ID: 908699617

View in Genome Browser
Species Human (GRCh38)
Location 1:66884387-66884409
Sequence CATTATGGAAAACTGTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1788
Summary {0: 1, 1: 2, 2: 38, 3: 443, 4: 1304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908699617 Original CRISPR CATTATGGAAAACTGTAGGT AGG (reversed) Intronic
900904383 1:5542378-5542400 CATTATGGAAAACAGTATGGAGG + Intergenic
900976907 1:6023368-6023390 CACTATGGAAAACAGTATGGTGG - Intronic
901262355 1:7882982-7883004 CATTATGGAAAACAGTGTGGAGG + Intergenic
902103014 1:14009378-14009400 CACTATGGAAAACTGGATGGTGG - Intergenic
902521596 1:17020969-17020991 CAAGGTGGAAAACTGTAGGGTGG - Intronic
903531053 1:24031080-24031102 GATTATAGAAAACTGTCGGCCGG - Intergenic
904561896 1:31404339-31404361 CATTATGGAAAACAATATGGAGG - Intergenic
904989159 1:34577605-34577627 CATTATGGAAAACAGTATGGAGG - Intergenic
905156602 1:35988848-35988870 CTTTATGGAAAACAGTATGGAGG - Intronic
905333882 1:37230116-37230138 CATTATGGAAAACAGTATGGAGG - Intergenic
905588010 1:39136951-39136973 CTTTCTGCAAAACTGAAGGTTGG + Intronic
905642341 1:39599507-39599529 CACTATGGAAAACGGTATGGAGG - Intergenic
906014757 1:42565606-42565628 CAATATGGAAAACAGTATGGAGG + Intronic
906053501 1:42894842-42894864 CACTATGGAAAACAGTACGAAGG - Intergenic
906435347 1:45791162-45791184 CATTATGGAAAACAGTATAGAGG - Intronic
906816282 1:48883185-48883207 CATTATAGAAAACAGTATGGAGG - Intronic
906956584 1:50380607-50380629 CATTATGGAAAATAGTATGGAGG - Intergenic
907000092 1:50843949-50843971 CATTATGGAAAACAGTATGGAGG - Intronic
907086423 1:51679325-51679347 AATTATGGAAAACAGGATGTTGG - Intronic
907338942 1:53719769-53719791 CATTATGGAAAACAGTATAAAGG + Intronic
907452467 1:54554847-54554869 CATTATGGAAAACAGTATGGAGG - Intronic
907532847 1:55118991-55119013 CATTGTGGAAAACAGTATGGTGG + Intronic
907760973 1:57359510-57359532 CATTGTGGAAAACAGTATGGGGG + Intronic
907763380 1:57384329-57384351 CACTATGGAAAACAGTATGACGG + Intronic
907775876 1:57514255-57514277 CATTATGGAAAAAAGTATGAAGG - Intronic
907929807 1:58988852-58988874 GATGCTGGGAAACTGTAGGTTGG - Intergenic
908084280 1:60613919-60613941 CATTAAGGAAAACAGTATGGAGG - Intergenic
908457392 1:64317371-64317393 CATTATGGAAAACAGTAGAGAGG - Intergenic
908505907 1:64799823-64799845 CATTATGGAAAACAGTACGATGG - Intronic
908579135 1:65495470-65495492 CATTATAGAAAACAGTAGGGAGG + Intronic
908593700 1:65661391-65661413 CATTATGGAAAGTAGTAGGGAGG - Intergenic
908647921 1:66299631-66299653 TATTATGGAAAACGGTATGGAGG - Intronic
908699617 1:66884387-66884409 CATTATGGAAAACTGTAGGTAGG - Intronic
908771490 1:67600916-67600938 CACTATGGAAAACAGTATGGTGG - Intergenic
908812318 1:67995487-67995509 CATTGTGGAAAACAGTATGGAGG + Intergenic
908838888 1:68258102-68258124 CATTATGGAAAATGGTATGAAGG - Intergenic
908947287 1:69514400-69514422 CATTATGGAAAACACTAAGGAGG + Intergenic
909536972 1:76747916-76747938 CATTATGGGAGACTGGAGGGGGG + Intergenic
909545951 1:76846551-76846573 CATTATGGAAAACTGTATGGTGG - Intergenic
909784810 1:79597840-79597862 CATTATGGAAAACAATATGGAGG + Intergenic
909860779 1:80602644-80602666 CATTATGGAAAACAGTATGGAGG + Intergenic
910302588 1:85723542-85723564 CATTATGGAAAACAGTATAGAGG + Intergenic
910331675 1:86079841-86079863 CATTATGGAAAACAGTTTGGAGG + Intronic
910373833 1:86548018-86548040 CATTATGGAAAACAGTATGGAGG - Intronic
910475780 1:87605044-87605066 CATTATGAAAAACAGTATGGAGG - Intergenic
910573530 1:88733262-88733284 CATTATGGAAAACAGCATGAAGG - Intronic
910896840 1:92078751-92078773 CATTATGGAAAACAGTATGGAGG - Intergenic
911137503 1:94456817-94456839 CATTATGGAAAACAGTATGGAGG - Intronic
911172935 1:94789251-94789273 CACTATGGAAAACAGTATGGAGG + Intergenic
911214286 1:95175602-95175624 CATTATGGAAAACTGTCTGAAGG - Intronic
911303979 1:96210488-96210510 CAATATTGCAAACTGTAGGCAGG - Intergenic
911312832 1:96317122-96317144 CATTATGGAAAACGATATGGGGG - Intergenic
911389689 1:97225166-97225188 CATTATGGAAAACAATATGGAGG - Intronic
911442850 1:97950425-97950447 GAATATGGAAAGCTGTAGTTGGG - Intergenic
911684009 1:100752906-100752928 CATTATGGAAAACAGTACAGAGG - Intergenic
911698034 1:100915841-100915863 CACTATGGAAAACAGTATGGAGG - Intronic
911771651 1:101750743-101750765 CATTATGGAAAACAGTATGGAGG - Intergenic
911993060 1:104726815-104726837 CATTATGGAAAATAGTATGGAGG + Intergenic
912072341 1:105827034-105827056 CATTATGGAAAACAGTATGGAGG + Intergenic
912591619 1:110826558-110826580 CATTATGGAAAACTGCATGGAGG + Intergenic
912743837 1:112228008-112228030 CACTATGGAAAACAGTATGGAGG + Intergenic
913374806 1:118139384-118139406 CATTATGGAAAACACTATGGAGG + Intronic
913384113 1:118240930-118240952 CACTATGGAAAACAGTATGGAGG + Intergenic
913431631 1:118800444-118800466 CATTATTGAAAACAATAGGGAGG + Intergenic
913459734 1:119071263-119071285 CATTATGGAAAACAGTATGGTGG + Intronic
914266690 1:146044148-146044170 GACTATGGAAAACAGTAGGCCGG + Intergenic
914557538 1:148781821-148781843 CACTATGGAAAACAGTATGGAGG + Intergenic
914615296 1:149348409-149348431 CACTATGGAAAACAGTATGGAGG - Intergenic
915153144 1:153851356-153851378 CACTATGGAAAACAGTATGGAGG - Intronic
915640644 1:157222076-157222098 CATTATGGAAAACAGTATGGAGG - Intergenic
915703241 1:157818077-157818099 CATTATGGAAGACAGTATGGAGG + Intronic
915764229 1:158347271-158347293 CATTATGGCAAACAGTACGCAGG + Intergenic
915833030 1:159148589-159148611 CGTTATGGAAAACAGTATGAAGG + Intergenic
915919787 1:159966533-159966555 TATTATGGAAAACAGTATGGAGG - Intergenic
916067357 1:161147077-161147099 AATTATGGTAAATTGTAGCTTGG - Intergenic
916170137 1:161995756-161995778 CATTCTGGAAAACTGTGGTAGGG + Intronic
916185903 1:162132727-162132749 CAATATGGAGACCTGTGGGTTGG - Intronic
916188727 1:162158560-162158582 CATTATGGAAAACAGTATGGAGG - Intronic
916323138 1:163528169-163528191 CATTATGGAAAACAGTATGGAGG + Intergenic
916585408 1:166145388-166145410 CATTAGGGCATCCTGTAGGTTGG + Intronic
916714358 1:167436898-167436920 CATTATGGAAAACAGTATTGAGG + Intronic
916805756 1:168259669-168259691 CATTATGGAAAACAGTATGGAGG - Intergenic
916990931 1:170244063-170244085 CATTATGGAAAACAGTATGGCGG - Intergenic
916993187 1:170266923-170266945 CAATATGGAAAACAGTACGGAGG - Intergenic
917025829 1:170640352-170640374 TATTATGGAAAACAGTATGGAGG - Intergenic
917069360 1:171133094-171133116 CATTATGGGAAACAGTATGAAGG + Intergenic
917253164 1:173084628-173084650 CATTATGGAAAACAGTAAGGAGG + Intergenic
917319733 1:173767457-173767479 CATTACGGAAAACAGTATGGAGG - Intronic
917527242 1:175799526-175799548 CATTGTGGAAAACAGTATGGAGG + Intergenic
917698242 1:177551934-177551956 CATTATGAAAAACAGTATGGAGG - Intergenic
917990200 1:180367960-180367982 CATTATGGAAAGCAGTATGGCGG - Intronic
918108679 1:181436285-181436307 CATTATGGAAAATAGTATGGCGG + Intronic
918225885 1:182482691-182482713 CAGTATGGAAAACAGTATGCAGG + Intronic
918452621 1:184674258-184674280 CATTATGGAAAACGGTATAGAGG - Intergenic
919017914 1:192064491-192064513 CATCATGGAAACCTGTATGGAGG + Intergenic
919029094 1:192216315-192216337 CATCATGGAAAACAGTATGCAGG - Intergenic
919034461 1:192288898-192288920 CATTATGGAAATCAGTATGGAGG + Intergenic
919044536 1:192434582-192434604 CATTATGGAAAACATTATGGAGG - Intergenic
919096277 1:193040564-193040586 TACTATGGAAAACTGTATGGAGG + Intronic
919120029 1:193327972-193327994 CATTATGGAAAACAGTTTGGAGG - Intergenic
919316394 1:195976009-195976031 CACTATGGAAAACAGTTGGGAGG - Intergenic
919320884 1:196036427-196036449 CATTATGGAAAACAGTATGTAGG - Intergenic
919483346 1:198116393-198116415 CATTATAGAAAACAGTATGGAGG + Intergenic
919560828 1:199116069-199116091 TGTTGTGGAAAACTGGAGGTGGG - Intergenic
919598853 1:199598568-199598590 CATTATGGAAAACAGTATGGAGG + Intergenic
919858572 1:201722692-201722714 CATTGTGGAAAACGGTATGGTGG - Intronic
919962150 1:202482306-202482328 CATTGTGGAAAACAGTATGGAGG - Intronic
919963776 1:202500043-202500065 CATTATGGAAAACAGTATGGAGG + Intronic
920083705 1:203398022-203398044 CATCATGGAAAACAGTATGGAGG - Intergenic
920135704 1:203767638-203767660 CATTATGGAAAACACTATGGAGG - Intronic
920181268 1:204133324-204133346 TACTATGGAAAACAGTAGGGTGG - Intronic
920349851 1:205330524-205330546 CATGATGGCAAACTGCAGCTTGG + Intergenic
921127815 1:212193651-212193673 CATTATGGAAAACAGTACGGAGG - Intergenic
921174034 1:212577996-212578018 CATTATGAAAAACAGTATGGAGG - Intronic
921176408 1:212599031-212599053 CATTATGGAAAACAGTTTGGAGG - Intronic
921347462 1:214201523-214201545 CATTATGGAAAACTGTATGGAGG + Intergenic
921461778 1:215435842-215435864 CATTATGGAAAATAGTATGGAGG - Intergenic
921529640 1:216265416-216265438 CATTATGGAAAAAAGTATGAAGG + Intronic
921688773 1:218122776-218122798 CATTACGGAAAACTGTATGGAGG + Intergenic
921733971 1:218605852-218605874 CATTATGGAAAACAGTATGGAGG + Intergenic
921757039 1:218869896-218869918 TATTATGGAAAACAGTATGGAGG - Intergenic
921956361 1:220987893-220987915 CATTATAGAAAACAGTAGGGAGG - Intergenic
922131201 1:222780718-222780740 TATTATGGAAAACAGTATGGAGG - Intergenic
922378143 1:224990865-224990887 CCATATGGAAAACTGTATGGAGG - Intronic
922384239 1:225065932-225065954 CCTTTTGGAAAACTGTATGGAGG - Intronic
922940429 1:229459931-229459953 CATTATGGGAAACTGTATGGAGG - Intronic
923058277 1:230446153-230446175 CATTATGGAAAAGAGTATGGAGG + Intergenic
923082681 1:230673597-230673619 CATTATGTATATCTGTAGTTTGG + Intronic
923139119 1:231146161-231146183 CATTATGGAAAACTTCACGGAGG + Intergenic
923350685 1:233102449-233102471 CACTATGGAAAACAGTATGCAGG - Intronic
923376191 1:233365758-233365780 CATTGTGGAAAACAGTATGGAGG + Intronic
923428877 1:233900772-233900794 CATTATGGGAAAATGTATGCAGG + Intergenic
923834976 1:237601010-237601032 CATTATGAAAAACAGTATGGAGG + Intronic
923915498 1:238499213-238499235 CATTATGGAAAGCAGTATGACGG + Intergenic
924116046 1:240748250-240748272 CATTATGAAAAAATGTATGGAGG + Intergenic
924393471 1:243589604-243589626 CATTATGGAAAACAGTATGGAGG + Intronic
924445931 1:244130953-244130975 CATTATGGAAAACAGTATAGAGG - Intergenic
924647333 1:245890644-245890666 TACTATGGAAAACTGTATGAAGG + Intronic
924649677 1:245914192-245914214 CATTATGGAAAACAGCATGAGGG + Intronic
1063024530 10:2164777-2164799 CATTATGGAAAACAGTAAGGAGG + Intergenic
1063286947 10:4699483-4699505 CATTATGGAAAACAGTATGGAGG + Intergenic
1063757541 10:9031616-9031638 CATTATGGAAAACAGTATGGTGG + Intergenic
1063871288 10:10420328-10420350 CATTATGGAAAACAGTATGGGGG - Intergenic
1063901756 10:10740478-10740500 CATTATGGAAAATGGTATGGAGG + Intergenic
1064816002 10:19263212-19263234 CATTATGAAAAACAGTATGGAGG - Intronic
1064928021 10:20591625-20591647 CACTATGGAAAACAGTATGGAGG + Intergenic
1065200254 10:23305748-23305770 CATTATGGAAAATAGTATGGAGG + Intronic
1065407460 10:25385535-25385557 CACTATGGAAAACAGTATGAAGG - Intronic
1065764820 10:29018599-29018621 CATTATGGAAAACAGTATGGAGG + Intergenic
1065888103 10:30096419-30096441 TATTATGGAAATCTCTAGGCAGG + Intronic
1066025166 10:31349489-31349511 CACTATGGAAAACAGTATGGAGG - Intronic
1066042203 10:31560658-31560680 CATTATAGAAAACTGTATGAAGG + Intergenic
1066227724 10:33400597-33400619 CAATCTGGAAAAGTGTAGGCTGG - Intergenic
1067168811 10:43887420-43887442 CATTATGGAAAACAGTATGGAGG + Intergenic
1067959471 10:50831985-50832007 CATTATGGAAAACAGTATGCAGG + Intronic
1068205465 10:53845297-53845319 CATTATGGAAAACAGTATGGAGG + Intronic
1068325873 10:55485566-55485588 CATTATGGAAAACAGTATGGAGG + Intronic
1068334279 10:55611574-55611596 CATTATGGAAAACAGAAGGGAGG + Intronic
1068453679 10:57227555-57227577 TATTATGGAAAACGGCAGGGAGG - Intergenic
1068614062 10:59092358-59092380 AATTATAGAAAACTTTAGGTAGG - Intergenic
1068695250 10:59961286-59961308 CATTATGGAAAGCAGTATGGAGG - Intergenic
