ID: 908693626

View in Genome Browser
Species Human (GRCh38)
Location 1:66811297-66811319
Sequence ATGCTTTTATAGAAGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 865
Summary {0: 1, 1: 0, 2: 7, 3: 79, 4: 778}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908693624_908693626 -8 Left 908693624 1:66811282-66811304 CCTTTTCTAAGTCCTATGCTTTT 0: 1
1: 0
2: 2
3: 36
4: 412
Right 908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG 0: 1
1: 0
2: 7
3: 79
4: 778

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908693626 Original CRISPR ATGCTTTTATAGAAGAAAAA TGG Intergenic
900874074 1:5329016-5329038 ATATTTTTTAAGAAGAAAAATGG - Intergenic
904550188 1:31310055-31310077 TAGCTTTAATAGAAGAGAAATGG + Exonic
905721410 1:40205790-40205812 ATGTCTTGAAAGAAGAAAAATGG - Intronic
905757951 1:40527785-40527807 TTGATCTTATAGAAGTAAAAAGG + Intergenic
905951719 1:41957514-41957536 ATGCTTTTATAGAGCATAAAGGG - Intronic
906224124 1:44106872-44106894 AGGAATTTAGAGAAGAAAAAAGG + Intergenic
908287671 1:62625391-62625413 ATTCTTTTGTAGAACGAAAAGGG - Exonic
908693626 1:66811297-66811319 ATGCTTTTATAGAAGAAAAATGG + Intergenic
909021895 1:70440881-70440903 AAAGTTTTATAGCAGAAAAAAGG + Intergenic
909168850 1:72267345-72267367 ATTCTTATATAGGAGAAGAAAGG + Intronic
909273669 1:73656975-73656997 ATGCTTTTCTACAAGAAAATGGG + Intergenic
909345640 1:74583013-74583035 ATTGTTTTAAAGGAGAAAAATGG - Intronic
909592362 1:77365152-77365174 ATTTTTTAAAAGAAGAAAAATGG - Intronic
910070728 1:83210207-83210229 AGGCTTGAATAGAAGAAAAAAGG - Intergenic
910375936 1:86570574-86570596 ATGCTTATAAAGAAAAAATATGG - Intronic
910535244 1:88290142-88290164 TTTCCTTTATAGAACAAAAAAGG - Intergenic
910929146 1:92425444-92425466 ATATATTTATAGTAGAAAAATGG - Intergenic
911089684 1:94008669-94008691 ATTGTTCTATAGAAGGAAAATGG + Intronic
911341196 1:96640609-96640631 AAGTTTTTAGAGAAGAATAATGG - Intergenic
911366091 1:96939114-96939136 ATGATTTCATGAAAGAAAAAGGG - Intergenic
911602960 1:99867117-99867139 ATACTTTTTTAAAAGAAAACTGG - Intronic
912049480 1:105507806-105507828 AAGCTTTTATACGAGAGAAAAGG - Intergenic
912478008 1:109953996-109954018 ATGGCATTATAGAAGAAAAATGG + Intergenic
912891520 1:113537466-113537488 AACCTTGTACAGAAGAAAAATGG + Intronic
913574487 1:120157190-120157212 ATGCTGTCAAAGAGGAAAAAAGG + Exonic
914295756 1:146321994-146322016 ATGCTGTCAAAGAGGAAAAAAGG + Intergenic
914556795 1:148772792-148772814 ATGCTGTCAAAGAGGAAAAAAGG + Intergenic
914616039 1:149357438-149357460 ATGCTGTCAAAGAGGAAAAAAGG - Intergenic
915278266 1:154804710-154804732 ATGCTTTCATATATGTAAAAGGG - Intronic
916245201 1:162680821-162680843 GTGTTTTTATAGAAGAAGACTGG - Intronic
916471987 1:165132924-165132946 ATGCTGGGATGGAAGAAAAAAGG + Intergenic
916810070 1:168297642-168297664 CTGGTTTTACAGAAGACAAAGGG + Intronic
917078614 1:171233703-171233725 ATGCTCTTAGATAAGAAAACAGG + Intergenic
917362236 1:174189665-174189687 TTGCTTTTTAAGAAGAGAAAGGG + Intronic
917736497 1:177925874-177925896 ATTCTTTTCAAGAAGAAAGAGGG + Intronic
917956623 1:180106000-180106022 ATGCCTTTGTGAAAGAAAAAGGG - Intronic
918028800 1:180782439-180782461 ATGCTTGCAAAGAAGAAAAGAGG - Intronic
918300895 1:183203010-183203032 ATGCTTTTGAAAAAGGAAAAAGG - Intronic
918355240 1:183701626-183701648 ATTATTTTAAAAAAGAAAAATGG - Intronic
918496211 1:185140262-185140284 ATAATTTTAAAGAATAAAAATGG + Intronic
918658522 1:187060009-187060031 GTACATTTAGAGAAGAAAAAAGG + Intergenic
918768854 1:188525942-188525964 ATGCATTTTTAAATGAAAAATGG + Intergenic
919042967 1:192415298-192415320 ATGTTATTATAGAACACAAAGGG + Intergenic
919313021 1:195935795-195935817 ATGATTTCACTGAAGAAAAACGG + Intergenic
919528705 1:198687522-198687544 ATGCCTTTATATATGAAACAAGG - Intronic
919667819 1:200309474-200309496 ATTATTTTATGGGAGAAAAAAGG + Intergenic
920157989 1:203971143-203971165 ATAAATTTATAGACGAAAAAGGG + Intergenic
920958032 1:210637177-210637199 TTATTTTGATAGAAGAAAAATGG - Intronic
922130900 1:222776685-222776707 AAGCTTTTATAGAAGACTAAAGG + Intergenic
922224172 1:223630926-223630948 AGGTGTTCATAGAAGAAAAATGG - Intronic
923729765 1:236538980-236539002 ATACTTTGATAAATGAAAAATGG + Exonic
923913478 1:238476545-238476567 ATGTGTTAATAGAAGAAGAAAGG - Intergenic
924004712 1:239596091-239596113 ATGTTTTAATAAAAGAGAAATGG - Intronic
924409922 1:243793945-243793967 ATGGTTACATAGCAGAAAAATGG + Intronic
1063194466 10:3728593-3728615 TTCCTTTTGTAGGAGAAAAATGG - Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1063656090 10:7990597-7990619 ATACATTAAAAGAAGAAAAATGG + Intronic
1064229804 10:13520169-13520191 CTACTTTTATATGAGAAAAATGG - Intronic
1064332999 10:14411285-14411307 CTGCTTTCTTGGAAGAAAAAAGG - Intronic
1064637532 10:17385050-17385072 AAGATTTTAAAAAAGAAAAAGGG + Intronic
1064779650 10:18820959-18820981 ACCCTTTTATGGAAGGAAAATGG - Intergenic
1064886338 10:20116547-20116569 AAGGTTTAATAGAAGTAAAAAGG + Intronic
1064977176 10:21129551-21129573 ATGCTTTTGTATAAGTGAAATGG + Intronic
1065187483 10:23183091-23183113 GTGCTTTCATTGAAGAAATATGG + Intergenic
1065202394 10:23325821-23325843 ATGCTGTAATAAATGAAAAAAGG + Intronic
1065226589 10:23549575-23549597 ATGGTTTTATAACAGAATAAAGG - Intergenic
1066428532 10:35331327-35331349 ATACTTTTCAAGAAGAGAAATGG - Intronic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1067738731 10:48879461-48879483 TTGCTTTAATAGGAGAACAATGG + Intronic
1067846949 10:49732046-49732068 ATGTTATTATTGGAGAAAAATGG - Intergenic
1067975397 10:51019233-51019255 ATGATTTTATATAATAAAGATGG + Intronic
1067983055 10:51109277-51109299 ATGTTTAAAAAGAAGAAAAAAGG + Intronic
1068371470 10:56121754-56121776 ATGCTTTTATTCAATAACAAAGG - Intergenic
1069758761 10:70792934-70792956 ATTCCATTCTAGAAGAAAAAGGG - Intergenic
1070311146 10:75275134-75275156 ATCCTTTTCTGGAAAAAAAAAGG - Intergenic
1070621465 10:78015199-78015221 ATGGGTTCATCGAAGAAAAATGG + Intronic
1070859011 10:79634341-79634363 CTGACTTAATAGAAGAAAAAAGG + Intergenic
1071164716 10:82792083-82792105 GAGTGTTTATAGAAGAAAAAAGG - Intronic
1072624680 10:97103556-97103578 AAACGTTTAGAGAAGAAAAAAGG - Intronic
1072760460 10:98052109-98052131 ATGCTTTGAAAGAAGGAAATGGG - Intergenic
1072920935 10:99576781-99576803 ATACTTTTATAAAAGCAAAATGG - Intergenic
1073011814 10:100366011-100366033 ATCCTTTTATGGAAAAAAGAAGG + Intergenic
1073197015 10:101699953-101699975 ATGCTATTATAGAGGAATAATGG - Intergenic
1073897767 10:108183260-108183282 ATGATTTTTTTGAAGAGAAAAGG - Intergenic
1074624836 10:115170844-115170866 ATGCTTTTATATACAAAAAGGGG - Intronic
1075791858 10:125090417-125090439 ATGATTTCATAGAAAAAATATGG + Intronic
1076018499 10:127049712-127049734 ATGCTTTTGTGAAAAAAAAATGG + Intronic
1076161848 10:128250190-128250212 ATCCTTTTAAATAGGAAAAATGG - Intergenic
1076199125 10:128544341-128544363 GTGCTGTTTTAAAAGAAAAAAGG - Intergenic
1076561090 10:131364705-131364727 ATGCTTCTACAGAAAAAAAGAGG + Intergenic
1077056115 11:594101-594123 ATGCTTAAAAAGAAAAAAAAAGG + Intronic
1077693026 11:4366343-4366365 ATACTTTTTTATGAGAAAAAAGG - Intergenic
1077753736 11:5003117-5003139 ATGCTTTAGAAGAGGAAAAAAGG + Intergenic
1077778912 11:5303451-5303473 AGGTTTTTATAAAATAAAAAAGG - Intronic
1077848172 11:6047839-6047861 CTACTTGTATAGAAGAAAAGAGG + Intergenic
1078239928 11:9522129-9522151 ATGCTTGTATTGGAAAAAAAAGG + Intronic
1078470887 11:11585728-11585750 CTGGTTTGATAGAAGAAAAATGG - Intronic
1078548803 11:12266403-12266425 ATGCATTTATAGAAATAAAGGGG - Intergenic
1078713674 11:13818884-13818906 AGGCAATTATAGAAGAAGAAAGG + Intergenic
1079029135 11:16972953-16972975 ATGGTTTTATAGAAAGAAAGTGG + Intronic
1079387271 11:19991537-19991559 AAGCTGTTATAGAAATAAAAGGG - Intronic
