ID: 908693584

View in Genome Browser
Species Human (GRCh38)
Location 1:66810978-66811000
Sequence CTTTGATGACAGAAGGGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908693584_908693591 11 Left 908693584 1:66810978-66811000 CCAAGGCCCTTCTGTCATCAAAG 0: 1
1: 0
2: 0
3: 25
4: 234
Right 908693591 1:66811012-66811034 CCTCAGTTGTCTGGCTTCTTCGG 0: 1
1: 0
2: 2
3: 17
4: 230
908693584_908693588 2 Left 908693584 1:66810978-66811000 CCAAGGCCCTTCTGTCATCAAAG 0: 1
1: 0
2: 0
3: 25
4: 234
Right 908693588 1:66811003-66811025 TTGGTGCCTCCTCAGTTGTCTGG 0: 1
1: 0
2: 1
3: 9
4: 141
908693584_908693592 20 Left 908693584 1:66810978-66811000 CCAAGGCCCTTCTGTCATCAAAG 0: 1
1: 0
2: 0
3: 25
4: 234
Right 908693592 1:66811021-66811043 TCTGGCTTCTTCGGTTCTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908693584 Original CRISPR CTTTGATGACAGAAGGGCCT TGG (reversed) Intergenic
900147977 1:1166657-1166679 CTTTGAGAAGAGAAGGGGCTGGG + Intergenic
900508528 1:3043842-3043864 CTTTCATGAAAGAAGGTCCATGG - Intergenic
900542791 1:3212476-3212498 CTGTGAGGAGAGAGGGGCCTTGG - Intronic
902160935 1:14529904-14529926 CTTTTATGACAAAAGCACCTGGG + Intergenic
902193912 1:14783773-14783795 CCTGGAAGACAGAAGGGCATGGG + Intronic
903995550 1:27303398-27303420 CTTTGATGCCAGGAGGGCCCTGG - Intronic
904199679 1:28811933-28811955 CTTTGGTGTCAGAGGGACCTGGG - Intergenic
904923649 1:34028842-34028864 CTGAGATGACAGAAGGTGCTTGG - Intronic
905307552 1:37029987-37030009 TTTTGATGTCAGAATGACCTAGG - Intronic
906848891 1:49226089-49226111 CTTTGTTAACAGATGGACCTGGG - Intronic
907238061 1:53064865-53064887 CTTTAGAGACAGAAGGGCATGGG - Intronic
907715022 1:56918543-56918565 CTTACATGGCAGAAGGGGCTAGG + Intergenic
908693584 1:66810978-66811000 CTTTGATGACAGAAGGGCCTTGG - Intergenic
909356698 1:74717724-74717746 CTTTGAAGACAGAACAGCCTGGG - Intronic
910344502 1:86220320-86220342 CTTTGAGGATAGCAGGGCATTGG + Intergenic
910830829 1:91461510-91461532 CTTTCATTCCTGAAGGGCCTGGG + Intergenic
911597600 1:99814593-99814615 CTTTGTTGACAGAAGTCCATAGG - Intergenic
912750263 1:112281725-112281747 TTTTTATGACAGTAGGGACTTGG - Intergenic
915033516 1:152903890-152903912 CTTTGCTGTCAGACAGGCCTGGG - Intergenic
916055865 1:161068736-161068758 CTTTGAAGCCAGAAGGACCAGGG - Intronic
916492784 1:165316417-165316439 CTTTGAGGACTGGAGGTCCTGGG + Intronic
916556399 1:165897614-165897636 CTTTGAAGTCAGAGGGCCCTGGG - Intronic
918060131 1:181053791-181053813 CTGGGATCACAGAAGGACCTGGG + Intronic
918551352 1:185746201-185746223 CTTTCATGAAAGAAGAGCATAGG + Intronic
920782973 1:209012420-209012442 CATTCCTGACAGCAGGGCCTTGG - Intergenic
921262710 1:213397922-213397944 CCGTGGAGACAGAAGGGCCTGGG + Intergenic
923810805 1:237313294-237313316 CTTATATGACAAAAGGGACTTGG + Intronic