1068764647 10:60749607-60749629 CATTACGGAAAATGGTAAGTGGG + Intergenic
1068771696 10:60828667-60828689 CATTATGGAAAACATTATGTAGG + Intergenic
1068843836 10:61648199-61648221 CACTATGGAGAACAGTATGTAGG - Intergenic
1069011659 10:63380840-63380862 CAGTATGGAAAACAGTATGGAGG + Intronic
1069106521 10:64389718-64389740 CATTATGGAAAACTGTATGGAGG + Intergenic
1069276048 10:66592455-66592477 CAGGATGGAAAAGTGGAGGTTGG - Intronic
1069277491 10:66610698-66610720 AAATATGGAAAACTGTATGGAGG + Intronic
1069357562 10:67604958-67604980 CATTTTGGAAAACAGTATGGAGG + Intronic
1069371777 10:67755417-67755439 CACTATGGAAAACAGTATGGAGG + Intergenic
1069509135 10:69028098-69028120 GATTGTGCAAAACTGTAGGATGG + Intergenic
1069650709 10:70045659-70045681 CAGTATGGAAAACAGTATGCAGG + Intergenic
1070099830 10:73374460-73374482 CATTATAGAAAACAGTATGGAGG + Intergenic
1070455205 10:76607938-76607960 CACTATGGAAAACAGTTTGTAGG + Intergenic
1070556928 10:77535465-77535487 CACTATGGAAAACAGTATGAAGG + Intronic
1070566738 10:77609015-77609037 CATTATGGAAAACAGTATGGAGG + Intronic
1071002786 10:80849726-80849748 CATTATGAAAAACAGTAGGGAGG + Intergenic
1071036280 10:81249894-81249916 AATTATGTAATACTTTAGGTTGG + Intergenic
1071146078 10:82573955-82573977 CATTATGGAAAACACTATGGAGG + Intronic
1071460544 10:85889750-85889772 CATTATGGAAAACAGTATAGAGG - Intronic
1071596144 10:86927737-86927759 CATTAGGGGAAACTGTACATAGG + Exonic
1071684302 10:87738287-87738309 CACTATGGAAAACAGTATGGAGG - Intronic
1071956176 10:90762203-90762225 CTTTATGGAAAACAGTATGGAGG - Intronic
1072047178 10:91668730-91668752 TATTATGGAAAACAGTATGGAGG - Intergenic
1072177653 10:92944624-92944646 CATTATGGAAAACAGGATGGAGG - Intronic
1072409435 10:95186211-95186233 CACTATGGAAAACTGCATGGAGG + Intergenic
1072678353 10:97485896-97485918 CATTATGGAAAACAGCATGGAGG + Intronic
1073198331 10:101713769-101713791 CATTATGGAAAACAGTATGGAGG - Intergenic
1073437029 10:103524011-103524033 CATTATGGAAAACAGTATCAAGG - Intronic
1073654756 10:105401735-105401757 CATTATGGAAAATAGTATGGAGG + Intergenic
1073685430 10:105747327-105747349 CATTATGGAAAACGGTATGGAGG + Intergenic
1073712692 10:106062788-106062810 CATTATGGAAAACAATATGGTGG - Intergenic
1073807613 10:107116184-107116206 CATTATGTAAGACAGTAGGAAGG + Intronic
1073851520 10:107624526-107624548 CATTATGGAAAATAGTATGGAGG - Intergenic
1073856941 10:107687215-107687237 CATTGTGGAAAACAGTATGGAGG + Intergenic
1074033213 10:109710073-109710095 CATTATGGAAAACAGTATAGAGG + Intergenic
1074041024 10:109788699-109788721 CATTGTGGAAAACAGTATGGAGG - Intergenic
1074061347 10:109968915-109968937 CATTTAGCAAAACTGAAGGTGGG + Intergenic
1074075813 10:110123286-110123308 CATTGTGGAAAACAGTATGGAGG - Intronic
1074173488 10:110970603-110970625 CACTATGGAAAACAGTATGAAGG - Intronic
1074466284 10:113683897-113683919 CATTATGGAAAACTGTCTAGAGG - Intronic
1074583784 10:114746629-114746651 CATTATAGAAAACAGTATGGAGG - Intergenic
1074638497 10:115349537-115349559 CACTATGGAAAACAGTATGGAGG - Intronic
1075341813 10:121652779-121652801 CACTATGGAAAACAGTATGGAGG + Intergenic
1075988888 10:126815738-126815760 CATTATGGAGAACAGTATGGAGG + Intergenic
1076050640 10:127330504-127330526 CACTATGGAAAATAGTAGGATGG + Intronic
1076133494 10:128029272-128029294 CAGCTTGGAAACCTGTAGGTGGG - Intronic
1077682519 11:4256202-4256224 CATTATGGAAAACACTCTGTAGG - Intergenic
1077687514 11:4310537-4310559 CATTATGGAAAACACTCTGTAGG + Intergenic
1077854165 11:6105370-6105392 CATTATGGAAAACAATATGGAGG + Intergenic
1077936241 11:6789823-6789845 CATTATGGAAAACAGTATGGAGG + Intergenic
1078123941 11:8539980-8540002 CATTATGGAAAACAGTATGGAGG + Intronic
1078312055 11:10254059-10254081 TATTATGGAAAACAGTACGGAGG + Intronic
1078328545 11:10400137-10400159 CATTATGGAAAACAGTATGGGGG - Intronic
1078583101 11:12555106-12555128 CATTATGGAAAACAATATGGAGG + Intergenic
1078960826 11:16267615-16267637 CATTATGAAAAACTGTATGCAGG + Intronic
1078984859 11:16583831-16583853 CATTATGGAAAACAGTGTGGAGG - Intronic
1079319083 11:19435643-19435665 CATTTTGGAAAACAGTATGGAGG - Intronic
1079474086 11:20809932-20809954 CATCATGGAAAACAGTATGGAGG - Intronic
1079553131 11:21726185-21726207 CATTATGGAAAATAGTATGGAGG - Intergenic
1079573366 11:21972433-21972455 CATTATAGAAAATAGTATGTAGG - Intergenic
1079665748 11:23103447-23103469 CTTGATGGAAAAATGCAGGTAGG - Intergenic
1079745089 11:24116716-24116738 CATTATGGAAAACAGTATAGAGG + Intergenic
1079832505 11:25286301-25286323 CACTATGGACAACTGTACGGAGG - Intergenic
1079971331 11:27039507-27039529 CGTTATGGAAAACAGTATGGTGG + Intergenic
1080108891 11:28543349-28543371 CATCATGGAACACTGGAGGTGGG + Intergenic
1080163381 11:29206712-29206734 CATTATGGAAAACAGTATGGAGG + Intergenic
1080220979 11:29903589-29903611 CACTATGAAAAACTGTATGCTGG + Intergenic
1080293648 11:30700358-30700380 CATTATGGAAAACAGTAGGGAGG - Intergenic
1080404061 11:31963051-31963073 CACTATGGAAAACAGTATGGCGG - Intronic
1080468089 11:32517354-32517376 CATTATGGAAAACAGTGTGGAGG - Intergenic
1080607985 11:33879917-33879939 CATTATTGAAAACGGTATGCCGG + Intronic
1080713749 11:34776800-34776822 CATTATGGAAAACAGTATGGAGG - Intergenic
1080747548 11:35122067-35122089 CACTATGGAAAACAGTATGGAGG - Intergenic
1080788896 11:35501995-35502017 CATTATGGAAAACTGTATGGAGG - Intronic
1081145313 11:39556255-39556277 CACTATGGAAAACAGTACGAAGG + Intergenic
1081180460 11:39980041-39980063 CATTATGGAAAACAGTATAGAGG - Intergenic
1081210789 11:40331200-40331222 CATTATGGAAAACAGTATGGAGG + Intronic
1081214856 11:40383428-40383450 CACTATGGAAAACAGTATGGAGG - Intronic
1082131330 11:48493123-48493145 CACTATGGAAAACAGTATGGAGG - Intergenic
1082221086 11:49638199-49638221 CATTAAGGAAAACTGAGGGAAGG - Intergenic
1082245474 11:49917008-49917030 CACTATGGAAAACAGTATGGAGG + Intergenic
1082564826 11:54663997-54664019 CACTATGGAAAACAGTATGGAGG - Intergenic
1082733895 11:56834589-56834611 CATTATGGAAGACAGTGTGTAGG - Intergenic
1082864969 11:57890646-57890668 CATTATGGAAAACAGTATGGAGG - Intergenic
1082914681 11:58419622-58419644 CATTATGGAAAACAGTATGGAGG + Intergenic
1083004352 11:59327835-59327857 CATTATGGAAAACTGTACAGAGG - Intergenic
1083520514 11:63306689-63306711 CATTATGGAAAACAGTATGAAGG - Intronic
1085188509 11:74597164-74597186 CATTATGTAAAACGGTATGGAGG - Intronic
1085427596 11:76418532-76418554 CACTATGGAAAACTTTATGGAGG + Intergenic
1085509085 11:77076935-77076957 CATTATGGAAAACAGTATAGAGG - Intronic
1085817321 11:79753162-79753184 CATTATGGAAAAGAGTATGGAGG + Intergenic
1085906677 11:80773080-80773102 CCTTATGGAAAACTGTATATAGG + Intergenic
1086182276 11:83967304-83967326 CATTATGGAAAACAGTATGCAGG - Intronic
1086276850 11:85140230-85140252 CATTATGGAAAACAGTATGGAGG - Intronic
1086320311 11:85639646-85639668 CATTATGGAAAACAGTATGGTGG + Intergenic
1086461527 11:87010518-87010540 CATTATGGAAAACAGTATGGAGG + Intergenic
1086719959 11:90107684-90107706 CACTATGGAGAACTGTATGGAGG - Intergenic
1086981445 11:93202365-93202387 CATTATTGAGAGCTGTAGGGAGG + Intergenic
1087434859 11:98101910-98101932 CATTATGGAAAATAGTATGGAGG + Intergenic
1087601361 11:100320127-100320149 CATTATTGAAAACAGTATGGAGG - Intronic
1087630521 11:100645871-100645893 CATTCTGGAAAACAGTATGGAGG + Intergenic
1087675808 11:101159701-101159723 CATTATGGAGAACAGTATGAAGG - Intergenic
1087785987 11:102354667-102354689 CATTATGGAAAACAGTATAGAGG - Intronic
1087867722 11:103252424-103252446 CATTATGAAAAATGGTAGGAAGG - Intronic
1088386079 11:109258032-109258054 CATTATGGAAAACAGTATGGAGG - Intergenic
1088432299 11:109772090-109772112 CATTGTGGAAAACAGTATGGTGG + Intergenic
1088612987 11:111596644-111596666 CATTATGGAAATCAGTATGGAGG + Intergenic
1089193702 11:116677883-116677905 CATTATGGAAAACAATATGGAGG + Intergenic
1089819876 11:121215120-121215142 CATTATGAAAAACAGTGGGGAGG + Intergenic
1089827083 11:121287814-121287836 CATTATGGAAAACAATATGGAGG + Intergenic
1090112122 11:123924083-123924105 CATTATGGAAAACAGTATGGAGG - Intergenic
1090133656 11:124171530-124171552 CATAATGGAAAACTCCTGGTAGG + Intergenic
1090284912 11:125491461-125491483 GAAAATGGAAAACTGTATGTGGG - Intronic
1090469135 11:126963917-126963939 CGTTATGGACAAGTGCAGGTGGG - Intronic
1090629180 11:128631630-128631652 CGCTATGGAAAACAGTAGGGAGG - Intergenic
1090682085 11:129071634-129071656 CATTTTGGAAAACTATATGGAGG + Intronic
1090822076 11:130351917-130351939 CACTATGGAAAACAGTATGGTGG - Intergenic
1090885761 11:130874936-130874958 CACTATGGAAAACAGTATGAAGG + Intergenic
1091197030 11:133739810-133739832 CATTATGGAAAACAGGATGGAGG + Intergenic
1091519848 12:1227199-1227221 CATTATGGAAAACGGTAAGAAGG - Intronic
1091547472 12:1511568-1511590 CATTCTGGAAAACAGTATGAAGG - Intergenic
1092236895 12:6816045-6816067 CCTTCTGGAAAGCTGGAGGTGGG - Exonic
1092724538 12:11472416-11472438 CATTATGGAAAATGGTATGGAGG - Intronic
1092839917 12:12530083-12530105 CATTATGGAAAACACTATGGAGG - Intronic
1093061125 12:14606242-14606264 CATTATGAAAAACAGTATGAAGG - Intergenic
1093072573 12:14722163-14722185 CATTAGGGAAAACAGTATGGAGG - Intergenic
1093138738 12:15481928-15481950 CATTATGGAAAACAGTATGGAGG + Intronic
1093303673 12:17484620-17484642 TATTATGGAAAACAGTATGGAGG + Intergenic
1093330871 12:17836858-17836880 CATTATGGAAAACAATATGGAGG - Intergenic
1093360092 12:18214782-18214804 CATTATGGAAAACATTATGGAGG + Intronic
1093436732 12:19143196-19143218 CATTATGGAAAACAGTATGGAGG - Intronic
1093541459 12:20291507-20291529 CATTATGAGAAACTGTATGGAGG - Intergenic
1093549644 12:20392571-20392593 CATTATGGAAAACAGTATGGAGG + Intronic
1093850517 12:24031114-24031136 CATTATGGAAAACAGTATGGAGG + Intergenic
1093984827 12:25518933-25518955 GATTAGGGAAAACGGTTGGTGGG + Exonic
1094038607 12:26098476-26098498 CATTATGGAAAATGGTATGGGGG + Intergenic
1094389813 12:29936684-29936706 CACTAGGGAAAATTGTATGTAGG - Intergenic
1094450573 12:30579179-30579201 CACTATGGAAAACAGTATGCAGG + Intergenic
1094657985 12:32439534-32439556 CATTATGGGAAACAGTATGAAGG - Intronic
1094743087 12:33311740-33311762 TATTATGGAAAACAGTATGGTGG + Intergenic
1094746962 12:33355839-33355861 CATTGTGGAAAACAGTATGGAGG - Intergenic
1094763662 12:33565073-33565095 CATTATAGAAAACAGTATGGAGG + Intergenic
1095042661 12:37460492-37460514 CACTATGGAAAACAGTATGGAGG - Intergenic
1095217895 12:39571142-39571164 CATCATGGAAAACAGTAAGGAGG + Intronic
1095394792 12:41749685-41749707 CATTGTGGAAAACAGTATGGAGG - Intergenic
1095408945 12:41901136-41901158 CATTATGGAAAACAGGATGGAGG + Intergenic
1095411997 12:41934602-41934624 CATTGTGGAAAACAGTATGGAGG + Intergenic
1095798331 12:46245532-46245554 CATTATAGAAAACAGTATGGAGG + Intronic
1095803697 12:46295187-46295209 CATTATGGAAAATAGTATGGTGG + Intergenic
1095852028 12:46820746-46820768 CAATATGGAAAACAGTATGGAGG - Intronic
1095853508 12:46835903-46835925 CATTATGGATAACTGTATGGAGG - Intergenic
1096017414 12:48290129-48290151 CATTATGAAAAACAGTATGGAGG + Intergenic
1096161445 12:49380956-49380978 CGCTATGGAAAACTGTATGGTGG - Intronic
1096188091 12:49596701-49596723 CATTGTGGAAAACAGTATGGAGG + Intronic
1096415916 12:51412986-51413008 CATTATGGAAAACAGTATGGAGG - Intronic
1096435192 12:51584286-51584308 CATTATGGAAAACAATATGAAGG - Intergenic
1096598326 12:52712051-52712073 CATGATGGAAAACAGTATGGAGG - Intergenic
1096897814 12:54841412-54841434 CATTATGGAAAACTGTATGGAGG - Intronic
1096959802 12:55566907-55566929 CATTATGGAAAACAGTATGGAGG + Intergenic
1096970644 12:55663632-55663654 CATTATGGAAAACTGTGTGGAGG + Intergenic
1097207601 12:57336221-57336243 CATTATGGAAAGCAGTATGATGG + Intronic
1097362789 12:58676414-58676436 CATCATAGAAAACTGTATGGAGG - Intronic
1097965250 12:65572443-65572465 CAGAATGGAAAATTGTAGGTGGG - Intergenic
1098072507 12:66690959-66690981 CATTATGGAAAACAGTATGGAGG - Intronic