1079630815 11:22672521-22672543 TTGCTTTTATAGAGCAAAATAGG + Intronic
1080112443 11:28583282-28583304 ATGCTTTTACAAAAGAAAAAGGG - Intergenic
1080132122 11:28808512-28808534 TCACTTTTATAAAAGAAAAAAGG + Intergenic
1080133778 11:28828683-28828705 ATGATTTTATAGAATCAAAGAGG + Intergenic
1080428952 11:32181215-32181237 CTGCTTTTGTAAAAGGAAAAAGG + Intergenic
1080525501 11:33112671-33112693 AATCTTTTAAAGAAGGAAAATGG - Intronic
1080611020 11:33903899-33903921 ATGTATTTATAAAACAAAAATGG - Intergenic
1080701509 11:34648379-34648401 ATGCTTTTATATATGATAATGGG + Intronic
1080870382 11:36231642-36231664 ATGCTTTTTTAAAACAAACAGGG + Exonic
1081056293 11:38414029-38414051 AGGCTTTTCTAGGAGAAATAAGG - Intergenic
1081076460 11:38680039-38680061 ATCCTGTAATAGCAGAAAAATGG - Intergenic
1081250586 11:40827222-40827244 ATGCATTTATACAACTAAAATGG - Intronic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1081636361 11:44725103-44725125 ATACATTTAAAGAGGAAAAACGG - Intergenic
1081834065 11:46139347-46139369 ATGCTTTTATAAAATAAAATAGG - Intergenic
1082894516 11:58175998-58176020 TTGCATTTAAAGAAAAAAAAAGG + Intronic
1082955531 11:58866164-58866186 AAGCTTTTACAGAGGAAGAAAGG - Intronic
1082962998 11:58936943-58936965 AAGCTTTTAGAGAGGAAGAAGGG - Intronic
1083022975 11:59526112-59526134 GTGCTTTTTTAGTAGAGAAAGGG + Intergenic
1083981209 11:66172096-66172118 TTGCTTTTATAAAACAAGAATGG - Intronic
1085613709 11:77977504-77977526 ATGTATTTAAAGAAAAAAAATGG + Intronic
1085852262 11:80135819-80135841 ATGTTGGTATAGAAGATAAAAGG - Intergenic
1086079300 11:82886751-82886773 ACAATTTTATAGAGGAAAAAGGG - Intronic
1086080081 11:82894966-82894988 ATGATTTTAAGCAAGAAAAAAGG + Intronic
1086303171 11:85451914-85451936 ATGAGTTTATAGAATATAAAAGG - Intronic
1086440171 11:86821866-86821888 ATAATTTTTTAGAAGTAAAATGG + Intronic
1086578546 11:88369272-88369294 ATATTTTTATTGAATAAAAATGG + Intergenic
1086825750 11:91493707-91493729 TTGCTTAAATAGAAAAAAAAGGG - Intergenic
1086984198 11:93230757-93230779 ATATATTTATAGAAAAAAAATGG + Intergenic
1087089650 11:94255414-94255436 GTACTTTTCTGGAAGAAAAAAGG + Intergenic
1087207011 11:95407344-95407366 AGGCTTTTCTAGAGGAAACAAGG - Intergenic
1087288208 11:96290107-96290129 ATGATTTTATAGGACAAAATAGG - Intronic
1087880501 11:103409961-103409983 ATACCTTTATATAAGATAAATGG + Intronic
1088067663 11:105740804-105740826 AAGTTTAAATAGAAGAAAAAGGG + Intronic
1088216463 11:107515775-107515797 ATAGTTTAATGGAAGAAAAATGG - Intronic
1088390489 11:109309062-109309084 AAGCTTTTACAGAAGAACACAGG - Intergenic
1088610027 11:111568042-111568064 GTGGTTTTATAAAAGATAAAAGG + Intergenic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1088734395 11:112715730-112715752 AGCCTTTGAAAGAAGAAAAATGG - Intergenic
1088858250 11:113775944-113775966 TTGGTTTTATAGAAAGAAAAAGG - Intergenic
1089264496 11:117249380-117249402 ATACATTTAAAGAAAAAAAATGG - Intronic
1089520598 11:119060283-119060305 ATGGTTTTAAAAAAGATAAAAGG - Intergenic
1090148603 11:124357275-124357297 CATCTTTTCTAGAAGAAAAAAGG + Intergenic
1092657559 12:10702959-10702981 CTGCTTTTATAGGTTAAAAAAGG + Intronic
1092775758 12:11943942-11943964 ATACTTAAATAGCAGAAAAATGG + Intergenic
1092957830 12:13565920-13565942 ATGCCTCTATAGAGGAAAAAAGG - Intronic
1093000285 12:13988542-13988564 ATGCTACTCTAGAAGATAAAAGG - Intergenic
1093078807 12:14786118-14786140 ATTCTTTTATAGCTTAAAAATGG + Exonic
1093153539 12:15652816-15652838 ATGTTTCAATAGGAGAAAAATGG + Intronic
1093280994 12:17196055-17196077 ATTCTGTTATAGAAGCACAAAGG + Intergenic
1093352781 12:18124751-18124773 ATGAAGTTATAGAAAAAAAAAGG - Intronic
1093467260 12:19462490-19462512 ATGCTACAAAAGAAGAAAAAAGG - Exonic
1093469690 12:19487413-19487435 ATGCTTTTGAAAGAGAAAAAAGG + Intronic
1093582618 12:20801020-20801042 ATACTTTGATAGAAGAAATAAGG - Intergenic
1093675660 12:21936986-21937008 ATGCTTTCAAAGAACAAAAATGG + Intronic
1093896740 12:24583290-24583312 TGGCTTTTATAGGAGAAACATGG - Intergenic
1094090844 12:26647408-26647430 ATGCTGTTGTAAAAGAAAAAAGG + Intronic
1094459086 12:30673956-30673978 ATGCTTTTAAAATAGAATAATGG - Intronic
1094641567 12:32280896-32280918 ATGCTTTTTTAAAAGGACAAAGG + Intronic
1094683655 12:32688713-32688735 ATGCTTTTATGGAAGAAGTGGGG + Intronic
1095214769 12:39535070-39535092 ATCCATTTAGAGAAGCAAAAGGG - Intergenic
1095226907 12:39688008-39688030 AAACATTTATTGAAGAAAAAAGG - Intronic
1095269609 12:40202352-40202374 ATGCTTTTTTTTAAAAAAAAAGG + Intronic
1095398588 12:41789414-41789436 AACCTTCTATTGAAGAAAAATGG + Intergenic
1095511668 12:42957459-42957481 GTGCTTTTATATATTAAAAAAGG + Intergenic
1095591970 12:43913750-43913772 ATGCTTTAATAAAAGAATAAAGG + Intronic
1096249965 12:50024781-50024803 ATGCTTTCTTAAAAAAAAAAAGG + Intronic
1097481369 12:60129964-60129986 ATCTTTTTATACAAGAAAATGGG - Intergenic
1097605093 12:61743985-61744007 ATGGCTTAATAAAAGAAAAATGG - Intronic
1097669741 12:62521334-62521356 ATGATTTTAAAAAACAAAAATGG - Intronic
1097955333 12:65479483-65479505 ATGGCATTATAGAAGAAACAGGG - Intronic
1097959337 12:65517251-65517273 ATGATTTCATAGAAGAGGAAAGG + Intergenic
1098088421 12:66873819-66873841 ATAGTTTTATAGATGAAAGATGG + Intergenic
1098302681 12:69070134-69070156 ATGCTTTGTAAGAAAAAAAAAGG + Intergenic
1098561599 12:71879007-71879029 ATTCTTTTTTAAAAGAGAAAAGG - Intronic
1098838578 12:75451388-75451410 ATGCTTATATATAAGTGAAATGG - Intergenic
1099084640 12:78230378-78230400 ATGCATTCAAAGAAGAAACAGGG + Intergenic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1099306606 12:80964476-80964498 CAGCTTTTATGCAAGAAAAATGG - Intronic
1099624322 12:85049535-85049557 ATGCTTATAAACAATAAAAAAGG - Intronic
1099641748 12:85297540-85297562 TTACTTTTATAGAAAAGAAATGG + Intronic
1099681891 12:85840084-85840106 AAGTCTTTATAGAAGAAAAATGG + Intergenic
1099992877 12:89744477-89744499 TTGCTACTATATAAGAAAAATGG + Intergenic
1100503866 12:95200561-95200583 ATGCTTATATAGAACCAAAAGGG + Intronic
1100543725 12:95581588-95581610 ATGCTTTTCTCAAAGAAATAGGG + Intergenic
1100887744 12:99090699-99090721 AAGCTTTTATAGAAGCAGAGAGG - Intronic
1100910043 12:99349563-99349585 AAGTTGTTATAAAAGAAAAAGGG + Intronic
1100938224 12:99694113-99694135 ATGCTTTTATAGAAAATTATTGG - Intronic
1100938496 12:99697954-99697976 ATGCTTTTGATTAAGAAAAACGG + Intronic
1101082476 12:101202890-101202912 ATGCTTTTATAGAATAATCATGG - Intronic
1101790190 12:107919006-107919028 TCCCTTTTATAGATGAAAAAGGG - Intergenic
1101889824 12:108703216-108703238 AAGCTAATGTAGAAGAAAAAAGG + Intronic
1102123546 12:110462220-110462242 ATGCTTTTCTTTGAGAAAAAAGG - Intronic
1102860725 12:116333984-116334006 TTTCTTTAATAAAAGAAAAAAGG - Intergenic
1103613194 12:122136302-122136324 ATGCATTTATTTAAGAAAAGAGG - Intronic
1103778153 12:123381856-123381878 ATTCTTTTAGGGAAGAAACAAGG - Intergenic
1105390839 13:19976515-19976537 CTGGTTTTATAAAATAAAAAAGG - Intronic
1105656811 13:22450269-22450291 ATACATTTATAAAAGACAAAGGG - Intergenic
1105896906 13:24724234-24724256 TTGGTTTTATAGACAAAAAAGGG + Intergenic
1106045539 13:26136904-26136926 GAGCTTTTATTCAAGAAAAACGG + Intronic
1106151124 13:27103400-27103422 ATGCTTTTCTATTAAAAAAATGG + Intronic
1106332139 13:28748978-28749000 TTGCATTTATAGTAGAAACAGGG + Intergenic
1106373875 13:29164704-29164726 GTGCTTTCAAGGAAGAAAAATGG + Intronic
1106696296 13:32177415-32177437 ATTATTTTTTAGAAGAAACAGGG - Intronic
1106958210 13:34967347-34967369 TTGCTTTTTTAAAAAAAAAAAGG - Intronic
1107342551 13:39423814-39423836 ATGCTTTTATCAAAGCAACATGG + Intronic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1107490468 13:40876381-40876403 CTTATTTTAAAGAAGAAAAAAGG - Intergenic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1107858644 13:44639827-44639849 ATGATTTTTTAAAAGAAAATGGG - Intergenic