1062861073 10:809949-809971 ATGTGATGACAGGAGGGCCTGGG + Exonic
1067287662 10:44918831-44918853 ATTGTATGATAGAAGGGCCTAGG - Intronic
1068338283 10:55667187-55667209 CTTTGAAGAGGGAGGGGCCTAGG - Intergenic
1070346976 10:75553762-75553784 TTTTTATGAGAGAAGGGCCTGGG + Intronic
1071162557 10:82766840-82766862 ATGGGAAGACAGAAGGGCCTAGG - Intronic
1071965171 10:90844846-90844868 AATTGATGCCAGATGGGCCTGGG - Intronic
1073467073 10:103700515-103700537 CCATGATGACAGACAGGCCTGGG + Intronic
1075566879 10:123511625-123511647 CTTTGAGGACAGAAGGTGCTCGG - Intergenic
1076255718 10:129022894-129022916 CTTTGATAAAAGAGTGGCCTGGG - Intergenic
1077350156 11:2089467-2089489 ATTTGATGACAGAGGGGCGGAGG + Intergenic
1077667747 11:4129174-4129196 CTTTGAAGGCAGAAGGGTTTAGG + Intronic
1079144649 11:17839915-17839937 CCTTGAAGTCAGAAGGACCTAGG - Intronic
1081910196 11:46695491-46695513 CTTTGAAGTCAGAAAGCCCTGGG - Intronic
1083594312 11:63911772-63911794 CACTGAGGACAGAAGGGACTAGG - Exonic
1084709252 11:70833938-70833960 CCTTCCTGGCAGAAGGGCCTGGG - Intronic
1087069957 11:94068560-94068582 AAGTGATGACAGAAGAGCCTGGG + Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089630291 11:119780042-119780064 CTCTGATGAGAGCAGGGGCTTGG + Intergenic
1090510759 11:127372302-127372324 CTTTGATATCACAAGGACCTTGG + Intergenic
1093434858 12:19125230-19125252 CACTGAAGACAGAATGGCCTTGG + Intergenic
1093981208 12:25477666-25477688 CTTTCATTCCTGAAGGGCCTGGG + Intronic
1094412463 12:30181544-30181566 CTTGGAGGTGAGAAGGGCCTTGG - Intergenic
1095955968 12:47806268-47806290 CTTTGCGGTCAGATGGGCCTGGG + Intronic
1097319209 12:58207007-58207029 CTGTGATGACAGGAGGCTCTTGG - Intergenic
1099890537 12:88584167-88584189 TTATGAGGACAGAAGGGCCTTGG - Intergenic
1101540563 12:105661058-105661080 CAGTGAGGACAGAAGGGACTAGG - Intergenic
1103179903 12:118901547-118901569 CTTAGATGACAGAAATGACTGGG - Intergenic
1106626628 13:31427286-31427308 CTTAGAACACAGAAGAGCCTGGG - Intergenic
1106770881 13:32959531-32959553 CTTTGCTGACAGAAGCTCCTGGG - Intergenic
1107667625 13:42708286-42708308 CTTTGATGTCAGAATATCCTAGG - Intergenic
1111288922 13:86136033-86136055 CTTTGACCAAAGAAGGGCCATGG + Intergenic
1113343889 13:109454516-109454538 CTTGGCTGAAAGAAGGGCCATGG + Intergenic
1113592930 13:111513279-111513301 CTCTGAGGGCAGAAGGGACTTGG + Intergenic
1114743844 14:25125363-25125385 CTTTGGAGACAGATGGGCTTGGG - Intergenic
1116553158 14:46268254-46268276 CTTTAATGATAAAAGGGACTTGG + Intergenic
1117105567 14:52394488-52394510 CTTTGAGGACAGCCTGGCCTGGG - Intergenic
1117831398 14:59754870-59754892 CTGTGAAGACAGCATGGCCTTGG - Intronic
1121248485 14:92482341-92482363 CTTTGAAGACAGACAGCCCTGGG - Intronic