1098072596 12:66692073-66692095 GATAATGGAAAACTGAAGGTGGG - Intronic
1098355057 12:69604711-69604733 CTTTATGGAAAACAGTATGGAGG - Intergenic
1098484552 12:71005667-71005689 CCTTATGGAAAACAGTATGGAGG - Intergenic
1098596504 12:72278508-72278530 CATTATGGAAAACAGTATGGAGG - Intronic
1098717157 12:73844383-73844405 TATGATGGAAAACTGTATGTAGG - Intergenic
1099154147 12:79153340-79153362 CTATCTGGAAAATTGTAGGTCGG + Intronic
1099405414 12:82254259-82254281 CATTATGGAAAACAGTATGAAGG + Intronic
1099416348 12:82391806-82391828 CATTATGGAAAACAGTATAGAGG - Intronic
1099506762 12:83487233-83487255 CATTACGGAAAACAGTATGTAGG - Intergenic
1099682732 12:85848557-85848579 AATTATGGAAAACTGTACGGAGG - Intergenic
1099782949 12:87223163-87223185 CATTATGGAAATCAGTATGGAGG - Intergenic
1099840719 12:87962279-87962301 CATTATGGAAAACATTATGGAGG - Intergenic
1100127466 12:91445895-91445917 CATTATGGAAAACAGTATAGGGG + Intergenic
1100342722 12:93696159-93696181 CATTATGGAAAACAGTATGGAGG + Intronic
1100780297 12:98018149-98018171 CATTATGGAAAATAGTATGGAGG + Intergenic
1100835678 12:98564856-98564878 CATTATGGAAAACAGTATGGAGG + Intergenic
1100841429 12:98616068-98616090 CATTATGGAAAACAGTGTGGAGG - Intronic
1100968008 12:100034058-100034080 CATTATGGAAAACAGTATGGAGG + Intronic
1101114682 12:101520371-101520393 CACTATGGAAAACAGTATGGAGG + Intergenic
1101207163 12:102499933-102499955 CATTATGGAAAACTGTAAGGAGG + Intergenic
1101361624 12:104032733-104032755 CATTATGGAAAACAATATGGAGG + Intronic
1101429192 12:104612761-104612783 CATTATGGAAAACAGTATGGAGG + Intronic
1101637016 12:106552173-106552195 CATTATGAAAAACAGTATGGAGG + Intronic
1101716390 12:107317025-107317047 CATTATGGAAAACAGCATGGAGG - Intergenic
1101766081 12:107700739-107700761 CATTATGGAAAATAGTATGGTGG - Intronic
1101938282 12:109078113-109078135 TATTATGGAAAATTGTACGGAGG - Intronic
1102087191 12:110152223-110152245 CATTATAGAAAACAGTATGGAGG - Intronic
1102138623 12:110596226-110596248 CATTATGGAAAACAGTATGGTGG + Intergenic
1102443385 12:112980788-112980810 CATTACGGAAAACAGTATGGAGG - Intronic
1102725120 12:115056514-115056536 CATTATGGAAAACAGTATGGCGG - Intergenic
1102750887 12:115293024-115293046 CACTATGGAAAACAGTATGGAGG - Intergenic
1102757317 12:115352800-115352822 CTTTATGGAAAACAGTATGGAGG - Intergenic
1102758105 12:115360552-115360574 CAGTATGGAAAACAGTATGGAGG - Intergenic
1103047329 12:117747873-117747895 CATTATGGAAAACAGTGTGGAGG + Intronic
1103103520 12:118202436-118202458 CATTATGGAAAACAGTATGGAGG - Intronic
1103169283 12:118799813-118799835 CATTATGGAAAACAGTATGGAGG - Intergenic
1103988474 12:124782678-124782700 CAGGAAGCAAAACTGTAGGTGGG - Exonic
1104331862 12:127854465-127854487 CATTATGGAGAACAGTATGGAGG + Intergenic
1104514802 12:129415241-129415263 CATTACAGAAAATGGTAGGTAGG - Intronic
1104564329 12:129866692-129866714 CATTACGGCAAACAGTACGTAGG + Intronic
1104601008 12:130153438-130153460 TCTTAGGGAAAACTGTAGGATGG + Intergenic
1104867961 12:131971551-131971573 CATTATGGAAATCAGTATGAAGG - Intronic
1105534538 13:21252555-21252577 CATTATGGAAAATAGTATGGCGG + Intergenic
1105545807 13:21350152-21350174 CATTATGTAAAACAATATGTAGG - Intergenic
1106020675 13:25911939-25911961 CATTATGGAAAACTATATGGAGG + Intronic
1106029445 13:25986780-25986802 CATTATGGAAAACAGTATGGAGG - Intronic
1106279065 13:28246990-28247012 CACTATGGAAAACAGTATGGAGG - Intronic
1106380893 13:29237990-29238012 CATTATGGATAACAGTATGGAGG + Intronic
1106452925 13:29900084-29900106 CATTATGGAAAACAATATGGAGG - Intergenic
1106709148 13:32312331-32312353 CATTATGGACAACAGTATGAAGG + Intronic
1106819518 13:33448674-33448696 CATTATGGAAAACAGTATGGCGG - Intergenic
1106890263 13:34237462-34237484 CATTACGGAAAACAGTATGGAGG - Intergenic
1107101961 13:36602922-36602944 CATTATGGAAAACAGTATGGAGG + Intergenic
1107200108 13:37704869-37704891 CATTATGGAAAATAGTATGGAGG + Intronic
1107219562 13:37966129-37966151 CAATATGGAAAACTGGATGTGGG - Intergenic
1107246109 13:38296534-38296556 CGTTATGGAAAACAGTATGGAGG + Intergenic
1107287999 13:38818104-38818126 CATTATGGAATACAGTATGGCGG + Intronic
1107291961 13:38864684-38864706 CAAGATGGAAAACTGGAGTTGGG - Intronic
1107649365 13:42528674-42528696 CATTATGGAAAACTGCATGAAGG - Intergenic
1108210623 13:48136391-48136413 CATTATGGAAAATTGTATGGAGG + Intergenic
1108300652 13:49071446-49071468 CATTAGGGAAAACAGTATGGAGG - Intronic
1108790356 13:53962605-53962627 CATTGTGGAAAACAGTAGGAAGG - Intergenic
1108791798 13:53978206-53978228 CACTATGGAAAACAGTATGCAGG + Intergenic
1108900227 13:55393929-55393951 CACTATGGAAAACAGTATGGAGG + Intergenic
1108906754 13:55485347-55485369 CATTATGTAAAGCAGTAGGGAGG - Intergenic
1108971871 13:56386600-56386622 CATTATGGTAAACTGTATTAAGG + Intergenic
1109203268 13:59454139-59454161 CATGGTAGAAAACTGCAGGTAGG - Intergenic
1109347562 13:61134274-61134296 CATTATTGAGAACTGCATGTGGG + Intergenic
1109400084 13:61815718-61815740 TATTATGAAAAACTGAAGGGAGG + Intergenic
1109418352 13:62074713-62074735 CATTATGGTAAACAGTATGGTGG - Intergenic
1109668109 13:65565859-65565881 CATTATGGAAACCAGTATGGTGG + Intergenic
1109713652 13:66191533-66191555 CATTATGGAAAACAATATGGAGG + Intergenic
1109742492 13:66573003-66573025 CATTATGGAAAACAGTATTGGGG - Intronic
1109820755 13:67650503-67650525 CATTATGGAAAACAGTATGGAGG - Intergenic
1110393567 13:75003881-75003903 CATTATGGAAAACAATATGGAGG - Intergenic
1110492611 13:76126590-76126612 CACTATAGAAAACTGTATGGAGG + Intergenic
1110557148 13:76872762-76872784 CATTATGGAAAACAGTATGGAGG + Intergenic
1110808535 13:79787187-79787209 CATTATGGAAAACAGTATGGAGG - Intergenic
1111093292 13:83475356-83475378 CATTATGGAAAACAGTATGAAGG + Intergenic
1111120714 13:83845186-83845208 CATTATGGACAACAGTATGGAGG + Intergenic
1111310983 13:86485660-86485682 TATTATGGAAATCAGTATGTAGG + Intergenic
1111519162 13:89377580-89377602 CATTAAGGACAACTGCAGTTAGG + Intergenic
1111602394 13:90491622-90491644 CATTTTGGAAAACAGTAGGGAGG - Intergenic
1111813949 13:93126857-93126879 CATTATGGAAAACAGTATGTAGG + Intergenic
1112127516 13:96484906-96484928 CATTATGAAAAACAGTATGGAGG - Intronic
1112410395 13:99158005-99158027 CATTACGGAAAACAGTATGGAGG - Intergenic
1112553595 13:100445984-100446006 CATTATGGAAAACAGTACGGAGG - Intronic
1112667511 13:101593339-101593361 CACTATGGAAAACTGTATGGAGG + Intronic
1112683386 13:101793648-101793670 CATTATGGAAAATTGTATGGAGG - Intronic
1112690417 13:101887115-101887137 CACTATGGAAAACAGTATGGAGG + Intronic
1112823311 13:103361066-103361088 CATTAAGGAAAACAGTATGGAGG - Intergenic
1112915390 13:104543014-104543036 CATTATGGGAAACAGTATGGAGG + Intergenic
1113235204 13:108264925-108264947 CACTATGGAAAACAGTATGGAGG + Intronic
1113664126 13:112129070-112129092 CATTATGGAAAACAGTACGGAGG + Intergenic
1114029257 14:18561536-18561558 CAAGATGGACAAATGTAGGTTGG - Intergenic
1114142687 14:19933521-19933543 CATCATGGAAACTTGTAGTTAGG + Intergenic
1114326831 14:21597777-21597799 CATTATGGAAAACTGCATGGAGG + Intergenic
1114339226 14:21725426-21725448 CATTATGGAAAACAGTAGGGAGG + Intergenic
1114505690 14:23210813-23210835 CATTAGGGAAAACTGAAACTGGG + Intronic
1114691150 14:24582932-24582954 AATTATGGAAAACAGTATGGAGG - Intergenic
1114698685 14:24653588-24653610 CATTATGGAAAACAGTATGGAGG - Intergenic
1114982588 14:28184394-28184416 CATTACGGAAAACAGTATGGAGG + Intergenic
1114992677 14:28307349-28307371 CAATATGGAAAACAGTATGGAGG - Intergenic
1115008905 14:28520962-28520984 CATTATGGGAAACTATATGGAGG - Intergenic
1115039485 14:28906064-28906086 CATTATGAAAAACAGTATGGAGG - Intergenic
1115195155 14:30790566-30790588 CATTTTGGAAAAGAGAAGGTAGG + Intergenic
1115305977 14:31933938-31933960 CATTGTGGAAAACAGTAGGGAGG - Intergenic
1115401609 14:32967752-32967774 CATTATGGACAACAGCATGTGGG + Intronic
1115669102 14:35588673-35588695 CATTACGGAAAACAGTATGGGGG + Intronic
1115691530 14:35849183-35849205 CATTATGGAAAACAGTACAGAGG - Intronic
1115691789 14:35851723-35851745 CATTTTGGAAAACAGTATGGAGG + Intronic
1115867405 14:37762393-37762415 CATTATGAAAAACAGTATGGTGG - Intronic
1115873326 14:37831488-37831510 TACTATGGAAAACTGTATGAAGG - Intronic
1116082677 14:40195562-40195584 CATTATGGAAAACACTATGGAGG + Intergenic
1116316648 14:43404914-43404936 CATTTTGGAAAACAGTATGGAGG + Intergenic
1116319601 14:43443929-43443951 CATTATGGAAAACAGTATAGAGG - Intergenic
1116333631 14:43628349-43628371 CATTATGGAAAACAATATGGAGG + Intergenic
1116348848 14:43833037-43833059 CATTATGGAAAACAATATGGAGG - Intergenic
1116369034 14:44106660-44106682 CATTATGGAAAACAGTATGGAGG + Intergenic
1116579175 14:46616711-46616733 CATTATGGAAAATAGTATATAGG + Intergenic
1116616071 14:47141216-47141238 CATTATGGAAAACAGTATAGAGG + Intronic
1116633311 14:47360644-47360666 CATTATGGAAAACAGTATGGAGG + Intronic
1116810188 14:49532388-49532410 CATTATGGAGAACAGTATGGGGG + Intergenic
1117033189 14:51697085-51697107 CATTATGGAAAGCAGTATGGGGG + Intronic
1117210126 14:53488643-53488665 CATTATGGAAAACAGTATGGAGG + Intergenic
1117441893 14:55767716-55767738 CATTATGGAAAATTGTATGAAGG + Intergenic
1117608511 14:57457544-57457566 CATTATGGAAAATAGTATGGCGG + Intergenic
1117614740 14:57522089-57522111 CATCATGGAAAACAGTATGGAGG - Intergenic
1117627475 14:57654661-57654683 CATTATGGAAAACAGTATGAAGG - Intronic
1117782354 14:59246620-59246642 CATTATGGAAAACAGTATGGTGG - Intronic
1117789133 14:59320144-59320166 CATTATCAAAAACAGGAGGTGGG - Intronic
1117856044 14:60034916-60034938 CATTATGGTAAACAGTATGGAGG - Intronic
1117914959 14:60668125-60668147 CATTAGGGAAAACAGTATGGAGG + Intergenic
1118116967 14:62789498-62789520 CATTATGGAAAACAATATGGAGG - Intronic
1118127514 14:62924391-62924413 CATTATGGAAAACCGTATGGAGG + Intronic
1118135896 14:63026774-63026796 CATTATAGAAAACAGTATGGAGG + Intronic
1118434661 14:65759002-65759024 AATTATGGAAAACAGTATGGAGG + Intergenic
1118491053 14:66260475-66260497 CATTATGGAAAACAGTGTGGAGG - Intergenic
1118528586 14:66674888-66674910 CATTATGAAAAACAGTATGGAGG - Intronic
1118956367 14:70485970-70485992 CATTATGGAAAACAGTATGGAGG + Intergenic
1119972137 14:78983216-78983238 CATTATGGAAAACAGAATGGAGG + Intronic
1120065683 14:80038506-80038528 CATTATGGAAAATAGTATGGAGG + Intergenic
1120138834 14:80903911-80903933 CATTATGGAAAACTGTATGGAGG + Intronic
1120304760 14:82755109-82755131 CACTATGGAAAACAGTATGAAGG + Intergenic
1120384738 14:83830109-83830131 CATTCTGGAAAAATGTCAGTGGG - Intergenic
1120572497 14:86138857-86138879 CATTATGGAAAACAGTAGGGAGG + Intergenic
1120593105 14:86399547-86399569 CATTATGGAAAACAGTATGAAGG + Intergenic
1120640604 14:87007192-87007214 CATTATGAAAAACAGTATGGAGG - Intergenic
1120798555 14:88663979-88664001 AAGTATTGAAAAGTGTAGGTTGG + Intronic
1120972942 14:90224134-90224156 CATTATGGAAAACTGTATGGCGG + Intergenic
1121099181 14:91238331-91238353 CACTATGGAAAACGGTAGGGTGG - Intronic
1121178595 14:91909945-91909967 CACTATGGAAAACTGTATGGTGG + Intronic
1121784209 14:96642987-96643009 CATTATGGAAAACAGTATTGAGG - Intergenic
1121903747 14:97720597-97720619 CATTATGGAAAACAGTATGGAGG - Intergenic
1121920937 14:97880802-97880824 CATTATGGAGAACAGTATGGAGG + Intergenic
1122149016 14:99714292-99714314 CATTATGGAAAACAGTGTGGAGG + Intronic
1122420077 14:101570479-101570501 CAATATTGAAAACTGTATGGAGG + Intergenic
1123218781 14:106837791-106837813 CATTAGGGAAAACTTTATGGCGG - Intergenic
1202941195 14_KI270725v1_random:148126-148148 CACTATGGAAAACAGTATGGAGG - Intergenic
1123428185 15:20190324-20190346 CATTATGGAAAACAATATGGAGG + Intergenic
1123571849 15:21619891-21619913 CATTATTGAAGACAGTATGTAGG - Intergenic
1123608464 15:22062485-22062507 CATTATTGAAGACAGTATGTAGG - Intergenic
1123917576 15:25048243-25048265 CATTGTGGAAAAATGTATGGAGG - Intergenic