1108020424 13:46122308-46122330 ATGCTGTCCTAGAAGAATAAAGG - Intergenic
1108477725 13:50837544-50837566 ATGCTTTTATATTAGAAAAAAGG - Intronic
1108771528 13:53707755-53707777 AGGCTATTACAGAAGAAAAATGG + Intergenic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1108888310 13:55219644-55219666 CTGCATTTATAGAAAAAGAAAGG + Intergenic
1108937025 13:55894463-55894485 AGGCTTTTAGAAAAGATAAATGG + Intergenic
1109111464 13:58325718-58325740 AAGCAGTTATAGCAGAAAAAAGG - Intergenic
1109491492 13:63106458-63106480 ATGGTTTTATACAAGAAAGACGG + Intergenic
1109581917 13:64351118-64351140 ATAGTTTTATAGAAGCAGAAAGG - Intergenic
1109705992 13:66093323-66093345 ATTCTTCTATAGAAAAGAAAGGG + Intergenic
1109929471 13:69196399-69196421 AGGATTTTATAAAAGATAAATGG + Intergenic
1109948080 13:69464081-69464103 AATCTTTTGTAGAAAAAAAAAGG - Intergenic
1110164447 13:72422338-72422360 ATCCTTTTAAAGAAAAACAAGGG + Intergenic
1110265438 13:73531996-73532018 ATTATTTGATAGAAGACAAATGG + Intergenic
1110579289 13:77100182-77100204 ATTATTTTTTAAAAGAAAAAAGG + Intronic
1110981532 13:81905989-81906011 TGGGTTTTATAGAAAAAAAATGG - Intergenic
1111080776 13:83304328-83304350 ATACTTTTTTTGAAGAAACATGG + Intergenic
1111146746 13:84191748-84191770 ATGCTTTTTTTAAAGGAAAAGGG - Intergenic
1111867296 13:93785091-93785113 ATTCATTTCAAGAAGAAAAAGGG + Intronic
1111907305 13:94270408-94270430 ATGCTTTCATAGAATAATGAGGG + Intronic
1112202402 13:97290048-97290070 AGACTTTTATAGGAGAAACATGG - Intronic
1112585792 13:100717392-100717414 ATGATTCTATAGAAGCAGAATGG + Intergenic
1112618107 13:101026372-101026394 CTCCTTTTACAGAAGAGAAAAGG + Intergenic
1112738678 13:102450156-102450178 ATTCTCTTAAAGAAGAAATAAGG - Intergenic
1112847746 13:103665011-103665033 ATGCATTAATACTAGAAAAAGGG + Intergenic
1112953132 13:105027639-105027661 CCTTTTTTATAGAAGAAAAATGG - Intergenic
1113375701 13:109763901-109763923 AAGCTTTTAAAGTAGAAAAAAGG - Intronic
1113519689 13:110931021-110931043 ATAATTTAATAGAAGGAAAAAGG + Intergenic
1114977969 14:28125205-28125227 TTACTTTTATGTAAGAAAAAAGG - Intergenic
1115365073 14:32548739-32548761 ATGATACTATAGAAGAAAACTGG - Intronic
1115631435 14:35249945-35249967 ATGGTTTTATCCAAGAAAAGGGG + Intronic
1115760513 14:36576338-36576360 ATGTTTTTCTGGAAGAAGAATGG + Intergenic
1116135406 14:40916932-40916954 ATTATTTTCTAGAAAAAAAATGG - Intergenic
1116204220 14:41841088-41841110 TTGCTATTGTAGAAGAAAAGTGG - Intronic
1116282127 14:42922537-42922559 ATTCATTTATTGAAGACAAACGG + Intergenic
1116311926 14:43338219-43338241 AAGCATTTATAGACAAAAAATGG - Intergenic
1116357278 14:43945250-43945272 TTGCTTAGATAGAAAAAAAAGGG + Intergenic
1117394620 14:55296858-55296880 ATATTTTTTTAGAAGACAAATGG - Intronic
1118130593 14:62958627-62958649 ATGGGATTATATAAGAAAAAAGG - Intronic
1118682339 14:68255808-68255830 ATGTTTTTAGTGTAGAAAAATGG - Intronic
1120017293 14:79488318-79488340 GTTTTTTTATATAAGAAAAATGG + Intronic
1120078130 14:80183422-80183444 ATGTTTTTCAAGAAGAAAAAAGG + Intergenic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1121592862 14:95131910-95131932 CTGATTTTATTGAAGAAAACAGG - Intronic
1121750784 14:96353764-96353786 ATGTTTTTATTGTAGAGAAATGG + Intronic
1122304676 14:100755243-100755265 ATTCTTTAAAAGAAAAAAAAAGG - Intergenic
1123554333 15:21411884-21411906 ATGCTTATTAAGAAGAAAACTGG + Intronic
1124816839 15:33002210-33002232 ATGCCTTTCTAGAATAAGAAGGG - Intronic
1124932833 15:34138782-34138804 ATTCTGTTATAGAATAAAAAAGG + Intergenic
1125048006 15:35265228-35265250 ATGCTTTGAAAGGAAAAAAAAGG + Intronic
1125185049 15:36920468-36920490 ATTCTTTTATAAAAAGAAAAAGG - Intronic
1125853605 15:42927754-42927776 ATGCTTTCAAAGAAAAGAAATGG + Intergenic
1125918931 15:43513027-43513049 ATGCTATTATAAAAGAACTAAGG + Intronic
1125923433 15:43541016-43541038 ATGCTTTTATAAAAGACATTTGG - Intronic
1126668956 15:51098922-51098944 ATGCTATTATAGCAGAAAATTGG - Intronic
1126821858 15:52512211-52512233 ATATTGTTATAGTAGAAAAATGG + Intronic
1126891091 15:53205076-53205098 GTGATTTTCTAGAAGAATAATGG + Intergenic
1127182069 15:56431424-56431446 ATGCAATTATTGAAGAAGAAAGG - Exonic
1127346387 15:58104899-58104921 AAGCATTTATTTAAGAAAAATGG - Intronic
1127516951 15:59705071-59705093 ATTCATTTATAGAAGAAAAAAGG + Intergenic
1128134872 15:65255433-65255455 ATACTTTTATGGAAGAAAGGGGG + Intronic
1128611794 15:69079831-69079853 TTGCTTTTAGGGAAGAAAATTGG - Intergenic
1128745633 15:70112123-70112145 AAGGTTTCACAGAAGAAAAAAGG - Intergenic
1130634622 15:85605760-85605782 ATGCTTTTTTAAAATATAAATGG - Intronic
1131106680 15:89739496-89739518 ATGCTTTGATAGCAGAAAGGAGG - Intronic
1132002556 15:98194545-98194567 ATGCTTCCATAGAGGAAACAAGG + Intergenic
1133621033 16:7526511-7526533 ATAGTTGTTTAGAAGAAAAAAGG - Intronic
1133645747 16:7763010-7763032 ATGCTCTACTAGAAGACAAAAGG - Intergenic
1133802968 16:9099129-9099151 AAGCATTTAAAGAAAAAAAAGGG + Intronic
1134233631 16:12448835-12448857 ATGCTTAGTTAGAAGAAAATGGG - Intronic
1135301905 16:21336500-21336522 ATGATTTTACAGAAATAAAAAGG - Intergenic
1135876155 16:26202089-26202111 AGGCTTTAATAGAAAGAAAAGGG - Intergenic
1138350356 16:56343146-56343168 ATGCATGTATAAAAGGAAAATGG + Intronic
1138933754 16:61694259-61694281 GTGCTTTTCTAGAAGGAAAGTGG + Intronic
1139034659 16:62929332-62929354 AGGGCTCTATAGAAGAAAAAAGG - Intergenic
1139117291 16:63971915-63971937 ATGCCTTTATGGAAGGCAAATGG - Intergenic
1139155052 16:64431498-64431520 ATGATTTTAAAAAAAAAAAAAGG - Intergenic
1139254249 16:65525971-65525993 ATGCTTTTCTGTATGAAAAAAGG - Intergenic
1139907061 16:70373491-70373513 CTGTTTTTGTAAAAGAAAAATGG - Intergenic
1140286506 16:73607517-73607539 CGCATTTTATAGAAGAAAAATGG - Intergenic
1140422014 16:74827339-74827361 AAGCATTTATTCAAGAAAAATGG + Intergenic
1142707597 17:1706331-1706353 AGGCTTTCATGGAAGAACAAGGG - Exonic
1143038621 17:4016083-4016105 TTGTTTTAATAGAAGAAAATGGG - Intronic
1143298667 17:5891861-5891883 ATGAATTTATAAAATAAAAATGG + Intronic
1145226572 17:21133625-21133647 ATGATTTTAAAAAAGAAAAGTGG - Intronic
1146434423 17:32830597-32830619 ATGATTTTAAAGAATAAAAATGG - Intronic
1146505770 17:33403741-33403763 ATTCTTTAATAGAAGTAAAAGGG - Intronic
1148982671 17:51592217-51592239 ATGCTGGTATTGAAGATAAAAGG + Intergenic
1149100931 17:52905805-52905827 ATGCTTATTTAGAAGCAAAAAGG - Intergenic
1149405547 17:56346570-56346592 ATGTCTTTATTCAAGAAAAATGG - Intronic
1149571016 17:57672402-57672424 AGGCTTAGATAGAAGACAAAAGG - Intronic
1151043386 17:70891114-70891136 ATTTCTTTATAGAAAAAAAATGG - Intergenic
1151047784 17:70941876-70941898 GATCTTTTATAAAAGAAAAAAGG - Intergenic
1151115278 17:71728597-71728619 ATGTTTTGATAAAAGAAAAATGG - Intergenic
1152489857 17:80623334-80623356 TTGCTGATATATAAGAAAAATGG - Intronic
1153602730 18:6797525-6797547 CTGCTATTACAGAAGACAAAAGG - Intronic
1153913843 18:9728005-9728027 ATACTTGTAAAGAATAAAAAAGG + Intronic
1153998115 18:10459684-10459706 ATGCTTTTATTTCAAAAAAATGG + Intronic
1154055446 18:11008981-11009003 ATCTTTTTATACAATAAAAATGG + Intronic
1154459959 18:14572998-14573020 ATATTTTTAGAGATGAAAAAGGG - Intergenic
1155219063 18:23668148-23668170 AAGGTTTTATAAAAGAAGAAAGG - Intergenic
1155552091 18:26975277-26975299 ATACATTTATACAAGTAAAAAGG - Intronic
1155633070 18:27918416-27918438 ATACATGTATAGAAGAAGAAAGG + Intergenic
1155724898 18:29069203-29069225 ATGCTTTGATAGAGAAATAAAGG - Intergenic
1155914150 18:31539584-31539606 TTCCTTTTATAAAAGAACAAGGG + Intronic
1156187265 18:34677679-34677701 ATGCTTTTTTAAAAAAAAATTGG - Intronic