1123908207 15:24941493-24941515 CTTTGATTTCTGAAGGGTCTAGG + Intronic
1124238665 15:28012292-28012314 CAGCTATGACAGAAGGGCCTTGG + Intronic
1124452314 15:29806526-29806548 CTTTGCTCACAGAAGGAACTTGG - Intronic
1124615642 15:31239951-31239973 CTCAGATAATAGAAGGGCCTTGG - Intergenic
1127551593 15:60044052-60044074 CTTTGAGGTCAGAAAGTCCTAGG - Intronic
1128067392 15:64773877-64773899 CCTTGATGCCAAAAGGCCCTTGG - Intronic
1128078938 15:64844809-64844831 CTCTGATGAGATAAGGGCTTGGG - Intronic
1128341369 15:66824726-66824748 CTGGGATGACAGAGGGGACTTGG - Intergenic
1128744727 15:70105571-70105593 CTTTGGAGACAGAGGGGCCTGGG - Intergenic
1129686343 15:77688180-77688202 CTCTGAAGACAGCAGGGCCAGGG + Intronic
1129902406 15:79161091-79161113 CTTTAATTACAAAGGGGCCTGGG + Intergenic
1130043501 15:80426261-80426283 CTTTGGTCACAGAAGGAGCTAGG - Intronic
1130575569 15:85090162-85090184 CTTTGGTGTCAGACGGGCCTGGG + Intronic
1131077922 15:89509890-89509912 CTTTCATGACAGAAGGGGAGAGG - Intergenic
1131133382 15:89913910-89913932 CTTTGAAAACAAAAGTGCCTAGG - Intergenic
1131363657 15:91818367-91818389 CTGGGGTGTCAGAAGGGCCTGGG + Intergenic
1131397615 15:92098963-92098985 CTTTGAGGTCAGACAGGCCTGGG - Intronic
1132714369 16:1283521-1283543 CTTTGGTGACAGGAAGTCCTGGG - Intergenic
1133860737 16:9592575-9592597 CTATGGTGACAGAAGGGGATGGG + Intergenic
1133860895 16:9594297-9594319 CTTTGAAGGCAGAGAGGCCTGGG - Intergenic
1137610476 16:49814138-49814160 CTTCGGAGACAGAAGGCCCTGGG + Intronic
1139492635 16:67294613-67294635 ATGTGGTGACAGAAGGGCCAGGG - Exonic
1140696636 16:77541162-77541184 CTTTAAAGACACAAGGGGCTTGG - Intergenic
1141002153 16:80318156-80318178 CTTTGTAGATAGAAGGTCCTTGG - Intergenic
1141367562 16:83457377-83457399 CTTTGAAGTCAGAAGGACATAGG + Intronic
1141499821 16:84436331-84436353 CTTTGTTTAGAGGAGGGCCTGGG + Intronic
1142261817 16:89046336-89046358 TTTTGGTGTCAGAAGGACCTAGG - Intergenic
1143111095 17:4553291-4553313 CTTCGGTGACAAAAGGGCCTAGG + Intronic
1143516515 17:7421785-7421807 CTTGGAACCCAGAAGGGCCTAGG - Intergenic
1143555447 17:7656992-7657014 TTTGGGTGACAGAACGGCCTAGG - Exonic
1143858415 17:9869899-9869921 TTTTGAAGGCAGAAGGGCCAAGG + Intronic
1145913084 17:28553794-28553816 CCTTCATGACAGCAGGGGCTAGG + Exonic
1147268017 17:39246596-39246618 AGTTGGTGACAGATGGGCCTGGG - Intergenic
1149046504 17:52252248-52252270 CTTTGAAGATAGATGGACCTGGG + Intergenic
1149582130 17:57758031-57758053 CTTAGATGGGAGCAGGGCCTTGG + Intergenic
1151263079 17:72931944-72931966 CTGTGGTGAGAGCAGGGCCTGGG - Intronic
1152280751 17:79383743-79383765 CCTGGATGACTGTAGGGCCTGGG + Intronic
1152369634 17:79878316-79878338 CCTTGATTACAGGAGGCCCTGGG - Intergenic
1152605201 17:81286106-81286128 CCTTGGTGACAGCAGGGCCCTGG - Intronic