1124000168 15:25752084-25752106 TGTTATGGAAAACTGTATGGAGG + Intronic
1124020183 15:25913934-25913956 CACTATGGAAAACAGTATGGAGG - Intergenic
1124060025 15:26282750-26282772 GATTATGGAAAACAGTATGGAGG - Intergenic
1124085936 15:26550562-26550584 CATTATGGAAAACAGTATGGAGG + Intronic
1124178661 15:27452301-27452323 CATGATGGAAAACAGTATGGTGG + Intronic
1124448287 15:29760036-29760058 CATTCTGGAAAACAGTATGGAGG - Intronic
1124550082 15:30672236-30672258 CATTATGGGAAACTGGAGGAAGG + Intronic
1124554696 15:30713562-30713584 CATTATGGAAAACAGTATGGAGG - Intronic
1124676552 15:31692118-31692140 CATTATGGAAAACAGTATGGAGG + Intronic
1124909190 15:33901584-33901606 CATTATGGAAAACAGTATGGAGG - Intronic
1124969493 15:34472227-34472249 CATTATGGAAAACCATACGGAGG - Intergenic
1125013900 15:34911361-34911383 CATTATGGAAAGCAGTATGGAGG - Intronic
1125190175 15:36982722-36982744 CATTATGGAAAATAGTATGAAGG - Intronic
1125313707 15:38408343-38408365 GAAAATGGAAAACTGAAGGTTGG + Intergenic
1125435875 15:39645206-39645228 CATTGTGGAAAACAGTATGAAGG + Intronic
1125446297 15:39761143-39761165 CATTATGGAAAAGTGTATGGAGG + Intronic
1125644232 15:41257854-41257876 TATTATGAAAAAATGTAGGCTGG - Intronic
1125829130 15:42700349-42700371 CATTATGGCAAACAGTATGAAGG - Intronic
1126128444 15:45317034-45317056 CATTATGAAAAACAGTATGGAGG - Intergenic
1126217069 15:46168094-46168116 CATTATGGAAAATGGTAGGCTGG - Intergenic
1126222283 15:46228152-46228174 CATTATGGAAAACAGTATGGAGG + Intergenic
1126292271 15:47095191-47095213 CATTATGGAAAACAGTATGGAGG + Intergenic
1126374245 15:47979138-47979160 CATTATGGAAAACAGTATGGAGG + Intergenic
1126463952 15:48943670-48943692 CATTATGGAAAACAATATGGAGG - Intronic
1126497684 15:49310455-49310477 CATTATGGAAAACAGTATAGAGG - Intronic
1126629876 15:50723228-50723250 CATTATGGAAACCAGTATGGTGG + Intronic
1126659510 15:51018582-51018604 CATTATGGAAAATAGTATGGAGG - Intergenic
1126745776 15:51825001-51825023 CATTATGGAAGCTTGGAGGTAGG - Intergenic
1126876118 15:53043496-53043518 TATAATGGAAAACTGTATGGAGG + Intergenic
1126944240 15:53801056-53801078 CATTATGGAAAACAGTATGGAGG + Intergenic
1126958257 15:53959360-53959382 CATTGTGGAAAACAGTATGGAGG - Intergenic
1126971435 15:54116842-54116864 CACTATGGAAAACTATACGGAGG - Intronic
1127020819 15:54746325-54746347 CATTATGGAAAACAGTATGCAGG + Intergenic
1127316591 15:57800771-57800793 CATTATGGAAAACAGTATGGAGG - Intergenic
1127730132 15:61792890-61792912 CATTATGGAAAACAATATGAAGG - Intergenic
1127738648 15:61873742-61873764 TATTATGGAAAACAGTATGGAGG + Intronic
1127742495 15:61925506-61925528 ATTTATGGAAAAATGTACGTGGG - Exonic
1127952602 15:63824209-63824231 CATTATGGAAAACAGTATGTAGG + Intronic
1128012863 15:64315046-64315068 TATTATGGAAAACTGTATGGAGG - Intronic
1128057237 15:64709396-64709418 CTTTATGGAAAACAGTATGGCGG - Intergenic
1128252922 15:66176229-66176251 CATTACGGAAAACAGTATGGAGG + Intronic
1128400078 15:67270054-67270076 CACTATGGAAAACAGTATGGAGG - Intronic
1128414712 15:67434669-67434691 CACTGTGGAAAACTGTATGGAGG - Intronic
1128445579 15:67757115-67757137 CATTATGGAAAACAGCATGGAGG - Intronic
1128718228 15:69925966-69925988 CATTATGATTGACTGTAGGTGGG - Intergenic
1128876953 15:71209600-71209622 CATTATGGAAAACGACATGTTGG - Intronic
1129075107 15:72988023-72988045 CATTATGGAAAACAGTATGAAGG + Intergenic
1129495803 15:75978613-75978635 CACTATGGAAAACAGTATGGAGG - Intronic
1129900803 15:79147905-79147927 CATTATGGAAAACAATATGGAGG - Intergenic
1129944975 15:79531325-79531347 CATTATGGAAAGCAGTATGGAGG + Intergenic
1130387169 15:83422083-83422105 CATTATGGAAAACAGTACTGAGG - Intergenic
1131444337 15:92484188-92484210 CATTATGGAAAACGGTATGGAGG + Intronic
1131661127 15:94518288-94518310 CATTATGGAGAACAGTATGGAGG + Intergenic
1131671922 15:94629119-94629141 CTTTATGGAAAACTTGATGTGGG - Intergenic
1131693249 15:94848440-94848462 CACTATGGAATACTAGAGGTGGG - Intergenic
1131711984 15:95065776-95065798 CATTATGGAAAACAGTATCGGGG + Intergenic
1131734848 15:95321026-95321048 CACTATGGAAAACAGTATGAAGG - Intergenic
1131964311 15:97823990-97824012 CATTATGGAAAACAGTTTGGAGG + Intergenic
1132037262 15:98495091-98495113 CATTATGGAGAACAGTATGGGGG - Intronic
1132136668 15:99347848-99347870 CATTATGGAAAACAGTATGGAGG - Intronic
1202980704 15_KI270727v1_random:354281-354303 CATTATTGAAGACAGTATGTAGG - Intergenic
1132524910 16:409536-409558 TAACAGGGAAAACTGTAGGTGGG - Intronic
1133149004 16:3812473-3812495 TATTATGGAAAATTTTAGGCCGG - Intronic
1133445306 16:5854795-5854817 CATTATGGAAAGCAGTATGGAGG - Intergenic
1134362877 16:13548783-13548805 CATTATGGAAAACAGTATTAAGG + Intergenic
1134420252 16:14081072-14081094 CATTATGGAAAACAGTGTGGGGG - Intronic
1134507685 16:14821413-14821435 CATTTTGGAAAACACTCGGTTGG - Intronic
1134695385 16:16220175-16220197 CATTTTGGAAAACACTCGGTTGG - Intronic
1134912639 16:18041830-18041852 CCTTATGGAAAACTGCAAGGTGG - Intergenic
1134976446 16:18574511-18574533 CATTTTGGAAAACATTCGGTTGG + Intergenic
1135090605 16:19512139-19512161 CATTATGGAAAACAGTATGGAGG - Intronic
1135231738 16:20715070-20715092 CAGTATGGAAATCTTTTGGTAGG - Intronic
1135774875 16:25248719-25248741 CATTATGGAAAACAGTACAGAGG + Intronic
1135774990 16:25249769-25249791 CATTATGGAAAACATTAGGGAGG + Intronic
1135796733 16:25451227-25451249 CATTATGGAAAACAATATGGAGG - Intergenic
1136209227 16:28746033-28746055 CACTATGGAAAACTGCATGGAGG - Intergenic
1136856133 16:33659426-33659448 CATTATGGAAAACAATATGGAGG - Intergenic
1137224322 16:46488479-46488501 CATTAAGGAAAACAGTATGGAGG + Intergenic
1137242386 16:46667037-46667059 CATTATGGAAAACAGTATGGAGG - Intronic
1137258178 16:46795690-46795712 CATTATGGAAAATGGTATGGAGG + Intergenic
1137269252 16:46892502-46892524 CATTATGGAAAACAGTATGGAGG - Intronic
1137420084 16:48325824-48325846 CATTATGGAAAACAGTATGGAGG - Intronic
1137459169 16:48643099-48643121 CATTATGGAAAACAGTATGGAGG - Intergenic
1137630791 16:49942768-49942790 CATTGTGGAAAACAGTATGGAGG + Intergenic
1137693185 16:50443741-50443763 CATCATGGAAAACTGCATGGAGG + Intergenic
1137784924 16:51130633-51130655 CAGTTTGGAAAACTCTAGGCCGG + Intergenic
1138058322 16:53859858-53859880 CATTGTGGAAAACTGCATGGAGG + Intronic
1138485077 16:57335867-57335889 CACTATGGAAAACAGTATGGTGG - Intergenic
1138557247 16:57779002-57779024 CACTATGGAAAACAGTATGATGG + Intronic
1138755680 16:59481669-59481691 TATTATGGAAAACAGTAAGGAGG - Intergenic
1139031604 16:62889372-62889394 CATTGTGGAAAACAGTATGGAGG - Intergenic
1139103474 16:63798184-63798206 CACTATAGAAAACTGTATGGAGG + Intergenic
1139173507 16:64659952-64659974 CATTATGGAAAACAGTAGGGAGG - Intergenic
1139321902 16:66121610-66121632 AATGATGGAAAACAGTAGGAAGG - Intergenic
1140679612 16:77372188-77372210 CATTATGGAAAATGGTATGAAGG + Intronic
1140766137 16:78159384-78159406 CATTATGAAAAACAGTATGGAGG - Intronic
1141071624 16:80961460-80961482 CATTTTGGAAAACAGTACGGAGG + Intergenic
1142234178 16:88913856-88913878 CATTTTGGAAAGCTGTTTGTTGG + Intronic
1203117719 16_KI270728v1_random:1507905-1507927 CATTATGGAAAACAATATGGAGG - Intergenic
1143435935 17:6925186-6925208 CAATATGGAAAACAGTATGGAGG - Intronic
1143814619 17:9502124-9502146 CATTATGGAAAACAGTATGGAGG + Intronic
1144029904 17:11310353-11310375 CATAATGGCAAACTGTATGAAGG + Intronic
1144122689 17:12171230-12171252 CATTATGGAAAACAGTATGGAGG - Intergenic
1144477184 17:15598470-15598492 CATTTTGGTAACCTGTGGGTCGG + Intronic
1144508905 17:15858176-15858198 CATTACGGAAAACAGTATGGAGG - Intergenic
1144597097 17:16579417-16579439 CATTATAGAAAACAGTATGGAGG - Intergenic
1145173021 17:20675818-20675840 CATTATGGAAAACAGTATGGAGG - Intergenic
1145190083 17:20832528-20832550 CATTATGGAAAACAGAAGGGAGG + Intergenic
1145220134 17:21081813-21081835 CATTATGGAAAACAGTATGGAGG + Intergenic
1146102099 17:29992859-29992881 CATTGTGGAAAATGGTAGGGAGG - Intronic
1146118819 17:30170847-30170869 CAATATGGAAAACAGTATGGAGG - Intronic
1146274338 17:31506949-31506971 CATTATGGACAACGGTATGGAGG - Intronic
1146433350 17:32820188-32820210 CATTATGGAAAACAGTATGTAGG + Intronic
1146755264 17:35425871-35425893 CATTATGGAAAATAGTATGGAGG - Intronic
1146959572 17:36962110-36962132 CTTTTTGCTAAACTGTAGGTGGG + Intronic
1147507278 17:41031757-41031779 CATTATGGAAAACAATATGAAGG + Intergenic
1147508576 17:41045747-41045769 CATTATGGAAAACAGTATGGAGG + Intergenic
1147512011 17:41078123-41078145 CATTATGGAAAACAGTATGGAGG + Intergenic
1148397569 17:47322326-47322348 CATTATGGAAAACTATATGGAGG + Intronic
1148859778 17:50598522-50598544 CATTATGGAAAACGGTATGCAGG - Intronic
1149283199 17:55131087-55131109 CATTTTGGAAAATAGTACGTAGG - Intronic
1149877136 17:60246612-60246634 CAATATGGAAAACAGTATGGAGG - Intronic
1149967085 17:61175632-61175654 CATTATGGAAAACAGTATTGAGG - Intronic
1150198498 17:63327294-63327316 CATTATGGAAAACAGCATGGAGG + Intronic
1150467860 17:65409995-65410017 CATTATGGAAAACAGTATGGAGG + Intergenic
1150535536 17:66035516-66035538 CATTATGGAGAACAGTATGGAGG + Intronic
1150908096 17:69360104-69360126 CACTATGGAAAACGGTATGGAGG + Intergenic
1151611831 17:75181897-75181919 GATTTTGGACAACTTTAGGTTGG - Intergenic
1152936664 17:83141984-83142006 CATTTTGGAAAACAGTATGGAGG + Intergenic
1153083662 18:1257947-1257969 CACTATGGAAAACAGTATGAAGG + Intergenic
1153132520 18:1872476-1872498 CATTATAGAAAACAGTAGAGAGG + Intergenic
1153295208 18:3539327-3539349 CAAGATTGAAAACTGTGGGTTGG - Intronic
1153571769 18:6480460-6480482 CACTATGGAAAACAGTATGGAGG + Intergenic
1153875616 18:9368033-9368055 CATTATGGAGAACAGTATGGAGG - Intronic
1153920846 18:9788473-9788495 CATTATGGAAGACAGTATGGAGG + Intronic
1154001370 18:10485013-10485035 CACTATGGAAAACAGTAAGGTGG - Intronic
1155089414 18:22491985-22492007 CATTATGGAAAACAATATGGAGG - Intergenic
1155234047 18:23801614-23801636 GATTATGGAAAACAGTATGGAGG - Intronic
1155467668 18:26156221-26156243 CATTATGGAAAATAGTATGGAGG + Intronic
1155535679 18:26814612-26814634 CATTATGGAAAACACTATGGAGG - Intergenic
1156007605 18:32462186-32462208 CATTATGGAAAACAGTATGGAGG - Intronic
1156924775 18:42562910-42562932 CATTTTGGAAAACGGTATGGAGG - Intergenic
1156960412 18:43021877-43021899 CATTATGGAAAACAGTATAGGGG + Intronic
1157232141 18:45927378-45927400 CACTATGGAAAACAGTATGATGG + Intronic
1157538556 18:48481304-48481326 CATTATGGAAAACAGTGTGGAGG + Intergenic
1157656646 18:49396262-49396284 CATTAAGGACAACAGTAGGGAGG + Intronic
1157668429 18:49508060-49508082 CACTATGGAGAACTGTATGGAGG + Intergenic
1157823890 18:50794863-50794885 CATCATGGGAAATTCTAGGTTGG + Intergenic
1158108618 18:53914423-53914445 CATTATGGAAAACAGTATGATGG - Intergenic
1158811528 18:61043153-61043175 CATTATGGAAAACAATATGGAGG - Intergenic
1159058810 18:63493275-63493297 CATTATGGAAAAGAGGAGGGGGG - Intronic
1159300345 18:66556985-66557007 CATTATGGAAAACAATATGGAGG + Intronic
1159302448 18:66592975-66592997 CATTATGTAAAACAGTATGAAGG - Intronic
1159340743 18:67129460-67129482 AATTATGAAAAACAGTAGGGAGG - Intergenic
1159398687 18:67900833-67900855 CATTATGGAAAACAGTATGGAGG + Intergenic
1159483242 18:69018345-69018367 CATTATGGAGAACAGTATGAGGG - Intronic
1159543449 18:69810871-69810893 CATTATGGAAAACAGTATGGAGG + Intronic
1159696419 18:71562567-71562589 CATTATGGAAAAATGTAATGAGG + Intergenic
1159824051 18:73183868-73183890 CACTATGGAAAACAGTATGAAGG + Intronic
1159846442 18:73466571-73466593 CATTATGGAAATCTATATGAAGG + Intergenic
1159849734 18:73513996-73514018 CATTATGGAAAACAGTATAGTGG - Intergenic
1159854978 18:73575400-73575422 CATTATGGACAACAGTATGAGGG - Intergenic
1159867928 18:73728230-73728252 CATAATGAAAAACCATAGGTTGG + Intergenic
1160057854 18:75502294-75502316 CATTATGGAAAACAGTATGGAGG - Intergenic
1160104287 18:75956320-75956342 CATTATGGAAAACAATATGGAGG + Intergenic