1156442210 18:37202137-37202159 ATGCTTTTGTTAAAAAAAAATGG - Intronic
1156616048 18:38785535-38785557 GTGCTGCTAGAGAAGAAAAAGGG + Intergenic
1156687979 18:39672897-39672919 ATTTTTTTTTAGAAGAAACAGGG - Intergenic
1156693600 18:39738842-39738864 GAGCTTTCATGGAAGAAAAAGGG - Intergenic
1156869471 18:41928886-41928908 TTGCTTTTAAAGAAGAATAAAGG + Intergenic
1157304168 18:46504849-46504871 ATGTTTCTACAGAAGACAAAAGG + Intronic
1157932154 18:51834873-51834895 ATTACTTTATATAAGAAAAAAGG - Intergenic
1157983018 18:52404311-52404333 ATGCTTTTACTGAAGAGAATGGG + Intronic
1158298441 18:56025463-56025485 CTCCTTTAATAGAAGAATAACGG - Intergenic
1158473393 18:57758695-57758717 CTACTTTTGTAAAAGAAAAAAGG - Intronic
1158820716 18:61155687-61155709 ATGATTTCATAAAAGAAAGAAGG - Intergenic
1158914562 18:62109561-62109583 TATCTTTTATAGAAAAAAAATGG - Intronic
1159510573 18:69393562-69393584 ATGCTTTTATAGAAGTCTGATGG - Intergenic
1159675480 18:71279208-71279230 ATGCTTTTAGAAATTAAAAAAGG + Intergenic
1159748583 18:72271493-72271515 TTAGTTTTATAGAAGAAAACGGG - Intergenic
1159802876 18:72922741-72922763 CTGATTTTTTATAAGAAAAATGG + Intergenic
1159984981 18:74831268-74831290 ATGCTTTTATCCAAACAAAAGGG - Intronic
1160603470 18:80032333-80032355 AAGATTTTAAAGAAAAAAAAGGG + Intronic
1163274802 19:16276861-16276883 ATGTTTTTTTGAAAGAAAAAAGG - Intergenic
1164228710 19:23269075-23269097 ATGCTGTCAGAGAAGAGAAATGG - Intergenic
1164398289 19:27885387-27885409 TTTCTTTTCTAGCAGAAAAATGG + Intergenic
1164791418 19:30987776-30987798 AAGTGTTTATAGAAGAAAAGTGG - Intergenic
1165555327 19:36626118-36626140 ATTCTTTTCTAGAAGAAGATGGG + Exonic
1165565100 19:36718936-36718958 ATTCTTTTCTAGAAGAAAACTGG + Exonic
1165641120 19:37387867-37387889 ATGCAATAGTAGAAGAAAAAGGG + Intronic
1166009377 19:39930318-39930340 TTGCATTTATTGAAGATAAATGG + Intronic
1167418924 19:49391428-49391450 ATTATTTTTTAAAAGAAAAAAGG + Intronic
1167585747 19:50374538-50374560 ATGCCTTTATAAAAAAGAAATGG - Intronic
1168375216 19:55871426-55871448 ATGCTTTAGAAGAAGACAAAGGG + Intronic
1168699009 19:58424434-58424456 ATGCTTTGAAAGAAGATATATGG + Intergenic
925493616 2:4422700-4422722 ATCACTTTATAGAAGAAAGAAGG + Intergenic
925582353 2:5424280-5424302 ATGCATATATAGAAGCCAAAGGG + Intergenic
925639538 2:5974230-5974252 AAGCTTTTACAGTAGAAAAAAGG + Intergenic
926278846 2:11427848-11427870 TTTCTTTTTTTGAAGAAAAATGG + Intergenic
926384528 2:12323302-12323324 ATGCTGTAATGGAAAAAAAAAGG - Intergenic
926984568 2:18608640-18608662 ATGCTTTTAATGAAATAAAATGG - Intergenic
926986407 2:18629458-18629480 ATGATTTAACTGAAGAAAAAAGG + Intergenic
927077128 2:19589818-19589840 CATCTTTCATAGAAGAAAAATGG - Intergenic
927145241 2:20161060-20161082 AGGCTTTTATAGGATGAAAAGGG - Intergenic
927861920 2:26565389-26565411 ATGATTTTAAAAAAGAAAAAAGG - Intronic
928532937 2:32210761-32210783 ATGCTTTTGTAGTGGGAAAATGG + Intronic
929064161 2:37956363-37956385 CTGATTTTATAGAAATAAAAAGG - Intronic
929129124 2:38548877-38548899 ATGCTTTTAAACAATAAAAACGG - Intergenic
929423294 2:41817336-41817358 TTACTTTTATAGAAAATAAAAGG + Intergenic
929978995 2:46661566-46661588 ATACTTCTAAAGAAGAAAAAAGG - Intergenic
930423812 2:51187950-51187972 ATTCTTTTAATGAGGAAAAAAGG + Intergenic
930524372 2:52508460-52508482 ATGCTTTTTTTGAAGAACTAGGG - Intergenic
931297313 2:60940423-60940445 ATGCTTTTATGTAGGCAAAAGGG + Intronic
931513528 2:63025951-63025973 CTGCTTTAAGAAAAGAAAAATGG + Intronic
931970519 2:67580835-67580857 ATGCTCTTGTAAAAGCAAAAGGG - Intergenic
932027976 2:68155183-68155205 ATTCCTTTTTCGAAGAAAAATGG - Intronic
932275959 2:70452503-70452525 CTCCTTTTACAGATGAAAAAGGG + Intronic
933104643 2:78308905-78308927 ATTCTTTTATAGAGGAGAAATGG - Intergenic
933113463 2:78434681-78434703 CTGTTTTTATTGAAGAAAGAAGG - Intergenic
933342588 2:81041223-81041245 ATGCTTTGAGAGGAAAAAAAAGG - Intergenic
934055710 2:88249926-88249948 ATGCTTTCCTAGAAAAATAAAGG + Intergenic
934166579 2:89299496-89299518 TTGCTTTTGTAGAGGGAAAAGGG + Intergenic
934200698 2:89882960-89882982 TTGCTTTTGTAGAGGGAAAAGGG - Intergenic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
934726906 2:96627712-96627734 ATGACTTTATATAAGAAGAAAGG + Intronic
934887466 2:98037602-98037624 ATGCTTATAAAGAAGGAAAAAGG + Intergenic
935575485 2:104705382-104705404 GTGCCTTTAAAGTAGAAAAATGG - Intergenic
936582279 2:113711883-113711905 ATGTTTTTAAAGAAGGATAAAGG - Intronic
936807465 2:116353506-116353528 ATGCTTATATGTAAGTAAAATGG + Intergenic
936957158 2:118034099-118034121 ATGCTTGTGTAGAACAAAGAAGG - Intergenic
937479972 2:122247901-122247923 ATGCATTTATAGATGTTAAAGGG - Intergenic
937564822 2:123272144-123272166 AAGCTTTTATAGCAAAACAAAGG - Intergenic
937725945 2:125166982-125167004 TTTCTTTTATAGAATAAAGAAGG - Intergenic
937764913 2:125649717-125649739 AAGTTTTTATTCAAGAAAAATGG - Intergenic
937822929 2:126332103-126332125 ATGCTTTGACAGAAAGAAAAAGG + Intergenic
937831638 2:126430850-126430872 ATACTTTTAGAAAAGAAAATGGG + Intergenic
938774636 2:134530643-134530665 TTTCTTCTATAGAATAAAAATGG - Intronic
939319788 2:140604314-140604336 ATGTTTTTGCAGAAGAAATAAGG + Intronic
939325794 2:140686560-140686582 ATACTTTTATTGATGAAAATAGG + Intronic
939894804 2:147778167-147778189 AAGCTATTATAGAGAAAAAAGGG + Intergenic
940193510 2:151067325-151067347 TTGATTTTACAGAAGAAAAGTGG - Intergenic
940233998 2:151490096-151490118 ATTCTTTATAAGAAGAAAAATGG + Intronic
940251697 2:151684629-151684651 ATGCTCTTATAGAACCACAAGGG + Intronic
940294264 2:152105948-152105970 ATCCTTTAATAGAAGAAATCAGG + Intergenic
940778940 2:157912878-157912900 AAACTTTTAAAAAAGAAAAAAGG + Intronic
940859303 2:158755737-158755759 TTTCTTTTATTGAAGAAACAAGG - Intergenic
941089825 2:161161161-161161183 GTGCTTTTCTAGAAGTAGAAAGG + Intronic
941194121 2:162425041-162425063 AGGCCTGAATAGAAGAAAAAGGG + Intronic
941469272 2:165864224-165864246 ATGCTTTCATAGAAGAGAAAAGG + Intronic
941531024 2:166671516-166671538 ATTGTTTTATGGATGAAAAAAGG + Intergenic
941835410 2:170012352-170012374 ATGCTTAAAAAGAAAAAAAATGG - Intronic
942371065 2:175285679-175285701 ATGTTTTCATAAAAGAAAAGTGG + Intergenic
942609020 2:177722487-177722509 TTTATTTTATAAAAGAAAAAAGG - Intronic
943220877 2:185104507-185104529 ATGATTTGATATAATAAAAATGG - Intergenic
944080853 2:195787109-195787131 ATGCTTTGGTACAAGAAAGACGG - Exonic
944265304 2:197718183-197718205 ATGTTTTTAGAGAAGAAAGTTGG + Intronic
945078272 2:206062611-206062633 ATACTTTTAAAGATGAAATATGG - Intronic
945428619 2:209738363-209738385 GTGCTTTTGAAGCAGAAAAATGG - Intergenic
945485419 2:210389862-210389884 ATGCATTTCTAGCAGAAAAGTGG + Intergenic
945906460 2:215599254-215599276 ATGCTTTTTTAGTGGAAGAAGGG - Intergenic
945921379 2:215758242-215758264 ATGTTTTAATAGAAGAAATTAGG + Intergenic
946193498 2:218020099-218020121 ATGCTTCAATAATAGAAAAAAGG - Intergenic
946579987 2:221118000-221118022 ATATTTTTATTGAAAAAAAAAGG + Intergenic
946676997 2:222170869-222170891 ATGCATTTATAGAAGAAGATGGG - Intergenic
946735185 2:222746930-222746952 ATGCTTTTATAATAGGAAACAGG + Intergenic
946852950 2:223925011-223925033 ATCATTTAATAGAATAAAAAAGG + Intronic
947002805 2:225476522-225476544 AGGCTTTTAAAACAGAAAAATGG + Intronic
947023409 2:225709589-225709611 AAGCTTATATAGATGAAAGAGGG - Intergenic
948140078 2:235666206-235666228 ATGCTTTAAAAAAAAAAAAATGG + Intronic
948764906 2:240214482-240214504 AGGTTTTTAAAGACGAAAAAGGG + Intergenic
1169026043 20:2372311-2372333 ATGCATTTATAAAAGGATAAAGG + Intergenic
1169615067 20:7432585-7432607 AGGCTTTTATAGAGTGAAAATGG + Intergenic
1170238813 20:14139331-14139353 CTCCTTTTATAGATGAAGAAAGG + Intronic
1170238973 20:14141401-14141423 CTCCTTTTATAGATGAAGAAAGG - Intronic