1153986262 18:10353277-10353299 CTTTGATCAGAGAAGGACCTGGG + Intergenic
1154055837 18:11013303-11013325 CTTTGAAGACAGAAGGGGCCAGG + Intronic
1155726260 18:29088015-29088037 CTGTGACGACAGAAGTGGCTAGG + Intergenic
1156634591 18:39012002-39012024 CTTTTATGACAGAAATCCCTAGG + Intergenic
1157509126 18:48255677-48255699 CTTTATAGACAGAAGGGCCCAGG - Intronic
1159632351 18:70763656-70763678 CTTTGCTGGCAGAAGGTCCCAGG + Intergenic
1161044814 19:2129164-2129186 CTGTGGGGACAGCAGGGCCTCGG + Intronic
1161321121 19:3641989-3642011 CTGTGGTGCCAGCAGGGCCTGGG + Intronic
1162489882 19:10985802-10985824 CCCTGATGACAGCAAGGCCTTGG - Intronic
1163184113 19:15624265-15624287 CTTTGGGGACAGAATGGTCTGGG + Intronic
1163695580 19:18761752-18761774 CTTTGGTGCCAGCAGGGCCAGGG + Intronic
1164251578 19:23482016-23482038 CTTTGTTGACAGATCAGCCTGGG - Intergenic
1165894089 19:39131268-39131290 CTTTGTTGACAGAAGTTCCGTGG + Intronic
925926003 2:8671172-8671194 CTTTGAGGTCAGATGGGCGTGGG + Intergenic
926109772 2:10174343-10174365 CTCTGCTGACAGCAGGGCCAGGG - Intronic
926572583 2:14545556-14545578 CTTGAATTTCAGAAGGGCCTAGG - Intergenic
928394982 2:30936679-30936701 CTTTAATGAATGAAGGGACTTGG + Intronic
929790071 2:45015685-45015707 CTTTGGTGTCAGACAGGCCTGGG + Intergenic
930309162 2:49716047-49716069 CTTTCATGACAGAAGGCAATGGG + Intergenic
930369679 2:50487265-50487287 CTTTGACGTCAGAAAGACCTGGG - Intronic
932327426 2:70872351-70872373 CTTTGATGAGGGACGGGGCTGGG - Intergenic
932450177 2:71804752-71804774 CTTTGATGAGAGATGACCCTGGG + Intergenic
934014390 2:87863471-87863493 CCTTAATTCCAGAAGGGCCTAGG - Intergenic
934957360 2:98633630-98633652 GTTTGATTACACAAGGTCCTAGG + Intronic
936068946 2:109352840-109352862 CTTTGCTGTCAGAAGGGGCTGGG - Intronic
936396236 2:112133837-112133859 CTTTGAAGTCAGACGTGCCTCGG - Intergenic
941700537 2:168599916-168599938 CTTTGATGTCAGAATCACCTGGG + Intronic
941722926 2:168831234-168831256 CTCAGATGGCAGAAGGGGCTAGG + Intronic
942247765 2:174023692-174023714 CAGAGACGACAGAAGGGCCTGGG + Intergenic
942489692 2:176476969-176476991 CCTTGATGTCAGAGGGGCCTTGG - Intergenic
942653145 2:178189679-178189701 CTTTGAGGGCTGAGGGGCCTTGG - Intergenic
945509297 2:210681016-210681038 TTTTGTTGACAAAAGGGCTTTGG + Intergenic
946957283 2:224944841-224944863 CTTCGACGACAGAAGGCACTGGG - Intronic
948693616 2:239721799-239721821 CGTTGATCACACCAGGGCCTGGG - Intergenic
948788871 2:240366754-240366776 CTTTGTCGGCAGAGGGGCCTGGG + Intergenic
1168949493 20:1786855-1786877 CGTTGGTGACAGCAGGGACTGGG - Intergenic
1169006659 20:2213043-2213065 CTCTGATGACTGAAGAGCCTTGG + Intergenic
1169116462 20:3069450-3069472 TTTTTATTACAGAAGGCCCTGGG + Intergenic
1169892883 20:10472595-10472617 CTTTGGAGGCAGAAAGGCCTGGG + Intronic