1160114900 18:76068879-76068901 CATTTTGGAAAACTGTATGAAGG - Intergenic
1161883446 19:6974209-6974231 CATTATGGAAAACAGTACAGAGG - Intergenic
1162213252 19:9110265-9110287 CATTATGGAAAACAGTATAGAGG + Intergenic
1162225736 19:9220780-9220802 CATTATGGAAAAGAGTATGGAGG - Intergenic
1162227833 19:9239076-9239098 CATTATGGAAAACAGTATGAAGG - Intergenic
1162649132 19:12072462-12072484 CTTTATGGAAAACAGTATGGTGG - Intronic
1164428125 19:28162212-28162234 CATTATGGAAAACAGTGTGGAGG - Intergenic
1164596965 19:29536609-29536631 CATTAGGGAGAACTGTGGGAAGG - Intronic
1165018003 19:32897952-32897974 CATTATGGAAAACAGTGTGGAGG + Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165181013 19:33969346-33969368 CACTATGGAAAACAGTATGGAGG - Intergenic
1165537143 19:36458033-36458055 CATTATGGAAAACAGCATGGAGG + Intronic
1165605392 19:37099251-37099273 CATTATGGAAAATAGTATGGAGG - Intronic
1166023271 19:40053481-40053503 CATTATGGAAAACAGCATGGAGG + Intronic
1166026287 19:40088569-40088591 CATTATGGAAAACAGTATGGAGG + Intronic
1166580379 19:43893441-43893463 CATTATGTAAAACAGTATGAAGG - Intronic
1167955891 19:53063466-53063488 CACTATGGAAAACAGTATGTTGG + Intergenic
1168371854 19:55842004-55842026 CACTATGGAAAACAGTATGGAGG - Intronic
924972125 2:137935-137957 CATTATGCAAAACAGTATGGAGG - Intergenic
925518982 2:4719859-4719881 CACTATGGAAAACAGTATGCAGG + Intergenic
926106150 2:10152868-10152890 CATTATGGAAAGCAGTATGGAGG + Intronic
926244810 2:11114948-11114970 CATTATGGAGAACAGTATGGAGG + Intergenic
926575935 2:14581363-14581385 CATTACGGAAAACTGTGTGAAGG - Intergenic
926714065 2:15910055-15910077 CATTATATAAAACTCTAGGCCGG + Intergenic
927078561 2:19604389-19604411 CGTTATGGAAAACAGTATGAAGG - Intergenic
927389149 2:22573401-22573423 CACTATGGAAAACAGTATGAAGG + Intergenic
927428984 2:23010485-23010507 CATTATGGAAAACAGTACAGAGG - Intergenic
927609277 2:24521799-24521821 CATTATGAAAAATAGTAGGGAGG - Intronic
927610179 2:24531160-24531182 CATTATGTAAAACAGTATGGAGG + Intronic
928067501 2:28181031-28181053 CATTGTGGAAAACAGTATGGAGG + Intronic
928800904 2:35090448-35090470 TATTATGGAAAACAGTATGGAGG + Intergenic
929902495 2:46017620-46017642 CATTATGGAAAACAGTATAGCGG - Intronic
930103959 2:47625618-47625640 CATTATGGAAAACGGTATGGAGG - Intergenic
930589452 2:53309967-53309989 CATTGTGGAAAATTGTATGGAGG + Intergenic
930593037 2:53353072-53353094 CATTATGGAAAACAGTATGGAGG - Intergenic
930666062 2:54099862-54099884 CATTATGGAAAACTGTATGTAGG - Intronic
930674874 2:54189777-54189799 CATTATGTAAAACAGTAGGGAGG - Intronic
930749713 2:54922467-54922489 CATTATGGAAAACGATATGGAGG + Intronic
930847883 2:55924509-55924531 CATGATGGAAAATTGTATGGAGG + Intergenic
930880591 2:56265715-56265737 CATTATGGAAAACAGTGTGGAGG + Intronic
930922953 2:56779453-56779475 TATTATGGAAAACAGTATGAAGG + Intergenic
930986616 2:57596521-57596543 CATTATGTAAAACAGTATGGAGG + Intergenic
931006179 2:57851942-57851964 CATTATGGAAAACAATATGAAGG + Intergenic
931180380 2:59893568-59893590 CACTATGGAAAACAGTATGGTGG - Intergenic
931186398 2:59955912-59955934 CATTATGGAGAACAGTATGGAGG + Intergenic
931452094 2:62376853-62376875 CACTATGGAAAACAGTATGGAGG + Intergenic
931898346 2:66759037-66759059 CACTATGGAGAACAGTAGGGAGG + Intergenic
932525867 2:72467403-72467425 CATTGTGGAAAACAGTATGGAGG - Intronic
932552177 2:72783084-72783106 CACTATGGAAAACAGTATGGAGG - Intronic
932717912 2:74116279-74116301 CACTATGGAAAACAGTAAGGAGG + Intergenic
932744257 2:74318775-74318797 CTTTATGGAAAACAGTATGGAGG + Intronic
932871401 2:75402696-75402718 CATTATGGAAAGCAGTATGGAGG - Intergenic
933391929 2:81681196-81681218 CACTATGGAAAACAGTATGGGGG + Intergenic
933432053 2:82194727-82194749 TATTATGAAAAACAGTAGGAAGG + Intergenic
933512103 2:83253738-83253760 TATTATGGAAGACTGTATGAGGG + Intergenic
933525153 2:83428148-83428170 CAGTATGGAAAACAGTATGGAGG + Intergenic
933562602 2:83907079-83907101 CATTATGGAAAACAGTATGGAGG - Intergenic
933627904 2:84622745-84622767 CATTATGGAAAACAATATGCCGG - Intronic
933737622 2:85507973-85507995 CATTATGGAAAGCAGTATGGTGG + Intergenic
933819973 2:86102205-86102227 CACTATGGAAAACAGTAGGGTGG - Intronic
934155213 2:89192902-89192924 CATTATGGAAAACAGTATGGAGG + Intergenic
934212105 2:89989833-89989855 CATTATGGAAAACAGTATGGAGG - Intergenic
934705815 2:96479371-96479393 CATTGTGGAAAACAGTATGGTGG - Intergenic
934898238 2:98137221-98137243 CACTATGGAAAACAGTATGAAGG - Intronic
935407409 2:102723539-102723561 CACTATGGAAAACACTAGGGGGG + Intronic
935442518 2:103118007-103118029 CACTATGGAAAACAGTATGGAGG + Intergenic
935464161 2:103375694-103375716 CATTATGGAAAACACTATGGAGG - Intergenic
935825962 2:106949908-106949930 CACTATGGAAAACAGTATGGAGG - Intergenic
935845100 2:107157063-107157085 CATTATGGAAAACAGTATGGAGG - Intergenic
935896665 2:107746495-107746517 CATTATGGAAAACAATATGCAGG + Intergenic
935974883 2:108568597-108568619 TATTATGGAAAACAGTAAGGTGG - Intronic
936119901 2:109732289-109732311 TATTGTGGAAAAATGTACGTTGG + Intergenic
936464744 2:112737297-112737319 CGTTATGGAAAACGGTATGGAGG - Exonic
936759276 2:115755668-115755690 TATTATGGAAAACAGTATGGAGG + Intronic
936940656 2:117880866-117880888 CATTATGGAGAACAGTATGGAGG - Intergenic
936969822 2:118166194-118166216 CACTATGGAAAACTGCATGAAGG + Intergenic
936973896 2:118200745-118200767 CATTTTGGAAAACAGTATGGAGG - Intergenic
937045535 2:118849318-118849340 TTTTCTGGAAAACTGGAGGTAGG - Intergenic
937129740 2:119500293-119500315 TATTATGGAAAACAGTATGGAGG + Intronic
937380991 2:121376100-121376122 CATTATGGAAAACAGTATCGTGG + Intronic
937432162 2:121848175-121848197 CATTATGAAAAACAGTATGGAGG - Intergenic
937568541 2:123328281-123328303 CATTATGGAAAACAATAGGGAGG + Intergenic
937618693 2:123959630-123959652 CATTTTGGAAGACAGTAGGAAGG - Intergenic
937704599 2:124905355-124905377 CATTATGGAAAAGAGTAGAGAGG + Intronic
937817344 2:126266250-126266272 CATTATGGAAAACAGTATGGTGG - Intergenic
938177352 2:129145848-129145870 CATTATGAAAAACAGTATGGAGG - Intergenic
938318667 2:130347249-130347271 CTTTATGGAAAACAGTATGGCGG - Intronic
938963970 2:136370368-136370390 CATTATGGAAAATGGTATGGAGG + Intergenic
939080029 2:137648837-137648859 CATTATGGAAAACTGTGTGGAGG - Intronic
939421072 2:141969843-141969865 CATTATGGAAAAATGTATGCAGG - Intronic
939553526 2:143644938-143644960 AAGTATAGAAAACTGTATGTTGG + Intronic
939756095 2:146113875-146113897 CATTATGGAAAATAGTATGAAGG + Intergenic
939836998 2:147142072-147142094 CATTATGGAAAACAATATGCGGG - Intergenic
939910834 2:147980787-147980809 CATTATGGAAAACAGTATGGAGG + Intronic
940208690 2:151233933-151233955 CATTATGGAAAACAGTTTGGCGG + Intergenic
940364431 2:152832009-152832031 CATTATGGAAAACCGTTTGGTGG - Intergenic
940716235 2:157227756-157227778 CATTATGGAAAACTGTATGGAGG - Intergenic
941352315 2:164451864-164451886 CATTAAGGAATAATGAAGGTCGG - Intergenic
941738067 2:169002371-169002393 CATTATGGAAATATGTATGTAGG + Intronic
942053193 2:172159966-172159988 CACTATGGAAAACAGTATGGAGG - Intergenic
942190884 2:173469068-173469090 CATTATGGAAAACAGTATGGAGG - Intergenic
942340650 2:174942079-174942101 CATTATGGAAAATGGTATGGAGG + Intronic
942502893 2:176610500-176610522 CATTATGGAAAACAGTATAGTGG - Intergenic
942529064 2:176888785-176888807 CATTATGAAAAACAGTATGGAGG - Intergenic
942675256 2:178420340-178420362 CATTATCCAAAACAGTATGTAGG - Intergenic
943087332 2:183328549-183328571 CATTATGGAAAACCTTATGGAGG - Intergenic
943125483 2:183790673-183790695 CATTATGGAAAACAGTATGAAGG - Intergenic
943218993 2:185079499-185079521 CATTATGAAAAACAGTATGGAGG + Intergenic
943293652 2:186109148-186109170 CATTATGGAAAATGGTATGGAGG - Intergenic
943361981 2:186930750-186930772 CATTATGGAAAATAGTATGGAGG - Intergenic
943495376 2:188613588-188613610 CACTATGGAAAACTGTATGGAGG - Intergenic
943503624 2:188724447-188724469 CACTATGGAAAACAGTAAGGAGG + Intergenic
943518909 2:188923090-188923112 CATTATGGAAAATGGTATGGAGG - Intergenic
943858121 2:192825054-192825076 CATTATGGAAAATAGTATGGAGG + Intergenic
943877982 2:193098509-193098531 CATTATGGAAAACAATATGGAGG - Intergenic
943922742 2:193730030-193730052 AATTATTGAAAACTGTTTGTTGG - Intergenic
943973207 2:194437978-194438000 CATTATGGAAAACGATATGGAGG - Intergenic
944267607 2:197746218-197746240 CATTTTGGAAAACAGTAGGGTGG + Intronic
944338727 2:198569401-198569423 CATTATGGAAAACAGTATAGAGG + Intronic
944359500 2:198836312-198836334 CATTGTGGAAAACAGTATGGAGG + Intergenic
944470485 2:200047392-200047414 CATTATGGAAAACAATATGGAGG + Intergenic
944604000 2:201333125-201333147 CATTATGGAAAACTGTATAGAGG - Intronic
944888586 2:204092047-204092069 CATTATGGAAAACAATACGCAGG - Intergenic
944919058 2:204391490-204391512 CATTATGGAAAACAGAATGGAGG - Intergenic
945100054 2:206255411-206255433 CATTATGGAAAACAATATGTAGG - Intergenic
945174670 2:207030537-207030559 CATTATGGAAAACAGTATGGAGG + Intergenic
945475678 2:210279328-210279350 CACTATGGAAAACAGTATGAAGG - Intergenic
945783621 2:214206690-214206712 CATTATGGAAGACAGTATGGAGG - Intronic
945789320 2:214285044-214285066 CATTATGGAAAACAGTATGGAGG - Intronic
946093930 2:217255781-217255803 CATTATGGAAAATAGTATGAAGG - Intergenic
946151459 2:217775075-217775097 CATTATGGAAAACAGTTTGAAGG + Intergenic
946636989 2:221740120-221740142 CATTATGGAAAACTATATGTGGG + Intergenic
946700509 2:222408175-222408197 CATTATGGAAAATAGTATGGAGG - Intergenic
946892884 2:224296500-224296522 CACAAAGAAAAACTGTAGGTAGG - Intergenic
946952155 2:224887984-224888006 CATTATGGGAAACAGTATGGAGG + Intronic
947038487 2:225887394-225887416 CACTATAGAAAACTGTATGGAGG + Intergenic
947075281 2:226336620-226336642 CATTATGGAAAACAGTATGGAGG + Intergenic
947249088 2:228080916-228080938 TATTATGGAAAACAGTATGGAGG + Intronic
947333941 2:229060687-229060709 TATTATGGAAAACTGTATAGAGG - Intronic
947429910 2:230018254-230018276 TATTATGGAAAACAGTATGGAGG + Intergenic
947458275 2:230278051-230278073 CATTATGGAAAACAGTATGGAGG - Intronic
947568023 2:231207803-231207825 CATTATAGAAAACTGTATGGAGG - Intronic
947677893 2:232001124-232001146 CATTATGGAAAACAGTTTGGAGG - Intronic
947808724 2:232986282-232986304 TATTATGGAAAACAGTATGGAGG + Intronic
947908174 2:233781306-233781328 CATTATGGAAAACTCTATGGAGG - Intronic
947997477 2:234540598-234540620 CATTATGGAAAACAGTATGGAGG + Intergenic
1168746384 20:246131-246153 CATTAAGGAAAACAGTATGAAGG - Intergenic
1169172777 20:3478885-3478907 GATTATAGAGAACTGAAGGTGGG - Intronic
1169310800 20:4538178-4538200 CATTATGGAAAACAGTATGGAGG + Intergenic
1169313291 20:4566500-4566522 CACTGTGGAAAACAATAGGTAGG + Intergenic
1169515158 20:6309027-6309049 CATTATGGAAAATAGTATGGAGG - Intergenic
1170255368 20:14337115-14337137 CCTTATGGAAAACAGCAAGTTGG - Intronic
1170760723 20:19248569-19248591 CATTATGGAAAACAGTATGAAGG + Intronic
1170887460 20:20353894-20353916 CATTTTGGAAAACAGTATGGAGG + Intronic
1170908555 20:20540178-20540200 CATTATGGAAAACAGTATGGAGG - Intronic
1171237392 20:23538709-23538731 CATTATGAAAAACTGTATGGAGG - Intergenic
1171510506 20:25679725-25679747 CATTATGGAAAATGGTATGGAGG + Intronic
1171537094 20:25903419-25903441 CACTATGGAAAACAGTATGGAGG - Intergenic
1171804015 20:29657747-29657769 CACTATGGAAAACAGTATGGAGG + Intergenic
1171840039 20:30198720-30198742 CACTATGGAAAACAGTATGGAGG - Intergenic
1171933677 20:31253013-31253035 CATTATGGAAAATAGTATGGAGG + Intergenic
1171950101 20:31413882-31413904 CACTATGGAAAACGGTATGGAGG + Intergenic
1171999488 20:31761824-31761846 TATTATGGAAAACAGTATGGAGG - Intronic
1172499552 20:35415753-35415775 CATTATAGAAAACAGTATGGAGG - Intergenic
1172797290 20:37549565-37549587 CACTATGGAAAACAGTATGGAGG - Intergenic
1173010818 20:39180204-39180226 CATTATGGAAAACAGTACAGAGG + Intergenic