1170383549 20:15789435-15789457 TTGCTGTCATATAAGAAAAATGG - Intronic
1171187003 20:23129855-23129877 ATGCTTTTAAAAAAACAAAAAGG + Intergenic
1172993724 20:39054455-39054477 GTGCTTTTATAAAACCAAAAAGG - Intergenic
1173100053 20:40078487-40078509 TAGCATTTATAGAAGTAAAATGG - Intergenic
1173148672 20:40547234-40547256 ATGGTTTTATGGAAGAAGCATGG - Intergenic
1173393744 20:42658827-42658849 TTGCATTTATTGAAGTAAAAAGG + Intronic
1173690604 20:44958180-44958202 ATGCTTTAATAGACATAAAATGG - Intronic
1173949215 20:46977316-46977338 ATTCTATTTTAAAAGAAAAAGGG + Intronic
1174564652 20:51456227-51456249 ATACTTTAATAAATGAAAAATGG + Intronic
1174625887 20:51913960-51913982 ATGCATTTTTAGTAGAAACAGGG - Intergenic
1175614114 20:60378052-60378074 CTGCATTCATAGAAGAAAGAGGG - Intergenic
1176814156 21:13579828-13579850 ATATTTTTAGAGATGAAAAAGGG + Intergenic
1177006041 21:15673170-15673192 ATTCTATTATGGGAGAAAAATGG + Intergenic
1177366471 21:20145354-20145376 AATATTTTATAGAAGAAAAGAGG - Intergenic
1177434597 21:21034575-21034597 ATGATTTTAAATCAGAAAAATGG + Intronic
1177990679 21:28032064-28032086 ATGTTTTCACAAAAGAAAAATGG + Intergenic
1179350213 21:40602648-40602670 ATGCTTTCATAGATGTTAAAAGG - Intronic
1179426904 21:41287858-41287880 ATGCTCTTAAGGAACAAAAAGGG - Intergenic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1181362259 22:22346980-22347002 CTGCTTTTAAAAAATAAAAATGG - Intergenic
1181488790 22:23248559-23248581 ATTCTTTCATAAAAGGAAAAAGG - Intronic
1184844979 22:47077143-47077165 ATTCTCTTATTGAAGAAGAAGGG + Intronic
1185363752 22:50424939-50424961 ATTCTTTTGAAGAAGGAAAAGGG - Intronic
949105986 3:199830-199852 TCGCTTTTATAGAAAAATAAGGG + Intronic
949121384 3:388758-388780 CTCTTCTTATAGAAGAAAAATGG + Intronic
949167782 3:961590-961612 ATACTTTAATTAAAGAAAAATGG - Intergenic
949291409 3:2470897-2470919 ATGCTTCGAGAGATGAAAAAAGG + Intronic
949388543 3:3533218-3533240 TTGCTTTGATAGGTGAAAAATGG + Intergenic
949496007 3:4632858-4632880 ATGTTTTTAAAAAATAAAAAAGG + Intronic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
949655278 3:6210708-6210730 ATGCTATTTTAGAAGAAAGATGG + Intergenic
949669841 3:6387291-6387313 ATGCTTTTTTAAAATAAATAAGG + Intergenic
949794258 3:7829678-7829700 ATGTATCAATAGAAGAAAAAAGG + Intergenic
950767237 3:15281828-15281850 TTGCATTTTTAGTAGAAAAAGGG - Intronic
950949580 3:16984233-16984255 ATATTTTTAGAGAAGAAATAAGG + Intronic
951038113 3:17955947-17955969 ATGTTTTCATGTAAGAAAAAAGG - Intronic
951340008 3:21473853-21473875 ATGGTTTAATAGAAGAAAATGGG - Intronic
951472465 3:23070994-23071016 ATGCTTTTATTGCAGAGACAGGG - Intergenic
953075611 3:39567476-39567498 AGGCTTTGCTAGAAGATAAAGGG - Intergenic
953257936 3:41307285-41307307 GTGCTTTGACAGCAGAAAAAGGG + Intronic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
954981149 3:54746709-54746731 ATATTTTTATAGAAAAAAGAAGG - Intronic
955027680 3:55186219-55186241 TTTCTTTAAAAGAAGAAAAATGG - Intergenic
955331529 3:58051232-58051254 TCTCTTTTACAGAAGAAAAAGGG + Intronic
955468083 3:59257000-59257022 TTGCTTGTATATAAGAATAAAGG - Intergenic
955742848 3:62110533-62110555 ATGCTTTAAAAAAAAAAAAAAGG + Intronic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
956404199 3:68911219-68911241 AGTCTTTTATAGGAAAAAAATGG - Intronic
956662092 3:71609002-71609024 ATTCTATTAAAGAAGAAAAATGG - Intergenic
956731315 3:72199130-72199152 ATGCTTTCACAGAGGAAACATGG + Intergenic
957112384 3:75980349-75980371 ATGCTTCTATAGAAGATTAATGG - Intronic
957147044 3:76437584-76437606 ATGGTTTAATAAAACAAAAAAGG + Intronic
957153337 3:76514965-76514987 ATGTTTTTATAGAAAATAATAGG + Intronic
957249456 3:77754605-77754627 TTCTTTTTAAAGAAGAAAAAAGG + Intergenic
957515029 3:81239219-81239241 TTGCTTTTGTATATGAAAAATGG + Intergenic
957691444 3:83576179-83576201 AAGCTTTTATAGAAGAAAAGTGG - Intergenic
957814701 3:85280614-85280636 AAGCTTTTATAAATGAATAATGG - Intronic
957817869 3:85325873-85325895 ATTCTTATATAAAAGAAACAGGG + Intronic
957986909 3:87583831-87583853 ATTCTTTTATAGCAGCATAAAGG - Intergenic
958072713 3:88635390-88635412 CTGTTTTTTTAGAAGAAATAAGG - Intergenic
958113258 3:89178994-89179016 ATGTTTTTCTAAAAGCAAAATGG + Intronic
959360793 3:105388894-105388916 AGGCTTTCATGAAAGAAAAATGG + Intronic
959401666 3:105909938-105909960 ATGATTTTATAGAGAATAAAGGG - Intergenic
959776949 3:110176856-110176878 ATGCCCTTATAAAAGAGAAAGGG - Intergenic
959800662 3:110491252-110491274 ATGCTTTTCAAGATGAAAAAAGG - Intergenic
960918226 3:122719311-122719333 AAGGTTTTCTAGAACAAAAAAGG + Intronic
961435020 3:126911008-126911030 ATGGTTTTAAAAAACAAAAATGG - Intronic
961989431 3:131171957-131171979 ATGCTTATATAAAAGAAAATAGG + Intronic
962148448 3:132866832-132866854 ATACTTTAATAGGAGAAACATGG - Intergenic
963134288 3:141886686-141886708 TTTCTTTTATAGAGGAAACAAGG - Intronic
963736903 3:149028109-149028131 ATGATTCTATGGAAGAAAACAGG + Intergenic
963866689 3:150369179-150369201 TTGCTTTTATAGCAGAGAATAGG - Intergenic
964178019 3:153849148-153849170 CTGCTTGTATAGCAGAATAATGG + Intergenic
964935293 3:162076966-162076988 ATATTTTAATAGAAGAAAAGTGG + Intergenic
966564940 3:181367999-181368021 TTGCTATTAATGAAGAAAAAAGG - Intergenic
966893144 3:184422489-184422511 ATGCAATAATATAAGAAAAATGG + Intronic
967278334 3:187798334-187798356 AGGCTTTAAGAGAAGAAAAGAGG - Intergenic
967491679 3:190099026-190099048 GTGCTTTTTTTTAAGAAAAAGGG + Intronic
967562514 3:190933731-190933753 AGGCATTTATCGCAGAAAAATGG - Intergenic
969270153 4:6094174-6094196 ATGCTTTTATAAAACCATAATGG - Intronic
969479238 4:7438674-7438696 AGTCTTTTAAAAAAGAAAAAAGG - Intronic
969545290 4:7822539-7822561 ATGTTTTTATTCAAAAAAAACGG + Intronic
969787046 4:9466653-9466675 ATGATTTTACAGACGAGAAAAGG + Intergenic
970028013 4:11644519-11644541 ATGCCTTTAAAAAAGAAAAATGG + Intergenic
970236455 4:13963645-13963667 ATGCTTTTACCAAAAAAAAAAGG - Intergenic
970451573 4:16171893-16171915 ATGATTTTATATCCGAAAAAAGG - Intronic
970701762 4:18749900-18749922 ATGGTTTTATAGAAGCCAAAGGG - Intergenic
970841151 4:20470987-20471009 ATGTTTCTACAGAAGAAAAGGGG + Intronic
971029856 4:22624123-22624145 ATACATTTATACAAGTAAAAAGG - Intergenic
971108353 4:23552735-23552757 ATATTTCTATAGAATAAAAAGGG + Intergenic
971400135 4:26268545-26268567 GTGCTTTTATTGAAGAGAAAAGG - Intronic
971731588 4:30389607-30389629 CTTTTTTTATATAAGAAAAAGGG - Intergenic
971762676 4:30788119-30788141 GTGCTATTATAGAAAAAAATAGG + Intronic
971817954 4:31513887-31513909 TTAATTTTATAGAAGAAAATGGG + Intergenic
971854097 4:32022152-32022174 AAGCTTGCATAAAAGAAAAATGG - Intergenic
971927352 4:33030085-33030107 ATGATTCTAATGAAGAAAAAAGG + Intergenic
972046793 4:34675581-34675603 ATCCTCTTATGAAAGAAAAATGG + Intergenic
972141865 4:35970330-35970352 ATATTATTATAGAAGAAAGATGG + Intronic
972148278 4:36056749-36056771 ATGCTTATAGAAAAGAAAAATGG - Intronic
972183836 4:36503408-36503430 ATGCTTGTATATATGTAAAATGG + Intergenic
972343797 4:38176033-38176055 ATATTTTTATATAATAAAAATGG + Intergenic
972896163 4:43622586-43622608 ATATTTTTAAAGAAGAAAACTGG - Intergenic
972942233 4:44210398-44210420 ATGCTTTTATAAAATAACCAAGG + Intronic
973186761 4:47338863-47338885 ATTTTTTTAAGGAAGAAAAATGG + Intronic
973537180 4:51895194-51895216 ATGCTGTTAAAAAAAAAAAAAGG + Intronic
973615563 4:52674333-52674355 TTCCTTTTATAGCAGAAAAGAGG + Intergenic
974062657 4:57049623-57049645 AGGATTTTAGAGAAGAAATAAGG - Intronic
974283432 4:59830641-59830663 ATGCTTTAATAAAATAAAATGGG - Intergenic
974523532 4:63017835-63017857 ATGTCTTTATAGGAGACAAAGGG + Intergenic
974540831 4:63232448-63232470 ATATTTTTAAATAAGAAAAATGG - Intergenic
974643087 4:64657232-64657254 TTGATATTATAGAAGAAGAATGG + Intergenic