1172657771 20:36547530-36547552 CTTTGCTGTCAGACAGGCCTGGG - Intronic
1172802242 20:37584356-37584378 CTTTGGTGTCAGAAGGGGTTAGG + Intergenic
1173186610 20:40845062-40845084 CTTTGAAGGGAGAAGGGGCTGGG - Intergenic
1175899440 20:62354261-62354283 CTGTGCGGAGAGAAGGGCCTGGG - Intronic
1176148203 20:63574652-63574674 GGTTGGTGACAGAAGGGACTTGG - Intergenic
1176932726 21:14832326-14832348 CTATGAAGACAAAAGTGCCTGGG + Intergenic
1178665605 21:34543784-34543806 CTTGGGTGTCAGATGGGCCTGGG + Intronic
1179310761 21:40194061-40194083 ATTTGATGAGAGAAGTACCTTGG + Intronic
1182151525 22:28030438-28030460 GTTTGGTGACAGAATGGCATAGG - Intronic
1182622273 22:31624686-31624708 CTTTGCTGAAAGGAGGGGCTTGG - Intronic
1182852342 22:33486067-33486089 CTTTGCTGGCAGAAGTGCCAGGG - Intronic
1183018237 22:35007328-35007350 TTTTGCAGACAGAAGGGCTTGGG - Intergenic
1185175855 22:49326177-49326199 AGTTGAGGAGAGAAGGGCCTGGG - Intergenic
950496135 3:13335648-13335670 TTTTGAGGACACAGGGGCCTGGG - Intronic
950874680 3:16260781-16260803 CTTTGTTGGCTGAAGGGGCTGGG + Exonic
951750348 3:26028107-26028129 CTCTGAGGACAGAAGGGACTAGG - Intergenic
953811370 3:46115638-46115660 CTTTAAAGACAGAAGGGCCAGGG + Intergenic
955043152 3:55336097-55336119 CCCTGATGACAGAGGGGTCTTGG + Intergenic
955774490 3:62418795-62418817 CTTTCAAGGCAGGAGGGCCTTGG - Intronic
956596934 3:70977900-70977922 TTGTGATGACAGAGGGGCCTTGG + Exonic
960054111 3:113264528-113264550 CTTTGCAGACAAAGGGGCCTGGG + Intronic
960212408 3:114985979-114986001 CTTTGTTTACAGAAGGGGGTGGG + Intronic
960604519 3:119491082-119491104 CTTTCATGACAGGAGGAGCTAGG + Intronic
960807796 3:121600686-121600708 GTTTGAAGACAGACAGGCCTAGG + Intronic
961621424 3:128227729-128227751 CTTTGCTGCCAGTGGGGCCTTGG + Intronic
961828960 3:129613484-129613506 CTTTGCTGACAGCAGGGGCTGGG + Intergenic
964569955 3:158099653-158099675 CCATGAGGACAGAAGGGACTAGG + Intronic
967046184 3:185739448-185739470 TTTTGATAACAGAAGGGTTTAGG - Intronic
968081709 3:195850797-195850819 CTTTGGTGACAGGAAGACCTGGG + Intergenic
968532868 4:1104441-1104463 CTGTGGTGACAGAAGGGCAGTGG + Intronic
969175521 4:5395987-5396009 CATTAATGACAGCATGGCCTTGG - Intronic
971400766 4:26273551-26273573 CTTAGATTCCAGAATGGCCTCGG - Intronic
971460387 4:26889744-26889766 CGTTCATGACAGAAGTGGCTAGG + Intronic
971542541 4:27837935-27837957 CTCTGATAACAAAAGGGGCTTGG + Intergenic
973038989 4:45446802-45446824 CCTTGATGAGAAAAGGGGCTTGG - Intergenic
974179662 4:58367604-58367626 CTTTGATGTTAGAAGTTCCTAGG - Intergenic
981801851 4:148666885-148666907 CTTGGAAGAAAGAATGGCCTGGG - Intergenic
985966557 5:3342629-3342651 CTCTGATGACAGCGGTGCCTCGG + Intergenic
986054608 5:4123854-4123876 CTTTCTAGACAGAAGTGCCTAGG + Intergenic
986425924 5:7631460-7631482 CTTGAAAGACAGAAGGGCCCTGG - Intronic