1173048326 20:39534289-39534311 CATTATGGAAAACAGTATGGAGG - Intergenic
1173449972 20:43155119-43155141 CATTATGAAAAACAGTATGGAGG + Intronic
1173604183 20:44318553-44318575 CATTATGAAAAACTGTATGGAGG + Intergenic
1173642280 20:44612184-44612206 CACTATGGAAAACAGTATGGAGG - Intronic
1173913822 20:46691304-46691326 CATTATGGACAACAGTATGGAGG - Intergenic
1174331893 20:49826703-49826725 CTTTATGGAATTCTGTAGTTTGG + Intronic
1174715440 20:52752929-52752951 CAATATGGAGAACTGTATCTGGG - Intergenic
1174974154 20:55311933-55311955 CACTATGGAAAACAGTATGAGGG - Intergenic
1174979059 20:55371600-55371622 CATTATGGAAAACAGTACAGAGG - Intergenic
1176581967 21:8538801-8538823 CACTATGGAAAACAGTATGGAGG + Intergenic
1176685209 21:9841621-9841643 TATTATGAAAAACTGTATGGTGG + Intergenic
1177213438 21:18098646-18098668 CATTATGGAAAACAGTTTGGAGG + Intronic
1177258419 21:18695338-18695360 CATTATGGAAAACAGTAGGCAGG + Intergenic
1177460530 21:21402872-21402894 TATTATGAAAAACTGTATGGAGG - Intronic
1177512441 21:22106769-22106791 CATTATGGAAAACAATATGGAGG - Intergenic
1177610712 21:23443930-23443952 CATTATAGAAAACAGTATGGAGG - Intergenic
1177767841 21:25478727-25478749 CATTATGAAAAACAGTATGGAGG - Intergenic
1177916684 21:27097309-27097331 CATTATGGAAAACAGTATGGAGG - Intergenic
1177936655 21:27355975-27355997 TATTATGGAAAACTGTATAGAGG - Intergenic
1178121495 21:29474325-29474347 CTTTAGGGACAACTGTTGGTTGG + Intronic
1178162102 21:29929738-29929760 CATTATGGAAAACAGTATGTAGG + Intronic
1178260177 21:31092261-31092283 CACTATGGAAAACGGTATGGAGG - Intergenic
1178435650 21:32555832-32555854 TATTATGGAAAACTGTTGCGGGG - Intergenic
1178474436 21:32924341-32924363 TATTATGGAAAACAGTATGGAGG - Intergenic
1178723572 21:35031431-35031453 CATTATGGAAAACTGTATGGAGG + Intronic
1179125445 21:38586635-38586657 CATTATGGAAAACAGGATGGAGG + Intronic
1179263733 21:39783283-39783305 CATTATGGAAAACAGTATGAAGG - Intronic
1180264804 22:10515861-10515883 CACTATGGAAAACAGTATGGAGG + Intergenic
1180453373 22:15488599-15488621 CAAGATGGACAAATGTAGGTTGG - Intergenic
1180745005 22:18081784-18081806 CATTATGGAAAACAGAATGCAGG - Intronic
1180753477 22:18142786-18142808 CATTGTGGAAAACAGTATGGAGG + Intronic
1181912415 22:26249747-26249769 CATTATGGAAAACAGTATCAAGG - Intronic
1182378618 22:29867967-29867989 CCTTATGGAAAACAGTACGGAGG + Intergenic
1182681998 22:32086667-32086689 CATTATGGAAAACTGGATGGTGG + Intronic
1182682192 22:32088633-32088655 CATTAAGGAATACAGTAGGCTGG - Intronic
1182798912 22:33014456-33014478 CATTATGGAAAACGGCATGGAGG - Intronic
1182843794 22:33414110-33414132 CACTATGGAAAACAGTATGGCGG - Intronic
1182909935 22:33974401-33974423 AATTATGCAAAACAGTAGGGAGG + Intergenic
1182963472 22:34499052-34499074 CATTGTGGAAAACAGTATGTAGG + Intergenic
1183031720 22:35111353-35111375 CATTATGAAAAACTCGAGGAAGG - Intergenic
1183536964 22:38408185-38408207 CATTATGGAAAACAGTATGGAGG + Intergenic
1183798739 22:40143450-40143472 GAATATGGAAAACTATAGATTGG + Intronic
1184811854 22:46840831-46840853 CTTTATGGAAAACGGTATGGAGG + Intronic
1184883417 22:47326830-47326852 CATTATGGAACACAGTATGGAGG + Intergenic
949144105 3:674260-674282 CATTATGGAAAAGAGTATGGAGG + Intergenic
949199905 3:1363829-1363851 TATTATGGAAAACAGTATGGAGG - Intronic
949250797 3:1981102-1981124 CACTATGGAAAAGTGTATGGAGG + Intergenic
949364227 3:3263222-3263244 CATAATGGAAATCTGCATGTAGG - Intergenic
949628741 3:5898529-5898551 TTTTATGGATAACTGTTGGTCGG + Intergenic
949633338 3:5953921-5953943 AATTATGGAAAACAGTATGGAGG - Intergenic
950737222 3:15019340-15019362 CACTATAGAAAACTGTATGGAGG + Intronic
950826401 3:15827188-15827210 CATTATGGAAAACAGTATGAAGG + Intronic
950850380 3:16056723-16056745 CATGATGCAAAAATGTAGGTAGG - Intergenic
951014893 3:17720508-17720530 CATCATAAAACACTGTAGGTTGG + Intronic
951027918 3:17849047-17849069 GATCAAAGAAAACTGTAGGTGGG + Intronic
951148687 3:19261168-19261190 CATTATGAAAAACAGTATGGGGG - Intronic
951176126 3:19602454-19602476 CATTATGGAAAACAGTATGGAGG + Intergenic
951280960 3:20749073-20749095 CATTATGAAAAACTGTAGAGAGG + Intergenic
951282300 3:20766896-20766918 CATTATGGAATACAGTATGGTGG - Intergenic
951315448 3:21184644-21184666 CATTATGGAAAACAGTATAGAGG + Intergenic
951418916 3:22460554-22460576 CATTATGGAAAACAGTATGGAGG + Intergenic
951480437 3:23155865-23155887 CACTATGGAAAACAGTATGGAGG + Intergenic
951735998 3:25865096-25865118 CATTATGAAAAACAGTATGGAGG + Intronic
951853817 3:27172029-27172051 CATTATGGAAAACAGTATAAAGG + Intronic
951954225 3:28236983-28237005 CATTATGGAAAACAGTCTGGAGG - Intergenic
951977713 3:28531776-28531798 CATTATGGAAAACAGTATGGAGG + Intronic
951988879 3:28653271-28653293 CATTATGGAAAACAGTCTGGAGG - Intergenic
952078941 3:29733435-29733457 CATTATGGAAAACAGTATGAGGG - Intronic
952345261 3:32477804-32477826 CATTATGAAAAACAGTATGGAGG + Intronic
952550860 3:34475529-34475551 CATTATGGAAAGCTCTATGGAGG - Intergenic
952592903 3:34979081-34979103 CATTATGGAGAACAGTATGGAGG + Intergenic
952614712 3:35256551-35256573 CATTCTGGAAAACAGTATGGAGG - Intergenic
953283888 3:41586069-41586091 CATTATGGAAAACAGTATGGAGG + Intronic
953288523 3:41637609-41637631 CATTATGGAAAACAGTATAGAGG - Intronic
953297285 3:41732541-41732563 CATTATGAAAAACAGTATGGGGG + Intronic
953310239 3:41870582-41870604 CATTATGGGAAACTAGAGGAAGG - Intronic
953630783 3:44614810-44614832 CATTATGGAAAACAGTGTGAAGG + Intronic
953731732 3:45455564-45455586 CATTATGGAAAACAGTATGGAGG + Intronic
953817578 3:46172863-46172885 CATTATGGAAAACAGTACAGAGG - Intronic
954521773 3:51234061-51234083 CATTATGGAAAACAGTATAGAGG - Intronic
954851240 3:53602525-53602547 CACTATGGAAAACTGTATGGGGG - Intronic
954944341 3:54406116-54406138 CATTATGAAAAACAGTATGGAGG + Intronic
954949278 3:54455165-54455187 CATTATGGAAAACAGTATGGAGG - Intronic
955207895 3:56913578-56913600 CATTGTGGAAAACAGTATGGCGG + Intronic
955622852 3:60884285-60884307 CATTATGGAAAACGGTATGGAGG + Intronic
955746251 3:62143092-62143114 CAAGATGGAAAAAGGTAGGTGGG - Intronic
955760860 3:62280631-62280653 CATGATGGAAAACTGTCTGGAGG + Intronic
956371396 3:68566294-68566316 CATTATGGAAAACAGTATAGAGG - Intergenic
956390536 3:68768517-68768539 CATTATGGAAACCAGTATGGAGG + Intronic
956496711 3:69834743-69834765 CATTTTGGAAAACAGTAGGAAGG - Intronic
956565824 3:70637617-70637639 CATTATGGAAAACCGTATGGTGG - Intergenic
956912976 3:73839953-73839975 CATTATGGAAAACAGTATGGAGG + Intergenic
957018623 3:75098428-75098450 CACTATGGAAAACAGTATGGAGG - Intergenic
957124558 3:76142237-76142259 CATTATGGAGAACAGTATGGAGG + Intronic
957228261 3:77476721-77476743 CATTAAGGAGAACAGCAGGTTGG - Intronic
957498719 3:81025484-81025506 CATTATGAAAAACAGTATGGAGG + Intergenic
957505841 3:81119402-81119424 CTCTATGGAAAACAGTAGGGAGG + Intergenic
957574936 3:81995369-81995391 CATTATGGAAAACATTATGGAGG - Intergenic
957599322 3:82312650-82312672 CATTTTGGAAAACAGTATGGAGG - Intergenic
957645634 3:82921171-82921193 CACTAAGGAAAACTGTATGGAGG - Intergenic
957718337 3:83962862-83962884 CATTATGGAAAACTGTATAAAGG - Intergenic
957797825 3:85034663-85034685 CATTATGGAGAACAGTATGGAGG - Intronic
957818248 3:85331690-85331712 CATTATGGAGAACAGTATGGAGG - Intronic
958599309 3:96274436-96274458 CATTATAGAAAACTATACGGAGG + Intergenic
958695181 3:97518551-97518573 CACTATGGAAAACAGTATGGAGG - Intronic
958721808 3:97852746-97852768 CATTATGGAAAACAGTATGGAGG - Intronic
958770515 3:98420853-98420875 CATTATAGAAAACAGTACGAGGG + Intergenic
958881139 3:99671740-99671762 CATTATGGGAAACAGTAAGAAGG + Intronic
958960951 3:100509355-100509377 CATTATGGAAAACAATATGGGGG + Intronic
959172741 3:102861982-102862004 CATTATGGAAAACAGTAGAGAGG + Intergenic
959364989 3:105446390-105446412 TATTATGGAAAACAGTATGTAGG + Intronic
959407874 3:105983125-105983147 CATTATGGAAAACAGTATGGAGG - Intergenic
959625882 3:108450127-108450149 CATTATGGAAAACAGTATGAAGG + Intronic
959715244 3:109425645-109425667 CATTATGGAAAACAGTGTGGAGG - Intergenic
959753432 3:109866383-109866405 CAATATGCAGAACTATAGGTTGG - Intergenic
959767970 3:110055986-110056008 CATTATGGGAAACAGTATGTAGG + Intergenic
959797620 3:110450683-110450705 CATTAGGGAAAACTGTACATTGG - Intergenic
959905399 3:111705579-111705601 CATTATGGAAGACAGTATGGGGG - Intronic
960046301 3:113201667-113201689 CATTAAGGAAAACAGTATGGAGG - Intergenic
960410806 3:117321993-117322015 TGTTATGGAAAACAGTATGTAGG + Intergenic
960471117 3:118066213-118066235 CATTATGGAAAACAGTATGGTGG + Intergenic
960517446 3:118617894-118617916 CATTAGGGAAAACTGGATGAAGG - Intergenic
960646884 3:119895491-119895513 CATTATGGAAAACTATATGGAGG - Intronic
960677196 3:120207147-120207169 TATTATGGAAAACGGTATGGAGG - Intronic
960748711 3:120921046-120921068 CACTAAGGAAAACTGTATGGAGG - Intronic
960894433 3:122487331-122487353 CACTATGAAAAACAGTAGGGAGG + Intronic
960930948 3:122849396-122849418 CATTATGGAAAACGGTACAGAGG - Intronic
961151886 3:124645872-124645894 CATTTTGGAAAACAGTAGGGAGG - Intronic
961226190 3:125249589-125249611 CATTATGGAAAACAGTATGGAGG + Intronic
961704909 3:128776765-128776787 CATTATGGAAAACAGTATGGAGG - Intronic
961850792 3:129816153-129816175 CACTATGGAAAACTTTACGGAGG + Intronic
961963324 3:130875691-130875713 CGTTATGGAAAACAGTATGGAGG - Intronic
962057751 3:131890516-131890538 CATTATGGAAAACAGTATGGCGG + Intronic
962244626 3:133782213-133782235 CATTGTGGAAAACAGTATGGAGG + Intergenic
962288920 3:134113893-134113915 CATTATGAAAAACAGTATGGAGG + Intronic
962291382 3:134139645-134139667 CATTATGGAAAACAGTATGGAGG + Intronic
962306975 3:134296885-134296907 CATTATGGAAAACAGTATGGAGG + Intergenic
962823543 3:139076862-139076884 CACTATGGAAAACTGTATGGAGG + Intronic
962860844 3:139399661-139399683 CATTATGAAAAACAGTATGGAGG + Intergenic
963091760 3:141488763-141488785 CATTTGGGAAAACTGTAAATGGG + Intronic
963285220 3:143428506-143428528 CATTATGGAAAATAGTATGAAGG + Intronic
963357493 3:144228072-144228094 CATTATGGAAAACAATATGGAGG + Intergenic
963389791 3:144646394-144646416 CATTATGGGAAACTCTATGGAGG - Intergenic
963438041 3:145297031-145297053 CAGTATGGAAAACAGTATGGAGG + Intergenic
963537699 3:146548463-146548485 CGTTATGGAAAACAGTACGGAGG - Intergenic
963677237 3:148327718-148327740 AATTAAAGAAAACTGTAGATAGG - Intergenic
963688037 3:148462833-148462855 CATTATGGAAAACAGTGTGGAGG + Intergenic
963840513 3:150100359-150100381 CACTATGGAAAACAGTATGGAGG - Intergenic
963844135 3:150137982-150138004 CATTATGGAAAACTTTATGGAGG + Intergenic
963848784 3:150186519-150186541 CATTATTGATAACTGTATGGAGG + Intergenic
963985976 3:151595186-151595208 CATTATGGAAAACAGTATGGAGG + Intergenic
963996788 3:151718727-151718749 CATTATGGAAAACAGTATGGAGG - Intergenic
964100977 3:152988423-152988445 CATTATGGAAAACAGTATAGAGG + Intergenic
964518390 3:157537894-157537916 CATTAGAGAAATCTGGAGGTAGG - Intergenic
964677241 3:159297368-159297390 CATTATAGAAAACAGTATGGAGG - Intronic
964697855 3:159530167-159530189 CACTATGGAAAACAGTATGGAGG - Intronic
964883861 3:161457769-161457791 CATTAGGGAAAACAGTATGAAGG - Intergenic
964997202 3:162896981-162897003 CATTATGGAAAACAGTATTCAGG + Intergenic
965346242 3:167554649-167554671 CCTCATGGAAAACTATAGGAAGG - Intronic
965442689 3:168735227-168735249 CATCATGGAAAACACTAGGGAGG + Intergenic
965495876 3:169398471-169398493 CATTTTAGAAAAATGTAGGAGGG + Intronic
965800571 3:172489369-172489391 CATTATGGAAAACAGTATGGAGG + Intergenic
966434087 3:179863750-179863772 CATTATGGAAAACAGGACGAGGG + Intronic
966964305 3:184974119-184974141 CATTTTGGAAAACAGTATGGGGG - Intronic
966966820 3:185003018-185003040 TATTATGGAAAACAGTATGGAGG - Intronic
967006143 3:185384535-185384557 CATTATGGAAAACAATATGGAGG - Intronic
967448313 3:189594161-189594183 CATTATGGAAAACAGTATAAAGG + Intergenic