974757936 4:66236804-66236826 TTACTTTTATTTAAGAAAAATGG - Intergenic
975189305 4:71441057-71441079 CTGGTTTTACAGATGAAAAAAGG + Intronic
975206816 4:71653566-71653588 ATTTTTTTACTGAAGAAAAATGG + Intergenic
975355704 4:73400926-73400948 TTTATTTTATAGTAGAAAAATGG + Intronic
975766713 4:77676234-77676256 ATGATTTAACAGAAAAAAAAAGG + Intergenic
975916687 4:79333578-79333600 ATGTTTTTAAAGAAGAAATGAGG - Intergenic
976123568 4:81808795-81808817 ATGCTTTGATAGCAGAGAAAAGG - Intronic
976415322 4:84767110-84767132 ATGCTTTTGAAAAAAAAAAATGG - Intronic
976657425 4:87503956-87503978 AAGTTTTTATTGAAGAAAACAGG + Intronic
977262269 4:94812214-94812236 ATACTGTTATAGAAGAAGCAGGG + Intronic
977451332 4:97201733-97201755 ATGGATTAATAAAAGAAAAATGG - Intronic
977503365 4:97869529-97869551 ATGCAGTTATAGGAGATAAATGG + Intronic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
978052235 4:104215867-104215889 ATGTTTTTATAAAAAATAAATGG - Intergenic
978484875 4:109241175-109241197 TTGCATTTATAGATTAAAAAAGG - Intronic
978889618 4:113808613-113808635 CTGCTTTTAGGGAAAAAAAAGGG - Intergenic
978908898 4:114042876-114042898 ATGAATTTAAATAAGAAAAATGG - Intergenic
978964785 4:114727186-114727208 AGGCTTTTATCTAAGAACAAAGG + Intergenic
979182494 4:117749039-117749061 ATGCATTTAAAGACAAAAAAAGG - Intergenic
979806425 4:124977767-124977789 TTGCTTTAATAGAAGAAACCCGG - Intergenic
979877288 4:125909307-125909329 ATGACTTTATAGAAAAGAAAAGG - Intergenic
980483338 4:133419211-133419233 ATGCTGTTATAGATGTAAAGAGG + Intergenic
980591836 4:134900405-134900427 ATACTTTGATACAACAAAAATGG - Intergenic
981137971 4:141235031-141235053 ATGCTTCTATAGAACAAAAATGG - Intergenic
981248781 4:142573335-142573357 ACGGTTTTTTAAAAGAAAAAAGG - Intronic
981961782 4:150549800-150549822 AAGCTTTTTTAGAGGAAAGATGG + Intronic
982266872 4:153545885-153545907 CTCCTGTTATAGAAGCAAAATGG + Intronic
982964527 4:161887949-161887971 ATGCATTAATGGGAGAAAAAAGG - Intronic
983293668 4:165838349-165838371 TTGCTGTTAAAAAAGAAAAATGG - Intergenic
983413175 4:167423886-167423908 TTTCTTTTCTAGCAGAAAAAGGG + Intergenic
983536944 4:168868006-168868028 TTCCTTATATAAAAGAAAAAGGG - Intronic
983951302 4:173645805-173645827 TTGATTTCATAGAAGTAAAATGG - Intergenic
984209126 4:176824146-176824168 GTTTTTTTATAGGAGAAAAATGG + Intergenic
984305780 4:177988571-177988593 ATGCTTTAATAGTAGATACATGG + Intronic
984469302 4:180146174-180146196 ATGATTTAATAGAAGGAACATGG + Intergenic
984495338 4:180489812-180489834 ATCCATATATGGAAGAAAAATGG - Intergenic
984637570 4:182128232-182128254 ATGCCTACATAGAAAAAAAAAGG - Intergenic
985342573 4:188971164-188971186 AGACTTTTGTAGAAAAAAAAGGG + Intergenic
986054834 5:4126638-4126660 ATCCTATTACAGAAAAAAAAGGG - Intergenic
986108933 5:4692046-4692068 AGGCTTTTATAGGACAAACATGG + Intergenic
986988746 5:13527460-13527482 ATGCTATTGGAGAAGAGAAATGG + Intergenic
987350667 5:17018984-17019006 ATAGTTCTATAGAAGAAACATGG + Intergenic
987535947 5:19187690-19187712 GTGTCTTTATAGAAGAATAATGG - Intergenic
987562924 5:19547664-19547686 ATGTTTATATATTAGAAAAATGG + Intronic
987609754 5:20187399-20187421 TTCCTTTTGTAGAAGACAAATGG + Intronic
987616966 5:20287850-20287872 ATGGAATAATAGAAGAAAAATGG + Intronic
988322666 5:29719234-29719256 TTGCTTTTATAGTATTAAAAAGG + Intergenic
988386877 5:30576087-30576109 AAGTGTTTATATAAGAAAAATGG + Intergenic
988734455 5:34007117-34007139 ATGCTGTTTTAGAAGGAAGAAGG + Intronic
988877723 5:35466625-35466647 ATGCTGAGATAGAGGAAAAATGG - Intergenic
989394404 5:40938261-40938283 AAGCATTTATAGAAAAAACAAGG - Intronic
989585623 5:43072083-43072105 ATGATATTTTAGAAGATAAATGG + Intronic
989652280 5:43705941-43705963 CTACTTTGAGAGAAGAAAAAGGG - Exonic
989739580 5:44754592-44754614 ATACTCTTATAGAAGCTAAAAGG + Intergenic
990501339 5:56399476-56399498 ATGCTTTGATACAGGGAAAAAGG + Intergenic
990711584 5:58587096-58587118 TTCCTTTTACAGAAGAAAAGTGG - Intronic
990937508 5:61165964-61165986 ATACTTTTTAAGAAAAAAAATGG - Intergenic
991362827 5:65839066-65839088 TTTTTTTTATAAAAGAAAAAAGG - Intronic
991395982 5:66205953-66205975 GTGCTTTTATATAATAAAAGAGG - Intergenic
991514573 5:67420477-67420499 ATGTCTTTATAGGAGAAAAATGG + Intergenic
991601993 5:68360920-68360942 ATACTTTTAAAGGAGTAAAAGGG + Intergenic
991699844 5:69307379-69307401 ATTTTTTTTAAGAAGAAAAATGG + Intronic
991908219 5:71534189-71534211 ATCATCTTTTAGAAGAAAAATGG - Intronic
992263653 5:74995363-74995385 CTGCTTTTAGAAAACAAAAAGGG - Intergenic
992272392 5:75078433-75078455 ATGCTTTTCCAGAAAAAAATAGG - Intronic
992518650 5:77523911-77523933 ATCCTTTTATTAAAGAGAAAGGG + Intronic
992954492 5:81893345-81893367 ATGCATATATAGTAGAAAAGGGG - Intergenic
993333424 5:86627651-86627673 ATGTTTTCATAGGAAAAAAATGG + Intergenic
993351963 5:86861352-86861374 ATGCTAGTTTAGAAGAACAAAGG - Intergenic
993515082 5:88822088-88822110 ATGCTTTATTAGAAAAAACAGGG - Intronic
993656950 5:90589576-90589598 ATGTTTTTATAAAATAAAAAAGG - Intronic
994361577 5:98855783-98855805 ATGCCTTTTTACAAAAAAAATGG - Exonic
994725952 5:103435599-103435621 ATGCTTAAATAGAAGACTAAGGG + Intergenic
995142059 5:108745946-108745968 ATACTTTTAAACAGGAAAAAAGG + Intergenic
996039481 5:118794076-118794098 ATCCTTACATAGAAGAAACAGGG + Intergenic
996176603 5:120367676-120367698 AAGCTGTTAGGGAAGAAAAATGG - Intergenic
996216403 5:120871860-120871882 ATGGATTTATAGAGGAAGAAAGG - Intergenic
996625231 5:125562942-125562964 ATGCTAGTATAAAAGCAAAATGG - Intergenic
997393793 5:133540050-133540072 AGGCCTTAATAGAACAAAAATGG + Intronic
997577031 5:134987182-134987204 CTGATCTTATAGAAGCAAAAAGG + Intronic
998535389 5:142925689-142925711 ATGCTTATTTAGGAGACAAAGGG - Intronic
998662189 5:144251536-144251558 ATGCTATTATATAACTAAAATGG + Intronic
998667745 5:144317624-144317646 ATGCATTCCTAGAAGAAATAAGG - Intronic
998673022 5:144375317-144375339 ATTCTATTATAATAGAAAAAAGG - Intronic
1000081439 5:157851188-157851210 ATATTTTTATAGTAGAAAAAAGG - Intronic
1000141446 5:158408129-158408151 ATACTATTATATAAGAAAACTGG - Intergenic
1000401393 5:160831976-160831998 ATCCTTTTATAGAACAATAATGG + Intronic
1000524926 5:162345896-162345918 ATGCATATATTGAAGAATAATGG - Intergenic
1000545781 5:162599935-162599957 ATGATATTTTAGAATAAAAAGGG + Intergenic
1000732399 5:164852406-164852428 GTGATTTTCGAGAAGAAAAATGG - Intergenic
1000898508 5:166885525-166885547 CTTCTTTCATAGAAGACAAATGG - Intergenic
1001507712 5:172293091-172293113 TTGATTTTATGGAAGAGAAAAGG + Intergenic
1001532732 5:172475755-172475777 ATGGTTTTACAAAAAAAAAATGG - Intergenic
1001967217 5:175919267-175919289 CTGTTTTTATAGATCAAAAATGG + Intronic
1001973393 5:175976147-175976169 CTGCTTTTACAGAAATAAAAAGG + Intronic
1002244044 5:177867636-177867658 CTGCTTTTACAGAAATAAAAAGG - Intergenic
1002413857 5:179107217-179107239 ATACTTTTAGAAAAAAAAAAAGG + Intergenic
1002875993 6:1209655-1209677 ACTATTTTATAGAAGAACAAAGG + Intergenic
1003216452 6:4117784-4117806 ATTATTTTACAGAGGAAAAAAGG + Intronic
1004232293 6:13844397-13844419 GAGCTTGTATAGAAGAATAAAGG - Intergenic
1004533448 6:16476340-16476362 TTGCTTTTTTAGAAGAAATTTGG - Intronic
1005210997 6:23463036-23463058 GTTCTTTTTTAGAAGAATAATGG - Intergenic
1005373248 6:25156427-25156449 ATGCTTTAAAAAAAAAAAAAAGG - Intergenic
1005750873 6:28881350-28881372 ATGCTTATATAGCACACAAAGGG - Intergenic
1005915554 6:30347828-30347850 ATGCTTTTGTAGAAGCCAGAGGG - Intergenic
1006006923 6:31010139-31010161 AGGCCTTTGTAGAAGAAAGAAGG - Intergenic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1006290095 6:33128210-33128232 TGTCTTCTATAGAAGAAAAATGG - Intergenic
1007157334 6:39758024-39758046 AAGCTTTTTTAGCAGCAAAAGGG + Intergenic
