
971867093 4:32186950-32186972 TTTCTTTTTTTTCCACCCCCTGG + Intergenic
974257475 4:59478293-59478315 TATCTATTTTTGGAAAACCCAGG - Intergenic
975012323 4:69372810-69372832 CTTTTATTTTCACAATCCCCAGG + Intronic
975241116 4:72060450-72060472 TTTCTATTTTACCAAAGCACTGG - Intronic
976871412 4:89798095-89798117 CTTCTACTTTTCCAAACACCTGG - Intronic
977350594 4:95880590-95880612 TTCCTGTTCATACAAACCCCTGG + Intergenic
978114056 4:104998150-104998172 AGTCTATATTTACAAAACCCTGG - Intergenic
978834283 4:113129131-113129153 TTTCTATTAGTAAAGACCCCGGG - Intronic
978912935 4:114086444-114086466 TTTTTATTTTTAAAGAACCCAGG - Intergenic
979028751 4:115611677-115611699 ATTTTTTTTTTACAAATCCCTGG - Intergenic
980112858 4:128651187-128651209 TTTTTATTTTTGAAAAGCCCAGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981942647 4:150300611-150300633 TTTTTTTTACTACAAACCCCAGG + Intronic
984247512 4:177293536-177293558 TTTCTGTTTTTTAAAACTCCAGG + Intergenic
984427700 4:179608889-179608911 TTTGTATTTTTACAAAACACAGG - Intergenic
985413664 4:189713982-189714004 TTTCCATTTTGACAAACCATTGG + Intergenic
985777740 5:1853714-1853736 TTTCCATTTGTCCAAACCACAGG - Intergenic
985804943 5:2036359-2036381 TTCCTAATATTAAAAACCCCAGG + Intergenic
986277399 5:6289650-6289672 TTTCTATTTTTTCAAACTTAAGG - Intergenic
986606249 5:9526173-9526195 TTTCAATATTTATAAATCCCTGG - Intronic
987006455 5:13715198-13715220 TTTCTTTTTTTTCAAACCGTTGG - Intronic
987264150 5:16235034-16235056 TTTCATTTTTTAAAAACCTCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987939010 5:24508529-24508551 TTTCTTTTTTTACAAAGACAGGG + Intronic
990558695 5:56962462-56962484 TTTCTGCTTTTACAAATCTCTGG - Intronic
991201004 5:63992586-63992608 TAGCTAATTTTAGAAACCCCGGG + Intergenic
993004292 5:82413850-82413872 TTTCTATTTCTACTAACCACAGG - Intergenic
993437061 5:87910543-87910565 TTTCTATTTTTACTATACACTGG + Intergenic
996313888 5:122139620-122139642 TTTCTAGTTTTTCAAATACCAGG - Intronic
997548905 5:134735271-134735293 TTTTTATTTTTATAAACACAGGG - Intergenic
999061826 5:148644023-148644045 TTTTCATTTTTACAAGCCTCCGG - Intronic
999173747 5:149617227-149617249 TTTATATAATTCCAAACCCCTGG - Intronic
1000717596 5:164665622-164665644 TTTCTATTTTTTAAGACTCCAGG + Intergenic
1001717933 5:173832272-173832294 TTTGTATTTTTAAAGACCACAGG - Intergenic
1003141506 6:3475260-3475282 TTTCAGTTTTCACAAACCCCAGG - Intergenic
1004038864 6:11954220-11954242 TTTTTATTTTAAAAAACCCTCGG - Intergenic
1005689792 6:28292750-28292772 TTTCTTTTTTTTCAACCCCTTGG - Intronic
1007552548 6:42741298-42741320 TTTCTATTTTTACTAGACACGGG + Intergenic
1008294973 6:49764702-49764724 TTCCAATTGTTACAAACCCAGGG - Intergenic
1009393091 6:63166064-63166086 TTTTTATATTTATAAATCCCTGG + Intergenic
1009912735 6:69952471-69952493 TTTATATTTTTATAAAGCCATGG - Intronic
1010645278 6:78380303-78380325 TTTCTGTTTTTAGCTACCCCTGG - Intergenic
1011557903 6:88588404-88588426 TTTCTGTTCTTGCAAAGCCCAGG + Intergenic
1012901821 6:105014746-105014768 TATCTATTTTTAAAAAGGCCAGG - Intronic