967454731 3:189671459-189671481 CATTATGGAAAAGAGTATGGAGG + Intronic
967504882 3:190242796-190242818 CACTATGGAAAACAGTATGGAGG + Intergenic
967760401 3:193217791-193217813 TATTATGGAAAACAGTATGGAGG + Intergenic
968173888 3:196532277-196532299 CATTATGAAAAACAGTATGGAGG + Intergenic
968256697 3:197280557-197280579 CATTATGGAAAACAGTATGCAGG - Intronic
968719564 4:2190943-2190965 CACTATGGAAAACAGTACGTAGG + Intronic
968740489 4:2327978-2328000 CATTATGGAAAACAGTATAGAGG + Intronic
968879151 4:3290222-3290244 CATTATGGAAAAGAGTATGGAGG - Intergenic
968889012 4:3356962-3356984 CACTATGGAAAACAGTACGGTGG - Intronic
969165814 4:5310608-5310630 CATTATGGAAAACAGTATGGAGG + Intronic
969178258 4:5416502-5416524 CTCTCAGGAAAACTGTAGGTGGG - Intronic
969196946 4:5570567-5570589 CACTATGGAAAACAGTATGGAGG + Intronic
969556457 4:7914711-7914733 CACTATGGAAAACAGTATGGAGG - Intronic
969969464 4:11030716-11030738 CATTATGGAACACAGTATGGAGG + Intergenic
969976630 4:11108857-11108879 CATTCTGGAAAACTACAGGATGG + Intergenic
970186993 4:13466614-13466636 CATTATGGGAAACTGTATGGAGG + Intronic
970243527 4:14034216-14034238 AATTATGGAAAACAGTATGGAGG + Intergenic
970764298 4:19529006-19529028 CATTATGAAAAACAGTATGGAGG + Intergenic
970881015 4:20930932-20930954 CATTATGGAAAACAGTGTGGAGG + Intronic
970996642 4:22275135-22275157 CATTTTGGAAAACAGTATGGAGG + Intergenic
971101463 4:23470281-23470303 CATTATGGAAAACAGTATGAAGG - Intergenic
971217794 4:24677292-24677314 CATTATGGAAAACAGTATGGAGG - Intergenic
971254785 4:25004373-25004395 CACTATGGAAAACAGTATGGTGG + Intronic
971821794 4:31566476-31566498 CATTATGGAAAACAGTGTGGTGG + Intergenic
971997034 4:33978089-33978111 CATTATGGAAAACAGTATAAAGG + Intergenic
972091035 4:35283944-35283966 CATTATGGAAAATAGTATGCAGG - Intergenic
972098200 4:35376614-35376636 CATTATGGAAAACAGTATGGTGG + Intergenic
972194283 4:36634247-36634269 AATTATGGAAAACAGTATGAAGG + Intergenic
972218757 4:36928014-36928036 CATTATGGAAAACAGTATGAAGG - Intergenic
972251063 4:37302530-37302552 CATTATGGAAAACGGTGTGGAGG - Intronic
972283514 4:37626151-37626173 CATCATGGAAAACAGTACGCAGG + Intronic
972309959 4:37871443-37871465 CATTATGGAAAACAGTATGAAGG + Intergenic
972523152 4:39881370-39881392 CATTATGGAGAACAGTATGGAGG - Intronic
972523860 4:39888366-39888388 CACTAAGGAAAACTGTATGGAGG + Intronic
972668592 4:41192210-41192232 CATTATGGAAAACAGTATGGAGG + Intronic
972698902 4:41474745-41474767 CATTTTGGAAAACAATAGGGAGG + Intronic
972892892 4:43581609-43581631 CATTATGGAAGACAGTATGGAGG + Intergenic
973217113 4:47681714-47681736 CATTATGGAAAACAATATGGAGG + Intronic
973307641 4:48671018-48671040 CACTATGGAGAACTGTACGGAGG - Intronic
973586158 4:52393828-52393850 CATTATGGAAAATAGTATGGAGG + Intergenic
973724489 4:53761480-53761502 CATTATGGAAAACAGTAGAGAGG + Intronic
973922408 4:55701369-55701391 CATTATGGAAAATAGTATGGAGG + Intergenic
973947468 4:55973409-55973431 CTTTTAGGAAAACTGGAGGTAGG - Intronic
974086960 4:57271863-57271885 CATTATGAAAAACAGTATGAAGG - Intergenic
974405216 4:61459625-61459647 CATTATAGAAAACAGTATGGAGG - Intronic
974420952 4:61672744-61672766 CATTATGGAAAACAGTATGTAGG + Intronic
974528932 4:63081619-63081641 CATTATGGAAAACAGTATGAAGG + Intergenic
974544767 4:63287335-63287357 CATTATGGAAAACAGCATGGAGG - Intergenic
974544821 4:63288267-63288289 CATTATGAAAAACAGTATGGAGG - Intergenic
974766342 4:66351424-66351446 CATTAGGGAAAATTGTAGAGAGG + Intergenic
975123861 4:70759592-70759614 CTTTATGGAAAACTGTACGGAGG - Intronic
975338209 4:73206155-73206177 CATTATGGAAAACAGTACAGAGG + Intronic
975428445 4:74258150-74258172 CATCATGGAAAACAGTATGGAGG + Intronic
975599619 4:76085730-76085752 CATTATGGAAAACAGTATGGAGG + Intronic
975672160 4:76791321-76791343 CATTATGGAAAGCTGTACAGAGG + Intergenic
975761720 4:77626763-77626785 CATTTTGGAAAACAGTATGGAGG - Intergenic
975949596 4:79753064-79753086 CATTATGGAAAGCAGTATGCAGG + Intergenic
975952519 4:79790753-79790775 CATTATGGAAAAGAGTATGGAGG - Intergenic
976013559 4:80522034-80522056 CACTATGGAAAACAGTATGGAGG - Intronic
976024235 4:80667891-80667913 CAGTATGGAAAACTATATGGAGG - Intronic
976076678 4:81306893-81306915 CATTATAGAAAACAATATGTAGG + Intergenic
976207111 4:82633552-82633574 CATTATGGAAAACAGTATGGAGG - Intronic
976240334 4:82949084-82949106 CATTATGGAAAACAGTGTGGAGG - Intronic
976420073 4:84831909-84831931 CATTATGAAAAACAGTATGGAGG + Intronic
976430085 4:84952854-84952876 CATTATGGAAAATAGTATGGAGG + Intronic
976951065 4:90831201-90831223 CATTATGGAGAAAGGAAGGTAGG + Intronic
977024965 4:91806391-91806413 CATTATGGAAAACAGTACGGAGG - Intergenic
977063594 4:92286559-92286581 CGTTATGGAAAACAGTATGGAGG - Intergenic
977240194 4:94559085-94559107 CATGATAGAAAACAGTAAGTTGG - Intronic
977274759 4:94962890-94962912 CATTATGGAGAACAGTATGAAGG - Intronic
977419568 4:96781121-96781143 CATTATGGAAAACATTATGGAGG + Intergenic
977505817 4:97902716-97902738 CATTATGGAAAACAGTATAGAGG + Intronic
977587343 4:98788255-98788277 CATTATAGAAAACAGTATGGGGG + Intergenic
977604887 4:98974192-98974214 CAGTATGGAAAACTGTATAGAGG - Intergenic
977741505 4:100489377-100489399 CATTGTGGAAAACTGTATGGAGG - Intronic
977782943 4:100999768-100999790 CATTATGGATAACATTAGGGAGG - Intergenic
977829571 4:101574767-101574789 CATTATGAAAAACAGTATGGAGG - Intronic
977921166 4:102644207-102644229 CATTATGCAAAACAGTATGGAGG + Intronic
977983385 4:103352991-103353013 CACTATGGAAAACAGTATGGAGG - Intergenic
978085763 4:104650997-104651019 CATAATGGAAAACAGTATGTAGG + Intergenic
978111135 4:104964817-104964839 CATTATGGAAAACAGTATGGAGG - Intergenic
978166036 4:105608136-105608158 CATTATGGAAAATAGTATGGAGG - Intronic
978258821 4:106726203-106726225 CATTATGGAAAGCTATATGGAGG + Intergenic
978410601 4:108420536-108420558 CATTATGGAAAACAGTATGGAGG + Intergenic
978899806 4:113934175-113934197 CACTATGGAAAACAGTATGGAGG + Intronic
979429074 4:120604988-120605010 CATTATGGAAAACAGTATGGAGG + Intergenic
979470312 4:121088379-121088401 CATTATGGAAAACAGTATGGAGG + Intergenic
979875068 4:125879137-125879159 TATTATGAAAAACTATATGTAGG + Intergenic
979943645 4:126796389-126796411 CATTATGGAAAACGATACGGTGG - Intergenic
980244227 4:130217797-130217819 CACTATGGAAAACAGTATGGAGG - Intergenic
980312143 4:131144501-131144523 CATTATGGAAAATTGTATGGAGG + Intergenic
980348667 4:131660088-131660110 TATTATGAAAAACTGTATGGTGG + Intergenic
980351204 4:131686477-131686499 CATTATATTAAACTGTAGATAGG - Intergenic
980412530 4:132441013-132441035 CATTGTGGGAAACTGTTGGAGGG + Intronic
980547509 4:134287215-134287237 CATTATGGAAAACATTATGGAGG + Intergenic
980684739 4:136212308-136212330 CATTGTGGAAAACAGTATGGAGG - Intergenic
980769217 4:137350301-137350323 CATTATGGAAAACACTATGGAGG + Intergenic
980864357 4:138536926-138536948 CATTATGGACAATGGTATGTAGG + Intergenic
980870407 4:138604982-138605004 CATTATGGAAAACAGTATGGAGG - Intergenic
981116433 4:140996047-140996069 CACTATGGAGAACTGTATGGCGG - Intronic
981168018 4:141585160-141585182 CATGATAGAAAACTGTATGGTGG - Intergenic
981215879 4:142166961-142166983 CATTATGGAAGACAGTAGCGTGG + Intronic
981223829 4:142268431-142268453 CATTATGGAAAACAATACGGAGG + Intronic
981229298 4:142334523-142334545 CAATATGGAAAACAGTATGGGGG - Intronic
981441184 4:144784135-144784157 CATTATGGAAAACTGTATGGAGG + Intergenic
981521463 4:145666800-145666822 CATTATGCAAAACAGTATGGAGG - Intergenic
981556114 4:145996620-145996642 CATTATGGAAAACAGTAGAGAGG - Intergenic
981683977 4:147432379-147432401 CATTATGGAAAACAGTATGGAGG - Intergenic
982032034 4:151310469-151310491 CATTATGGAAAACAGTACAGAGG + Intronic
982279669 4:153669918-153669940 CACTATGGAAAACAGTATGGAGG - Intergenic
982346219 4:154363134-154363156 CATTATGGAAAACAGTATGGAGG + Intronic
982442829 4:155456949-155456971 TATTATGGAAAAGGGGAGGTGGG + Intergenic
982705335 4:158702889-158702911 CATTATGGAAAACAGTATAGAGG - Intronic
982751724 4:159169987-159170009 CATTATGGAAAACAGTATGGAGG - Intronic
982797928 4:159667825-159667847 AACTATGGAAAACAGTATGTAGG - Intergenic
982853108 4:160343507-160343529 CATTATGGAAAACAGTGTGGAGG + Intergenic
982916507 4:161216768-161216790 CATTATGGAAAACGGTATGGAGG + Intergenic
983159827 4:164398724-164398746 CATTATGGAAAACTTCATGGAGG - Intergenic
983339531 4:166441025-166441047 CATTATGGAAAAGAGTATGGAGG - Intergenic
983497937 4:168465067-168465089 AATTATGGAAAACAGTATGGAGG - Intronic
983508442 4:168581321-168581343 CATTATGGAAAACAGTATGAAGG - Intronic
983668190 4:170206320-170206342 CATTATGGAAAATGGTATGAGGG + Intergenic
983910475 4:173233305-173233327 CATTATGGAAAACAGTATGGAGG - Intronic
984235911 4:177158621-177158643 CATTATGGAAAACAGTATAGAGG + Intergenic
984425411 4:179578969-179578991 CATTATGGAAAACAGTATAGAGG + Intergenic
984551455 4:181164733-181164755 TATTATGTAAAACTCTAGCTAGG + Intergenic
984649950 4:182260308-182260330 CACTATGGAAAACTATATGGAGG - Intronic
984673725 4:182522867-182522889 CGTTATGGAAAACAGTAGGAAGG - Intronic
984889768 4:184481301-184481323 CATTATGGAAAACAGTATGGAGG - Intergenic
985179648 4:187243928-187243950 CATTATGGAAAAGAGTATGGTGG - Intergenic
985232147 4:187830733-187830755 CATTATAGAAAACAGTATGAAGG - Intergenic
985298679 4:188463424-188463446 CACTATGGAAAACAGTATGGTGG + Intergenic
985374942 4:189325156-189325178 CATTTTGGAAAACACTATGTAGG - Intergenic
985428208 4:189851217-189851239 TTTTATGGAAAACTGTATGGAGG - Intergenic
985474347 5:70330-70352 CATTATGGAAAATAGTATGGAGG + Intergenic
986074694 5:4324083-4324105 CATTATGGAAAACAGTTTGCAGG + Intergenic
986137625 5:4997414-4997436 CATTATGGGAAACTATATGGAGG - Intergenic
986810781 5:11357098-11357120 CATTATGGAAAACAATATGTTGG + Intronic
987240074 5:15987519-15987541 CATTATGGAAAACAGTATGGAGG - Intergenic
987241256 5:16002443-16002465 CACTGTGGAAAACTGTATGGAGG - Intergenic
987256453 5:16158245-16158267 CATTATGGAAAGCAGTATGATGG + Intronic
987264619 5:16239933-16239955 CATTATGGAAAACAGTAAGGAGG + Intergenic
987380949 5:17285503-17285525 CATTATGGAAAATTGCATGGAGG + Intergenic
987659056 5:20848147-20848169 CATTATGGAAAACAGTACAGAGG - Intergenic
987751548 5:22045357-22045379 CATTAGGGAAAACAGTAAGGAGG + Intronic
987891469 5:23883657-23883679 CATTATGAAAAACAGTATGGAGG + Intergenic
988008060 5:25445558-25445580 GATCATGGAAAATTGTATGTGGG + Intergenic
988170881 5:27653555-27653577 CATTATAGAAAACAGTATGCAGG - Intergenic
988193636 5:27971016-27971038 CACTTTGGAAAAGTGTTGGTAGG + Intergenic
988315027 5:29614269-29614291 CATTATAGAAAACAGTATGAAGG - Intergenic
988700053 5:33664718-33664740 CATTATGGAAAACAGCATGGAGG + Intronic
988734826 5:34009970-34009992 CATTATGGAAAACAGTATGGAGG + Intronic
988764622 5:34357831-34357853 CATTATGGAAAACAGTATAGAGG + Intergenic
988947161 5:36216007-36216029 CATTATGGAAAACAGCATGAAGG - Intronic
989018123 5:36965099-36965121 CTTTATGGAACACTGTATGGTGG + Intronic
989210960 5:38858680-38858702 CATTATAGAAAACAGTATGGAGG - Intronic
989277379 5:39605211-39605233 CATAATGGAAAACTGCAGACTGG + Intergenic
989322510 5:40152994-40153016 CATTATGGAAAACAGTACGGAGG + Intergenic
989403015 5:41029043-41029065 CATTATGGAAAACGGGATGGAGG - Intronic
989420046 5:41227025-41227047 CATTATAGAAAACAGTATGGAGG - Intronic
989440537 5:41467125-41467147 CATTATGGAAAATTGTATGGAGG - Intronic
989448315 5:41556847-41556869 CATTATGGAAAACAGTACGCAGG - Intergenic
989773246 5:45170303-45170325 TATTATGGAAAACAGTATGGAGG + Intergenic
990000127 5:50882940-50882962 TATTGTGGCAAACTGGAGGTGGG + Intergenic
990031352 5:51263082-51263104 CATTATAGAAAACAGTATGAAGG - Intergenic
990055883 5:51577488-51577510 CTTTATGGAAAACAGTATGGAGG + Intergenic
990229672 5:53699080-53699102 CATTATGGAAAACAGTATGGAGG + Intergenic
990394611 5:55364054-55364076 CTTTATGGAGGAATGTAGGTGGG + Intronic