1007283855 6:40733239-40733261 ATGCTATTCTACAACAAAAAGGG + Intergenic
1007835973 6:44674091-44674113 AGGCTTTTCCAGGAGAAAAATGG + Intergenic
1008791756 6:55243556-55243578 ATTCTTTAAAAGGAGAAAAAAGG - Intronic
1008818681 6:55604086-55604108 TTCCTTTTAAAGAAAAAAAAGGG - Intergenic
1009051348 6:58280321-58280343 ATCATTTGAGAGAAGAAAAATGG + Intergenic
1009388404 6:63114940-63114962 ATGCTTTTTTTGTAGAAAAGGGG + Intergenic
1009496639 6:64357532-64357554 ATGCTTCAAAAGTAGAAAAAGGG - Intronic
1009602452 6:65819808-65819830 ATACTTTTATAGAATAAATATGG + Intergenic
1009685686 6:66953603-66953625 ATGCTTTTACTAAATAAAAAGGG - Intergenic
1009927695 6:70139804-70139826 ATGATTTTATAGATAAAGAAAGG + Intronic
1010116162 6:72315097-72315119 ATGATTTTATACAAGGAGAATGG + Intronic
1010191013 6:73196529-73196551 CTGCTTATATATAAGAATAAGGG - Exonic
1010495673 6:76532094-76532116 ACACTTTTAGAGAAGAAAGAGGG - Intergenic
1010764444 6:79762969-79762991 TTGCTTTTTTAAAAGAAAATGGG + Intergenic
1011420104 6:87162905-87162927 ATGCTCTTATAGTTGTAAAATGG + Intronic
1011481178 6:87795625-87795647 ATGTTTGTAGAGAAGAAGAAAGG - Intergenic
1011884135 6:92072207-92072229 ATACTTTTATAGCAAAAATAGGG + Intergenic
1012221231 6:96651832-96651854 AAGCTTATACAGAAGAAGAAGGG - Intergenic
1013565394 6:111354629-111354651 ATGTTTTTAGAGAGGAAAAATGG - Intronic
1013617506 6:111858536-111858558 AGGCTTTGTTAGAAGAAAAATGG - Intronic
1013906832 6:115230711-115230733 ATGGTTTTATAGATAGAAAATGG - Intergenic
1013958762 6:115872330-115872352 ATGCTTTGAGTGAGGAAAAATGG - Intergenic
1014161834 6:118178584-118178606 ATGGTTTTGTGGAATAAAAAAGG - Intronic
1014184579 6:118420741-118420763 AGGCTTTGACAGAAGAAAATGGG - Intergenic
1014287776 6:119520805-119520827 TTTCTTTTATAAAAGAAAAAAGG - Intergenic
1014503240 6:122220745-122220767 GTGCTTTTATAAAAACAAAAAGG + Intergenic
1014721643 6:124924450-124924472 ATGCTTTTATAGGGTAAAGATGG + Intergenic
1014843684 6:126250129-126250151 ATGCTATTATAGAATAAGAAGGG + Intergenic
1014973243 6:127845388-127845410 AAGCATTTATTGAAGAAAAATGG + Intronic
1015136235 6:129874387-129874409 AAGCTTTTAGAAAATAAAAAGGG + Intergenic
1015267631 6:131304469-131304491 ATTCTTTCAAAGAAGAAAGAGGG + Intergenic
1015517450 6:134098109-134098131 ATATTATTATAGAAGACAAATGG + Intergenic
1015795633 6:137008270-137008292 ATGATTTTAAAGAAGAAAAAAGG + Intronic
1015905766 6:138115005-138115027 ATGCTGGTTTAGAAGAAGAAAGG - Intergenic
1016135022 6:140530396-140530418 ATGGTTGTAAAGAAGATAAAGGG - Intergenic
1016155620 6:140804356-140804378 ATGCATTTAGAGATCAAAAATGG - Intergenic
1016283481 6:142447076-142447098 ATGTTTTTATATGAGAGAAATGG - Intergenic
1016621239 6:146110926-146110948 AGGGTTTTAAAGAAGAAAGAAGG + Intronic
1016776076 6:147906121-147906143 ACGCTTTTAATGAAGAAAAAAGG + Intergenic
1017240340 6:152161482-152161504 ATGCTTTTTTTAAAGAAAAATGG + Intronic
1017562916 6:155649808-155649830 TTGCTTTTACAAAACAAAAAAGG - Intergenic
1017837179 6:158189147-158189169 GTGCCTTTGTAGAGGAAAAAAGG - Intronic
1017925470 6:158908424-158908446 ATTCTTTTATAGTAGGAAATTGG + Intronic
1020404053 7:7811673-7811695 ATGCTTTGATAGGGGAGAAAGGG + Intronic
1020521623 7:9195782-9195804 ATGCTTTTCTAGGACCAAAATGG - Intergenic
1020585487 7:10060448-10060470 TTGATTTTCTACAAGAAAAATGG + Intergenic
1020748248 7:12106128-12106150 AAGCTTTTATGGAAAAACAATGG + Intergenic
1020844673 7:13267884-13267906 ATGAAGTTGTAGAAGAAAAAAGG + Intergenic
1020954351 7:14721642-14721664 AAGCTTATATAAAAGAAATATGG + Intronic
1021259587 7:18437795-18437817 ATACATTTATAGAATAAAAAGGG + Intronic
1021259628 7:18438803-18438825 ATACATTTATAGAATAAAAAGGG - Intronic
1021537188 7:21718730-21718752 TTGCTCTTATAGCAAAAAAAGGG - Intronic
1022426668 7:30275762-30275784 ATTGGTGTATAGAAGAAAAATGG + Intergenic
1022834175 7:34097996-34098018 ATTTTTTTTTCGAAGAAAAAGGG + Intronic
1023357257 7:39379677-39379699 ATTTTTTTTTAAAAGAAAAAAGG - Intronic
1023655132 7:42412020-42412042 ATGATTTGATAGAAGAAAACTGG - Intergenic
1024031220 7:45461444-45461466 TTGCTTTTATAAGAGAAATAAGG - Intergenic
1024319030 7:48046867-48046889 ATGCTTATCTAGAGGAAAACTGG + Intronic
1024644731 7:51361560-51361582 CTGCTTTTCTAGAAGAAATGAGG + Intergenic
1024813152 7:53236596-53236618 TTTCTTTAATAGAAGATAAATGG + Intergenic
1025257483 7:57394580-57394602 GTGCTTAGATAAAAGAAAAAAGG - Intergenic
1025801572 7:64791423-64791445 ATGCTTATTTAGAAGAGTAATGG - Intergenic
1026106234 7:67422968-67422990 ATGCTTGTAGAACAGAAAAAAGG + Intergenic
1026161971 7:67877513-67877535 ATACATTTATGGAAGACAAAGGG - Intergenic
1026250081 7:68662293-68662315 AAGCATTTATTGCAGAAAAATGG + Intergenic
1027288450 7:76675078-76675100 AGGCTTGAATAGAAGAAAAAAGG - Intergenic
1027716804 7:81682021-81682043 ATGGTTTAATAGAAAAATAAAGG + Intergenic
1027821568 7:83052220-83052242 ATGCATTAATAGAGGAAATATGG + Intronic
1027924083 7:84437466-84437488 ATGCTCTAATAAAACAAAAAAGG - Intronic
1028053441 7:86212654-86212676 ATGATTTTCCAGAAAAAAAATGG + Intergenic
1028756627 7:94442348-94442370 ATGCTTGTACAGAAAAAAAGAGG + Intergenic
1028797353 7:94918728-94918750 ATGCTTTTAAAAAAGAATATAGG + Intronic
1029271283 7:99378376-99378398 TTGCTTTTAAAAAAGAAAAATGG + Intronic
1029854584 7:103502548-103502570 ATGCTTTGATAAGAGAAAAATGG + Intronic
1029890621 7:103925926-103925948 AAGCTTTTATACAATAAAAAAGG + Intronic
1030377689 7:108772542-108772564 ATGCTTTCTTGGAGGAAAAAAGG - Intergenic
1031026227 7:116683063-116683085 ATTTTTTTAAAAAAGAAAAATGG - Intronic
1031392818 7:121236907-121236929 ATCCTTTTATAAAAAAACAAGGG + Intronic
1032016994 7:128386585-128386607 AGGCTTGAATAGAACAAAAAAGG + Intergenic
1032382527 7:131499735-131499757 ATCCTTTTATGGCAGAAACAGGG + Intergenic
1034780783 7:153880242-153880264 AGTCTTTTATAGAAGAGCAATGG - Intergenic
1034831664 7:154313566-154313588 ATGTTTTGATAGGTGAAAAAAGG + Intronic
1035188628 7:157145509-157145531 ACTCTTTTAAAAAAGAAAAAAGG + Intronic
1035246846 7:157568082-157568104 ATGCTTTTGTAGGAGAAAATTGG + Intronic
1035561948 8:611700-611722 ATTTTTTTAGAGAAGCAAAATGG + Intergenic
1036454640 8:8895937-8895959 ATTATTTTAAAAAAGAAAAATGG + Intergenic
1036459930 8:8943195-8943217 ATACTTTGATAGAAGAAATAAGG - Intergenic
1036984561 8:13513601-13513623 ATCATTTTATAGAAATAAAATGG - Intronic
1037029481 8:14085721-14085743 ATGCATGTATAAAAGAAAAGTGG + Intergenic
1037180233 8:15996076-15996098 GTACCTTTATATAAGAAAAAAGG - Intergenic
1037429074 8:18790600-18790622 ATGTTTTTATAGAAGAATGTTGG - Intronic
1038127120 8:24686860-24686882 ATACTTTTATAGCTGCAAAATGG + Intergenic
1038428420 8:27480571-27480593 ATGGTTTTATTGAGGAACAACGG + Intergenic
1038544580 8:28415480-28415502 ACGCTTTTGAAGAAGGAAAATGG - Intronic
1038685452 8:29713069-29713091 ATGTTTTTATCAAAGTAAAATGG + Intergenic
1039120834 8:34144516-34144538 GAGCTCTTTTAGAAGAAAAATGG + Intergenic
1039276766 8:35941161-35941183 ATGCTTGTTTAGAATAAAATGGG - Intergenic
1039332757 8:36557381-36557403 ATGCTTTTCTAGAAGGATATGGG - Intergenic
1039462912 8:37761217-37761239 ATGCTATTATATTAGAGAAATGG - Intergenic
1039486095 8:37911184-37911206 ATGCTTTTATAAGACAATAAAGG - Intergenic
1040456718 8:47605537-47605559 ATGCATATTTAAAAGAAAAATGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042095768 8:65214220-65214242 ATGCTATTAATGAAGAAAATGGG + Intergenic
1043047220 8:75341830-75341852 CAGCTTTTATAGAAGAGTAAAGG + Intergenic
1043130871 8:76459314-76459336 AAACTTTTTTAGAAGATAAATGG - Intergenic
1043170881 8:76965054-76965076 ATTATTTTATAAAAGGAAAAAGG - Intergenic
1043637350 8:82402901-82402923 TTGCTTTTATTGAAGATAGAAGG + Intergenic
1043790216 8:84456531-84456553 TTGCTTCTAAAGAAAAAAAAAGG + Intronic
1044175034 8:89109372-89109394 AGGCAGTTATAGAAGAAATATGG + Intergenic