1013640869 6:112079000-112079022 TTTCTATTTTTACAGAACAGGGG + Intronic
1013867691 6:114718868-114718890 TTTCCATTTTTCAAGACCCCTGG - Intergenic
1013918521 6:115370556-115370578 TTTCTATTTTTTCTTTCCCCAGG - Intergenic
1014431293 6:121373863-121373885 TTTGTATTTTTAGAAAACACAGG - Intergenic
1016822518 6:148360067-148360089 TTTCTTTCTTTACAAACCAAAGG + Intronic
1017034491 6:150254970-150254992 TTTCTATTTTTGGTAACCACTGG - Intergenic
1018270848 6:162075929-162075951 TTTTCATGTCTACAAACCCCAGG - Intronic
1018282059 6:162197567-162197589 TTTGTATTTTTCCATAGCCCTGG - Intronic
1020413824 7:7923275-7923297 TTTTTTTTTTTACAAACCCGAGG + Intronic
1020660061 7:10971870-10971892 TTTCTAGTTTTCCAAACCTGTGG - Intergenic
1021828661 7:24580328-24580350 TTTATATTGTTAAAATCCCCAGG + Intronic
1022150930 7:27605465-27605487 TTTTTTTTTTTACAAGACCCAGG + Intronic
1024252562 7:47517475-47517497 TTTGTATCTTTACAAACATCTGG - Intronic
1024581976 7:50808036-50808058 CTTCTATTTTTACAGGCACCTGG - Intergenic
1025164187 7:56696145-56696167 CTTCTATTTTTACACACTACTGG + Intergenic
1026274702 7:68866378-68866400 TTTCTGTTTTTCAAAACACCTGG - Intergenic
1026530541 7:71193547-71193569 TTTCTGGTTTTACAAATGCCAGG + Intronic
1027802647 7:82774805-82774827 CATGTATTTTTCCAAACCCCTGG - Intronic
1028801010 7:94966228-94966250 GTTGTATATTTAGAAACCCCAGG - Intronic
1028996686 7:97108132-97108154 TTTCTCTTTTGAAAAACCTCAGG + Intergenic
1030522948 7:110620693-110620715 TTTCTATTTGTTCAAACCTCGGG - Intergenic
1030768068 7:113437037-113437059 ATTATATTTTTAAAAACCCTTGG - Intergenic
1032979036 7:137260600-137260622 TTTTTACTTTTACAAAGCCCAGG + Intronic
1033349401 7:140550070-140550092 TTTCTATTTTTATGAATTCCAGG - Intronic
1033415230 7:141155891-141155913 TTTCTATTTTTAGTAACAACGGG - Intronic
1034329511 7:150270193-150270215 TTTCTATTTTTAAAGTTCCCAGG - Intronic
1034651018 7:152690298-152690320 TTTCTATTTTTAGAAGAACCGGG - Intergenic
1034668545 7:152839668-152839690 TTTCTATTTTTAAAGTTCCCAGG + Intronic
1035376396 7:158409652-158409674 TTTCTGTTGTTAGAGACCCCCGG - Intronic
1035493906 7:159304985-159305007 TTTCTACTATTACAAACCACAGG - Intergenic
1035556241 8:569273-569295 ATTCTATTTTTACAAATGGCTGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036449244 8:8851140-8851162 TTTCTCTTTTTCCTAACCCTTGG + Intronic
1038291633 8:26254700-26254722 TTTCAATTTTGAAAACCCCCAGG - Intergenic
1038353694 8:26806480-26806502 TTTCTATTTTTACCAGGCTCTGG - Intronic
1038509335 8:28116183-28116205 TTTTCACTTTTACAAACCCAAGG - Intronic
1038730492 8:30122483-30122505 TTTCTATTTTTAGAAACTTTTGG + Intronic
1041733759 8:61088738-61088760 TGTCCATTTTTACACATCCCAGG + Intronic
1042564109 8:70095706-70095728 TTTCTTTTTTTACCTAGCCCAGG - Intergenic
1043588282 8:81794883-81794905 TTTGTATTTTTACAAGACACAGG - Intergenic
1045435177 8:102155868-102155890 ATTCTATGTTTACAACTCCCTGG - Intergenic
1045441662 8:102219370-102219392 TTTATATTTTTAGAAACCTATGG + Intronic
1046388962 8:113542496-113542518 TTTCTCTTTTAACAAGCCTCAGG + Intergenic