986653254 5:9985974-9985996 CTTTCATGATATAAGGGACTAGG - Intergenic
986788664 5:11139516-11139538 CTTGGATGATAGAAGAGCCTGGG + Intronic
989538059 5:42586734-42586756 CTTTGAGGTCAGTGGGGCCTTGG - Intronic
990628559 5:57641845-57641867 CTTTGGTGACAGAGATGCCTGGG + Intergenic
992407450 5:76473093-76473115 CTTTGAAGTCAGAAAGACCTAGG - Intronic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
994856425 5:105126864-105126886 CATTTATGAAAGAAGGGCATAGG - Intergenic
995841931 5:116450535-116450557 CTTTCATGTCTGAAGGTCCTTGG + Intronic
997045980 5:130317908-130317930 CTTTGATGCCATGAGGGCATTGG + Intergenic
997743818 5:136280983-136281005 CTTTGATGTCAAACTGGCCTGGG - Intronic
998845796 5:146308566-146308588 CTTTGTTCTCAGCAGGGCCTAGG + Intronic
999008666 5:148010167-148010189 CTTTGGAGACAGAAGAGTCTGGG + Intergenic
999090075 5:148928223-148928245 CTTTGATGCCAGACAGGCCTTGG + Intronic
999466077 5:151806455-151806477 CTCTGATGACAGAAAGCACTGGG - Exonic
1001165926 5:169366878-169366900 CTATGATGACTGAAGAGCCGAGG - Intergenic
1001403521 5:171460518-171460540 CTCTAGAGACAGAAGGGCCTGGG - Intergenic
1001427211 5:171630470-171630492 CTTTGGGGACAGACGGGACTGGG + Intergenic
1001520546 5:172388974-172388996 CTTAGAAGACAGAAGAGTCTGGG + Intronic
1001948896 5:175802276-175802298 CTTTGATCACAGGAGAACCTAGG - Intronic
1002292563 5:178209806-178209828 CTTTGGAGTCAGAGGGGCCTGGG - Intronic
1003707800 6:8554130-8554152 CCTTGATTACAGAAGGTGCTAGG + Intergenic
1005945231 6:30590436-30590458 CCTTCACTACAGAAGGGCCTAGG + Intronic
1009825272 6:68858689-68858711 CTTTGATAAGAGAATGGCTTGGG + Intronic
1011917563 6:92526907-92526929 CTTTGCTGAGAGCAGGGCATTGG - Intergenic
1012547866 6:100440319-100440341 CTTTAGTGCCAGATGGGCCTGGG - Intronic
1012627939 6:101427089-101427111 CTTGGATGGCAGGAAGGCCTTGG + Intronic
1012719016 6:102717468-102717490 CTTTGGACACAAAAGGGCCTTGG + Intergenic
1013771382 6:113631756-113631778 AATTAATGACAGAAGGGCCAAGG - Intergenic
1014535063 6:122605104-122605126 CTTGGGTGACAGAGTGGCCTAGG - Intronic
1016714827 6:147212757-147212779 CTTTGTTTACAGAAGGGACCAGG + Intronic
1016883136 6:148930992-148931014 CTTTGATGAGAGAGGAGTCTTGG + Intronic
1017906423 6:158760110-158760132 CACTCATGACAGAAGTGCCTCGG + Intronic
1018021167 6:159762959-159762981 CTTTGATGACAGTGGAGCCCAGG - Exonic
1018590759 6:165419107-165419129 CTTGGATGGCAGAAGGGCACTGG - Intronic
1018810490 6:167294847-167294869 CTTTGGTGACAGACGGTGCTGGG + Intronic
1021871566 7:25012001-25012023 TAAAGATGACAGAAGGGCCTTGG + Intergenic
1023623772 7:42096803-42096825 CTTTGATGGCACCAGGCCCTTGG - Intronic
1025982941 7:66422267-66422289 CTTTCATGGCAGATGGGCCAAGG - Intergenic
1026032097 7:66803259-66803281 CTTTCATGGCAGATGGGCCTAGG + Intronic