1044189605 8:89299446-89299468 ATGCTTATATTGGGGAAAAAGGG + Intergenic
1044336675 8:90992147-90992169 ATGTTATTTTAGAAGAAAAAAGG - Intergenic
1044387371 8:91605143-91605165 ATACTTTAATAGAAAAAAATGGG - Intergenic
1045309997 8:100992960-100992982 CTGCTTTTACAGAAATAAAATGG - Intergenic
1045543631 8:103109104-103109126 ATGCTTTTATAGGAAAGAAAGGG + Intergenic
1045795821 8:106042730-106042752 ATAATTTTAAAAAAGAAAAATGG + Intergenic
1046803754 8:118457488-118457510 ATTCTTTTATTGAAGACATATGG + Intronic
1046826459 8:118696766-118696788 ATCCATTTAAAGAATAAAAAAGG - Intergenic
1047769964 8:128022732-128022754 ATCATTTTATAGATGAAGAAGGG - Intergenic
1048080736 8:131123468-131123490 ATGTTTTGAAAGAAAAAAAAAGG - Intergenic
1048747950 8:137636140-137636162 ATGCTCTTATGGAAAAATAATGG + Intergenic
1048978095 8:139684462-139684484 AAACTTTCCTAGAAGAAAAAGGG + Intronic
1050025038 9:1324959-1324981 ATATATTTATACAAGAAAAATGG + Intergenic
1050425546 9:5509171-5509193 TTGCTTTTGTAGAAGAAACAAGG + Intergenic
1050792375 9:9489073-9489095 AGGCTTTTAAAAGAGAAAAATGG - Intronic
1050857802 9:10383441-10383463 ATGCATTTATTGCAGAAGAAAGG - Intronic
1051315490 9:15825691-15825713 ATTTTTTTAAAGAAGAAAATTGG + Intronic
1052122527 9:24736013-24736035 ATGCTTTCAAAGAAGGGAAATGG - Intergenic
1052583055 9:30386401-30386423 ATACTTTTATAGAAAGCAAATGG - Intergenic
1052585543 9:30423753-30423775 CTGCTTTTAGAGAAAAATAAAGG - Intergenic
1052950952 9:34210831-34210853 ATGTGTTTAAAGAAAAAAAAAGG - Intronic
1053119132 9:35532440-35532462 ATTGGTTTATAGAAGACAAAAGG + Intronic
1053942038 9:43260807-43260829 CTGTTTTTATGAAAGAAAAAAGG - Intergenic
1054094905 9:60891185-60891207 AAGCTTATATGGAAGAGAAAAGG - Intergenic
1054116375 9:61167089-61167111 AAGCTTATATGGAAGAGAAAAGG - Intergenic
1054321728 9:63676298-63676320 ATTTTTTTAAAGAAGAAAGAAGG - Intergenic
1054591383 9:67015455-67015477 AAGCTTATATGGAAGAGAAAAGG + Intergenic
1054894412 9:70292034-70292056 AAGCTGTTATTCAAGAAAAATGG - Intronic
1055299046 9:74863887-74863909 ATGTTTTTTTAAAAAAAAAAAGG - Intronic
1055308713 9:74955845-74955867 ATGCTATTATGGAAGAACAAAGG - Intergenic
1055520559 9:77076565-77076587 ATGCTATTTTAAAAAAAAAATGG - Intergenic
1056038051 9:82630106-82630128 AAGATTTTATATAATAAAAAAGG + Intergenic
1057018211 9:91673506-91673528 AAGCTTTTAGAAAAAAAAAAAGG - Intronic
1057406493 9:94776043-94776065 GTTCATTTATAGAAGAACAAAGG + Intronic
1057715790 9:97494446-97494468 ATGTTATTTAAGAAGAAAAAAGG - Intronic
1058096583 9:100867913-100867935 ATGCTATTACAAATGAAAAAAGG + Intergenic
1058154478 9:101499504-101499526 AGGTTTTTAAAGAAAAAAAAAGG + Intronic
1058257441 9:102785910-102785932 ATTCTTTTATATCAGCAAAAAGG - Intergenic
1058555359 9:106160914-106160936 GTGCTTTTCTAGAAGTCAAAAGG + Intergenic
1058772602 9:108250663-108250685 ATAATTTTATATTAGAAAAATGG - Intergenic
1058914197 9:109549934-109549956 ATACTTTTCTAGAAAGAAAAGGG + Intergenic
1059130180 9:111739709-111739731 ATACTTTTAAAGCAAAAAAAGGG - Intronic
1059143906 9:111880055-111880077 AAGCTTTTATTCAAGAAAAATGG + Intergenic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1060329381 9:122651971-122651993 ATTTCTTTATTGAAGAAAAAAGG + Intergenic
1060705589 9:125796287-125796309 TTGCTTTTACAGATGAGAAATGG + Intronic
1061679078 9:132233881-132233903 AAGCTGTTTCAGAAGAAAAAAGG + Intronic
1185741928 X:2540634-2540656 GTGCTTTTTTAGTAGAGAAAGGG + Intergenic
1185774117 X:2788456-2788478 ATGCTTTTCCAGATGACAAATGG + Intronic
1185957038 X:4502566-4502588 ATCCTTATATAGCAGAAAGAGGG - Intergenic
1186066513 X:5771966-5771988 CTGATTTTATAAAAAAAAAATGG - Intergenic
1186227405 X:7414629-7414651 ATGCTTGTATAAATGAAACATGG + Intergenic
1187193481 X:17058664-17058686 ATGCATTTATACAGGAACAAGGG + Intronic
1187295368 X:17994503-17994525 ATGTTTTTAAAAGAGAAAAAGGG + Intergenic
1187359707 X:18613829-18613851 ATGCTTTTATGGTAGCATAAAGG - Intronic
1187416398 X:19097003-19097025 GTGCTTTTCTAGAAGAGAAGAGG + Intronic
1188597942 X:31923894-31923916 ACGCTATTATATAAGAAAACGGG - Intronic
1188985271 X:36763363-36763385 ATGTCTTAGTAGAAGAAAAATGG - Intergenic
1189124286 X:38429510-38429532 ATGCTATAATAGAAAATAAAGGG + Intronic
1189212534 X:39296007-39296029 ATGCTGTTATAGCAGCAGAAAGG - Intergenic
1189386513 X:40541161-40541183 ATTCTTTTATAGCAGCACAAAGG - Intergenic
1189563126 X:42211507-42211529 ATGCTATTAAAGATAAAAAATGG - Intergenic
1189615290 X:42777163-42777185 ATGGTTTTATAAAAGGAATATGG + Intergenic
1189728152 X:43989724-43989746 ATACTTTTGTAGAAGATTAATGG - Intergenic
1189728445 X:43993200-43993222 ATACTTTTGTAGAAGATTAATGG + Intergenic
1189810300 X:44775232-44775254 TTGGTTTTATAGATAAAAAAGGG + Intergenic
1189824606 X:44904865-44904887 AAGCGTTTAGTGAAGAAAAATGG - Intronic
1190882460 X:54501866-54501888 ATGCTTTTTAAGAATATAAAGGG + Intergenic
1191029674 X:55955153-55955175 AGGCTGTTAAAGAGGAAAAAAGG + Intergenic
1191836848 X:65472524-65472546 CTGAATTTATAGAAGAAAACAGG - Intronic
1192314461 X:70041233-70041255 CTCATTTTATAGAAGAAGAAAGG + Exonic
1193343855 X:80383406-80383428 CTTCTTTTCTAGAAGAAAGAAGG - Intronic
1193500002 X:82263694-82263716 ATACTATTCTAGAAGAATAAGGG - Intergenic
1193847107 X:86486252-86486274 ATGACTTCATAGAAAAAAAAGGG - Intronic
1193859474 X:86646435-86646457 ATACTTTTATTTAAAAAAAATGG + Intronic
1193976384 X:88124851-88124873 ATGGATTTAGAGAAGAAAGAGGG - Intergenic
1194007500 X:88514337-88514359 ACTCTCTTAAAGAAGAAAAAAGG - Intergenic
1194496044 X:94617719-94617741 AGACTGTTATAAAAGAAAAAGGG - Intergenic
1194689381 X:96963826-96963848 AGGATTTTATTCAAGAAAAATGG - Intronic
1194777887 X:97988106-97988128 AAGCTTTCAGAGAAGAAAATAGG + Intergenic
1194785696 X:98082002-98082024 ATGCTCTTATTGAAGTAAATAGG + Intergenic
1195109663 X:101634247-101634269 ATGGTTTTATTGAATAATAATGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195535523 X:106004760-106004782 ATGGTTTTAGAGAAGAGTAAAGG + Intergenic
1195596611 X:106698454-106698476 ATGTTTTTCTAGAAGTAAAAGGG + Intronic
1195730564 X:107963067-107963089 ATGCAATTATAAAAGAAAATGGG - Intergenic
1196542576 X:116926451-116926473 ATGCTCTTGTAGAAGAGCAAAGG + Intergenic
1196719922 X:118844121-118844143 CTGGTTTAATAGAATAAAAAGGG + Intergenic
1197126459 X:122952201-122952223 ATGCATTTAAAGAACTAAAAGGG - Intergenic
1197414100 X:126153162-126153184 CTTCTTTTAGAGAAAAAAAATGG - Intergenic
1197468109 X:126831952-126831974 ATGATTTCAGAGAAGAGAAAAGG + Intergenic
1197787834 X:130217867-130217889 ATGCTTTGATAGAATTAAAAAGG + Intronic
1197861258 X:130973208-130973230 GTGCATTTATTCAAGAAAAATGG - Intergenic
1198701617 X:139402831-139402853 CTGCTATTGTAGAAAAAAAATGG + Intergenic
1198768654 X:140105070-140105092 TTGCATTTAGAGAAGAACAATGG - Intergenic
1198950967 X:142072134-142072156 ATATTTTTAGGGAAGAAAAAAGG + Intergenic
1198997524 X:142590958-142590980 ATACCTTTATATAAGAAAATTGG - Intergenic
1199118484 X:144021385-144021407 ATGCTTTCATAACATAAAAAAGG - Intergenic
1199318933 X:146415467-146415489 ATTCTATTAAAGAAGAAAAATGG - Intergenic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1200632220 Y:5603146-5603168 CTGCTTTTTTACAAGAAGAAGGG - Intronic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1201674721 Y:16567194-16567216 ATGCCTGTATAACAGAAAAATGG + Intergenic
1201791647 Y:17847810-17847832 ATGTTTTTCTAGCAGCAAAATGG - Intergenic
1201809907 Y:18058179-18058201 ATGTTTTTCTAGCAGCAAAATGG + Intergenic
1201929898 Y:19331571-19331593 ATTTTTTTAAAAAAGAAAAATGG + Intergenic
1202094015 Y:21225947-21225969 ATGCATTTATATATGAATAAAGG - Intergenic
1202353256 Y:24017462-24017484 ATGTTTTTCTAGCAGCAAAATGG - Intergenic
1202517523 Y:25652653-25652675 ATGTTTTTCTAGCAGCAAAATGG + Intergenic