1047054867 8:121152815-121152837 ATTCTCTTTTACCAAACCCCAGG + Intergenic
1051001844 9:12291575-12291597 TTTCTATCTTTACAAATAGCAGG - Intergenic
1051305477 9:15704076-15704098 TTGCGATTTTTACAAACTGCAGG - Intronic
1053043567 9:34894763-34894785 TTACTAGTTTTACAAACCTGTGG - Intergenic
1053404521 9:37860608-37860630 TTTCTTTTTTTAAAAACCAGGGG + Intronic
1054742214 9:68818446-68818468 TTTCTATTTTAACAGAAACCTGG + Exonic
1057438145 9:95061340-95061362 TTTGTATTTTTTTAAAACCCTGG - Intronic
1058486782 9:105449141-105449163 TTTCTATTATTAGAAAGCACGGG + Intronic
1058494976 9:105546929-105546951 TTTCAATTTTTAGAAAACCTTGG - Intronic
1058749276 9:108023283-108023305 TTCCTCTTTTTACCAAGCCCTGG + Intergenic
1059241421 9:112809553-112809575 TTTTTTTTTTTACACACCACTGG - Intronic
1060862998 9:126971367-126971389 TTTTTTTTTTTACAAACTACTGG + Intronic
1060926045 9:127456011-127456033 TTTCTATTATTACTAACACCGGG - Intronic
1203360324 Un_KI270442v1:216065-216087 TTTCCATTTTGACAAACCACTGG - Intergenic
1203639296 Un_KI270750v1:144409-144431 TTTCCATTTTGACAAACCATTGG - Intergenic
1186127983 X:6436148-6436170 TTTCTATGTCTGCAAACACCTGG - Intergenic
1186249912 X:7654736-7654758 TTTCTAATTTTACCAACTCAGGG + Intergenic
1186985369 X:15008127-15008149 TCTCTATTTTTAGAAATCCTAGG + Intergenic
1187629234 X:21149860-21149882 TTTCTAATATTACAAACACAAGG + Intergenic
1188078418 X:25807292-25807314 TGTTTATTTTTTCAAAGCCCTGG + Intergenic
1188280930 X:28268612-28268634 CTTCCATATTTACAAAGCCCTGG + Intergenic
1188585907 X:31775293-31775315 TTACTGTTTTTATAAACGCCTGG + Intronic
1189631222 X:42955546-42955568 ATCCTATTTTTACATACCCTTGG - Intergenic
1189825017 X:44909264-44909286 TTTCTGTTTTTGCAAACTCAAGG - Intronic
1190045663 X:47109998-47110020 TTGCTGTATTTACAATCCCCGGG + Intergenic
1190045674 X:47110076-47110098 TTGCTGTATTTACAATCCCCGGG + Intergenic
1190045707 X:47110310-47110332 TTGCTGTATTTACAATCCCCGGG + Intergenic
1190620077 X:52278558-52278580 TTTATATTTTTACAGACTCATGG - Intergenic
1191183833 X:57589548-57589570 TTTCTGTTTTAAGAAACCCTGGG - Intergenic
1191235720 X:58132213-58132235 TTTCTATTGTTAGAATGCCCAGG - Intergenic
1191244563 X:58215797-58215819 TCTCTATTTTTACAATGCCTGGG - Intergenic
1192819785 X:74632658-74632680 TTTTTATTTTTACAGAACCAAGG - Intergenic
1192899689 X:75483285-75483307 TCTCTTTTTTAACAAACCCGTGG - Intronic
1193928399 X:87520333-87520355 TTTCTTTTTTAAAAAACCACTGG - Intronic
1195525405 X:105883441-105883463 TTGCTATTTCCATAAACCCCTGG - Intronic
1195932939 X:110096946-110096968 TTTCTGTTTCTATAAACCCCTGG - Intronic
1196819041 X:119688406-119688428 TTTTTATTTTGAAAAATCCCAGG + Intronic
1197177825 X:123503715-123503737 TTTTAATAATTACAAACCCCTGG - Intergenic
1198516431 X:137412976-137412998 TTTCTATTTTTAAAAGCCTGTGG - Intergenic
1199122511 X:144072823-144072845 ACTCTATTTTTACAAAATCCAGG + Intergenic
1201078106 Y:10201477-10201499 TTTCCTTTTTGACAAACCACTGG + Intergenic
1201275216 Y:12290764-12290786 TTTCAAGTTTTAAAAAACCCAGG + Intergenic
1201344647 Y:12968974-12968996 TTTGTATTTTTAGTAAACCCAGG - Intergenic