1026396820 7:69963805-69963827 CTTTGAAGACTGAAGGCCCCTGG - Intronic
1030353177 7:108512975-108512997 CTTAGATGGCAGAAGGGGCAAGG - Intronic
1030572069 7:111239326-111239348 CTTTGTTGAAATTAGGGCCTAGG - Intronic
1030773856 7:113509113-113509135 CTTTGGAGTCAGAAGGACCTGGG - Intergenic
1032000897 7:128264831-128264853 CTTTGAGGAGAGAAGGTGCTGGG - Intergenic
1032410114 7:131688597-131688619 GTCTGAGGACAGCAGGGCCTGGG - Intergenic
1032544530 7:132730706-132730728 GTTAGATGAAAGAAGGGGCTGGG + Intergenic
1041254944 8:55971990-55972012 CCTCGGTGACAGGAGGGCCTGGG + Intronic
1041753977 8:61292533-61292555 CTTTGAAGACAGAAGGGTCAAGG + Intronic
1042454184 8:68981098-68981120 CCTTGGTGACAGAAAGACCTGGG + Intergenic
1043448334 8:80340963-80340985 CTTTGATAACAGAATGTGCTAGG - Intergenic
1044599700 8:93991513-93991535 CTTTGATTTCAGCAGGGACTGGG + Intergenic
1044668109 8:94651592-94651614 TTTTGATGACAAAAGGGTTTAGG + Intronic
1045874801 8:106967375-106967397 CTTTGATTACTGAAGAGGCTGGG + Intergenic
1046430260 8:114115002-114115024 CTTACATGACAAAAGGGGCTTGG - Intergenic
1046853716 8:119005414-119005436 CTTTGATGACAGAGAAGCCCTGG - Intronic
1046934372 8:119872653-119872675 CTTTGAAGCCAGAATTGCCTCGG + Intergenic
1048111129 8:131470263-131470285 AGTTGATGACTGAAGGCCCTAGG + Intergenic
1048616851 8:136084365-136084387 CTTTGATGCCAGACAGGCCCAGG + Intergenic
1048646848 8:136430181-136430203 CTTTGAGGACACAAAGGCATAGG + Intergenic
1048864072 8:138746569-138746591 CTTTGATGACTGAAAGGCCATGG + Intronic
1049226026 8:141450882-141450904 CTTTGGAGTCAGAAGGGTCTAGG + Intergenic
1049476393 8:142798973-142798995 GTTTGGAGACAGAAGGCCCTGGG + Intergenic
1052411527 9:28127828-28127850 GTTTGATGTCAGAAAGACCTGGG + Intronic
1052811287 9:33062978-33063000 CTTTGGAGACAGATGGTCCTAGG + Intronic
1054874974 9:70086575-70086597 CATTGATCACAGAAGGGGCTGGG - Intronic
1055292438 9:74796595-74796617 CTGTGATGACATATGGTCCTGGG - Intronic
1055324903 9:75119021-75119043 CTTTGGGGACAGCAGGGTCTGGG - Intronic
1057346408 9:94254831-94254853 CTATGATAACAGAAAGGCCAGGG - Intergenic
1057445104 9:95108366-95108388 GTTAGATGGCAGAATGGCCTTGG - Intronic
1186663829 X:11698489-11698511 CTTTGAAGTCAGCAGGACCTGGG - Intergenic
1190382310 X:49851782-49851804 CTTTGCCTACAGTAGGGCCTAGG + Intergenic
1194584366 X:95714930-95714952 CTTTCATTTCAGAAGGGTCTGGG - Intergenic
1195020936 X:100827725-100827747 CTTTCATGACAGGAGGTCCATGG + Intronic
1197649773 X:129051939-129051961 CTTAGCTGACAGCAGGGCCCGGG + Intergenic
1198510260 X:137343359-137343381 CTTTGATGACAGAGGAGGCAAGG - Intergenic
1198977258 X:142350663-142350685 CTTTGATGAGAGAAGGGGAATGG - Intergenic
1199130084 X:144175002-144175024 CCTTAATTCCAGAAGGGCCTAGG + Intergenic