990767556 5:59203408-59203430 CACTATGGAAAACAGTATGAAGG + Intronic
991042528 5:62190734-62190756 CATTATGGAAAACAGTATAGAGG - Intergenic
991045711 5:62220657-62220679 CATTATGGAAAACAATATGGAGG + Intergenic
991208156 5:64073896-64073918 CTCTATGGAAAACAGTAGGGGGG - Intergenic
991324170 5:65411358-65411380 CACTATGGAAAACAGTATGAAGG - Intronic
991353101 5:65739583-65739605 CATTATGGAAAACAGTATGGAGG - Intronic
991556977 5:67906453-67906475 CAGTATGGAAAACAATAGGAAGG + Intergenic
992187084 5:74254797-74254819 CATTATGGAAAACAGTATGGAGG + Intergenic
992474690 5:77089718-77089740 CATTATGGAAAACAGTATGGCGG + Intergenic
992681777 5:79160692-79160714 CATTATGGAAAACTGTATGGAGG + Intronic
992932314 5:81661419-81661441 CATTATGGAAAACAGTACGGAGG - Intronic
993048584 5:82897483-82897505 CACTATAGAAAACAGTAGGGAGG + Intergenic
993182790 5:84576205-84576227 CATTATGGAAAACAGTATGGAGG - Intergenic
993212385 5:84969143-84969165 CATTGTGGAAAACAGTATGGAGG + Intergenic
993263334 5:85690478-85690500 CATTGTGGAAAAGTGTAGTAAGG - Intergenic
993446664 5:88020896-88020918 CATTACGGAAAACAGTATGAAGG + Intergenic
993470069 5:88296492-88296514 CATTATGGAAAACAGTATGGAGG + Intergenic
993472802 5:88326676-88326698 TATTATGGAAAACAGTATGGAGG - Intergenic
993770789 5:91923596-91923618 CGTTATGGAAAACAGTATGGAGG + Intergenic
993811271 5:92479772-92479794 AATAATGGAAAACTGTAGACAGG + Intergenic
993811430 5:92482594-92482616 CATTATAGAAAACAGTATGGCGG + Intergenic
994015781 5:94963376-94963398 CATTAAGGAAAACAGTATGGAGG - Intronic
994071635 5:95609606-95609628 CATTATGGAAAACAGTAAAATGG - Intergenic
994113410 5:96034377-96034399 CATTATGGAAAACAGTATGGAGG + Intergenic
994241338 5:97424941-97424963 CATTATGGAAAAGAGTATGGAGG - Intergenic
994313587 5:98305916-98305938 CATTATGGAAAATGGTATGGAGG + Intergenic
994562946 5:101399889-101399911 CACTATGGAAAACAGTACGATGG - Intergenic
994776937 5:104047420-104047442 AATTGTGGAAAAATGTTGGTAGG + Intergenic
994922033 5:106058584-106058606 CATTATAGAAAACAGTATGGAGG + Intergenic
995167076 5:109056142-109056164 CATTATGGCAAACAGTATGAAGG + Intronic
995186293 5:109275082-109275104 CATTATGGAAAACAGTATGGAGG + Intergenic
995213013 5:109562001-109562023 CATTATGGAAAACAGTGTGGAGG - Intergenic
995213323 5:109566002-109566024 CATTATGGAGAACGGTATGGAGG + Intergenic
995537870 5:113155454-113155476 CATTATGGAAAACAGTGTGGAGG - Intronic
995553722 5:113305709-113305731 CATTACGGAAAACTGTACTTTGG - Intronic
995637901 5:114216372-114216394 CACTTTGGGAAAATGTAGGTTGG + Intergenic
995839941 5:116434438-116434460 CATTATGGAAAACCGTATGGAGG - Intergenic
995964423 5:117887088-117887110 CATTATGGAAACCAGTATGGAGG - Intergenic
996102922 5:119463426-119463448 CATTATGGAAAATAGTATGGAGG - Intronic
996139025 5:119881926-119881948 CATTATGGAAAGCTCTATGGAGG + Intergenic
996144793 5:119960964-119960986 CATTATGGAAAACAGTATGGAGG + Intergenic
996852972 5:127973283-127973305 CATTATGGAAAACAGTATGGAGG + Intergenic
997082118 5:130752596-130752618 CATTGTGGAAAACTGTAAGGAGG + Intergenic
997794081 5:136790370-136790392 CATTATGGAAAACAGTATGGAGG + Intergenic
997905627 5:137814173-137814195 CATTATGGAAAACAGTATGGAGG - Intergenic
998181198 5:139944824-139944846 CACTATGGAAAACAGTATGGGGG - Intronic
998426826 5:142035973-142035995 CATTATGGAAAACAGTATAGCGG + Intergenic
998501774 5:142639091-142639113 CATTATGGAAAACAGTATAGAGG + Intronic
998540731 5:142979077-142979099 CATTATGGAAATCTCAATGTGGG + Intronic
998864900 5:146488645-146488667 CACTATGGAAAACAGTATGGAGG + Intronic
999022316 5:148180814-148180836 CATTATGGAAAACAGGATGGAGG - Intergenic
999107058 5:149082590-149082612 CATTATGGAACACAGTATGGAGG + Intergenic
999179098 5:149656296-149656318 CATGATGGAAAACTGTGAGATGG + Intergenic
999334809 5:150706333-150706355 CATTATTCTATACTGTAGGTTGG + Intergenic
999437922 5:151578540-151578562 CATTACGGAAAACAGTATGGTGG + Intergenic
999513232 5:152274761-152274783 CATTTTGGAAAACAGTATGAAGG - Intergenic
999714234 5:154346371-154346393 CATTATGGAAAACAGTATGGAGG - Intronic
999739207 5:154536987-154537009 CATTATGGAAAACAGTATGGAGG - Intergenic
999974746 5:156900177-156900199 CACTATGGAAAACAGTATGGTGG + Intergenic
1000078766 5:157823233-157823255 CATTATTTAAAACTGTTGCTTGG - Intronic
1000108644 5:158085569-158085591 CATTATGGAAAACAGTATGGAGG - Intergenic
1000360771 5:160444964-160444986 CATTATGGGAAAGAGTAGGGAGG + Intergenic
1000371799 5:160543754-160543776 CCTTATGGAAAACAGTATGAAGG + Intergenic
1000517817 5:162261257-162261279 CTTTATGGAAAACAGTATGGAGG + Intergenic
1000645144 5:163752238-163752260 CATTGTGGAAAACAGTATGGTGG - Intergenic
1001359491 5:171066739-171066761 CATTATGGAAAACAATATGGAGG - Intronic
1001993966 5:176140200-176140222 CATTATGGAATACAGTATGGAGG - Intergenic
1002412383 5:179092353-179092375 CATTATGGAAAACGGTATGGAGG - Intergenic
1003281391 6:4695398-4695420 CATTATGGAAAACAGTATGGAGG + Intergenic
1003305514 6:4923632-4923654 CATTATGGAAAAGAGTATGCAGG - Intronic
1003346488 6:5273238-5273260 CAATATGGAAAACTGTGTGGAGG - Intronic
1003686286 6:8306163-8306185 AATTATGGAAAACAGTATGGAGG - Intergenic
1003927531 6:10890269-10890291 CAATATGGAAAACAGTATGGAGG - Intronic
1004116019 6:12768747-12768769 CATTATGGAAAACAGTATGGAGG - Intronic
1004204250 6:13576223-13576245 CATTTTGGAAAACAGTATGGAGG - Intronic
1004713716 6:18196395-18196417 CATTATGGAAGACAGTACGGAGG - Intronic
1004797836 6:19108623-19108645 CATTATAGAAAATGGTATGTAGG - Intergenic
1004875666 6:19950699-19950721 CACTATGGAAAACAGTATGGAGG - Intergenic
1004954629 6:20715625-20715647 CACTATGGAAAACAGTACGGAGG - Intronic
1005050578 6:21680128-21680150 GATTATGAAAAACTGTTGCTGGG - Intergenic
1005261135 6:24062006-24062028 CATTATGGAAAACAGTATGGAGG - Intergenic
1005596797 6:27387275-27387297 CATTATGGAAAACAGTTTGATGG + Intronic
1005938056 6:30539313-30539335 TATTATGGAAAACTGTATGGCGG + Intergenic
1006174233 6:32112312-32112334 CATTATTGAGAACTGGGGGTCGG + Intronic
1006207455 6:32360618-32360640 CATTATGGAAAACAGTATTGTGG - Intronic
1006234846 6:32620408-32620430 CATTATGGAAAACTGTATGGAGG + Intergenic
1006256103 6:32833710-32833732 CGCTATGGAAAACTGTATGGTGG + Intronic
1006278358 6:33024753-33024775 CATTATGGAAAACAGTATGGAGG - Intergenic
1006424112 6:33953316-33953338 CATTATGGAAAGCAGTATGGAGG + Intergenic
1006555810 6:34865599-34865621 CATTATGGAAAACAGTATGAAGG - Intronic
1006614179 6:35314012-35314034 TACTATGGAAAACTGTATGAAGG - Intronic
1007136639 6:39528542-39528564 CATTGTGGAAAACTATATGGAGG - Intronic
1007211965 6:40199992-40200014 CATTATGGAAAACAGCATGGAGG - Intergenic
1007362090 6:41366123-41366145 CGTTATGGAAAACAGTATGGAGG - Intergenic
1007371740 6:41430689-41430711 CAGTAAGGAAGACTGAAGGTAGG - Intergenic
1007805465 6:44441529-44441551 CATTATGGAAAACAGTATGGAGG - Intronic
1007806559 6:44454304-44454326 CATTATGGAAAACAGTACAGAGG + Intergenic
1008094566 6:47326496-47326518 CATTATGGAAAACAGCATGGAGG + Intergenic
1008099257 6:47373494-47373516 CATTATGGAAAACAGTATAGAGG + Intergenic
1008119568 6:47596829-47596851 CATTATGGAAAACAGTACAAAGG - Intronic
1008202560 6:48609483-48609505 CATTACGGAAAACAGTACGAGGG + Intergenic
1008733228 6:54508747-54508769 CATTATGGAAAACAGTATGAAGG + Intergenic
1008745235 6:54661780-54661802 CATTATAGGAAACTGTATGAAGG - Intergenic
1008774651 6:55022982-55023004 CATTATGGAAAACAGTATGGAGG + Intergenic
1008905796 6:56676442-56676464 CATTATGGAAAACAGTATAGAGG + Intronic
1009315054 6:62208650-62208672 CATTATGGAAAACAGTATGGAGG - Intronic
1009661853 6:66622780-66622802 CACTATGGAAAACAGTACGGAGG - Intergenic
1009670677 6:66745323-66745345 CATTATGGAAAACAGCATGGGGG - Intergenic
1009704560 6:67230087-67230109 CACTATGGAAAACAGTATGGAGG + Intergenic
1009781067 6:68271545-68271567 CATTATGGAAAACAGTATGGAGG + Intergenic
1009907364 6:69886401-69886423 CATTATGGAAAACAGTATGGCGG + Intronic
1010056500 6:71571385-71571407 CACTATGGAAAACAGTATGGAGG - Intergenic
1010180550 6:73081981-73082003 CATTCTGAAAATCTGTGGGTTGG - Intronic
1010277111 6:73981563-73981585 CATTATAGAAAACAGTATGGAGG - Intergenic
1010443344 6:75924163-75924185 CATTATGGAAAACCATCTGTAGG + Intronic
1010466564 6:76173923-76173945 GATTGTGGAAAACAGTAGGAAGG + Intergenic
1010557139 6:77296438-77296460 CATTATGGAAAACTGTGTGGAGG - Intergenic
1010605404 6:77883941-77883963 CATTATGGAAAACAGTATGGAGG - Intronic
1010689069 6:78887775-78887797 CATTATGGAAAACAGTATACAGG + Intronic
1011045877 6:83082091-83082113 CATTATGGAAAACAGTAAGGAGG + Intronic
1011061952 6:83279997-83280019 CATGATGCAGAATTGTAGGTTGG - Intronic
1011160434 6:84383267-84383289 CATTATGGAAAACGGTAGGGAGG - Intergenic
1011446685 6:87449075-87449097 CATTATGGAAAATAGTATGAAGG - Intronic
1011501004 6:87989787-87989809 TATTATGGAAAACAGTATGGAGG + Intergenic
1011523284 6:88234701-88234723 CATTATGGAAAACAGTATGGAGG + Intergenic
1011574137 6:88776106-88776128 CATTATGGAAAACAGTATGGAGG - Intronic
1011617984 6:89215113-89215135 CATTATGGAAAACTAGATGGAGG + Intronic
1012003471 6:93683927-93683949 CATTATGCAAAACAGTATGGAGG - Intergenic
1012148519 6:95717165-95717187 CATTATGGAAAACAATATGGAGG - Intergenic
1012150941 6:95751443-95751465 CATTATGGAAAACAATATGGAGG + Intergenic
1012214597 6:96566571-96566593 CATTATGGAAAACAGTTTGAAGG - Intronic
1012248749 6:96956463-96956485 CATTTTACAAAACTGTAGCTTGG + Intronic
1012256055 6:97033596-97033618 CATTATGGGAAACAGTAGAGAGG - Intronic
1012330722 6:97982572-97982594 CATTATGGAAAACTGTGTGGAGG - Intergenic
1012368704 6:98476306-98476328 CATTATGGAAAACATTATGGAGG + Intergenic
1012478728 6:99643765-99643787 CATTATGGAAAACAGTACAGAGG + Intergenic
1012483807 6:99698071-99698093 CACTATGGAAAACAGTATGGTGG - Intergenic
1012486533 6:99727967-99727989 CATTATGGAAAACATTATGGAGG - Intergenic
1012578780 6:100837307-100837329 CATTATGAAAAACAGTATGAAGG + Intronic
1012601340 6:101101218-101101240 CATTATGGAAAACAGTGGGGAGG - Intergenic
1012642857 6:101642806-101642828 CATTATGGAAAACAGTATGATGG - Intronic
1012801506 6:103834970-103834992 CATTATGGAAAACAGTATGGAGG - Intergenic
1012913366 6:105141733-105141755 CATTACGGAAAACAGTATGGAGG - Intergenic
1013050719 6:106532476-106532498 CATTATGGAAAACAGTATAGAGG - Intronic
1013392009 6:109695007-109695029 CATTATAGAAAACAGTATGGAGG + Intronic
1013568429 6:111394209-111394231 CATTATGCAAAACAGTATGGAGG - Intronic
1013702310 6:112787795-112787817 CATTATGGAAAATAGTATGGAGG - Intergenic
1013978519 6:116103014-116103036 TTTTGTGGAAAACTGAAGGTGGG - Intronic
1014004268 6:116398970-116398992 CATTATGGAAAACAGAATTTTGG - Intronic
1014257866 6:119181949-119181971 CATTATGGAAAACAGTATGGAGG - Intronic
1014399514 6:120970278-120970300 CATTATGGAAAGCAGTATGGAGG + Intergenic
1014431725 6:121378993-121379015 CATTATGGAAAACGGTATGGAGG - Intergenic
1014838715 6:126191006-126191028 CATCATGGAAAACAGTATGGAGG - Intergenic
1014887535 6:126799799-126799821 CATTATGGAAAACAATATGAAGG + Intergenic
1014965407 6:127741976-127741998 CATTGTGGAAAACAGTATGAAGG + Intronic
1015151065 6:130038338-130038360 CATTATAGAAAACAGTATGGAGG - Intronic
1015337391 6:132055794-132055816 CACTATGGAAAACAGTATGGAGG + Intergenic
1015598037 6:134884708-134884730 CATTATGGGAAACAGTATGGAGG + Intergenic
1015676201 6:135752391-135752413 CATTATGGGAAACGGTATGGAGG + Intergenic
1015687930 6:135886936-135886958 CACTATGGAAAACAATAGGGAGG - Intronic
1015772626 6:136784544-136784566 CATAAGGGAAAACTCTAGTTAGG - Intronic
1016444171 6:144116206-144116228 CATTATGAAAAACAGTAGAGAGG - Intergenic
1016524109 6:144980664-144980686 CATTATACAAAACTGTATGGAGG + Intergenic
1016604291 6:145901652-145901674 CATTAGGGAAGACTGTACATGGG + Intronic
1016657884 6:146543125-146543147 CATTATGGAAAACCCTACGGAGG + Intergenic
1017284204 6:152655590-152655612 CATTATGGAAAAAAGTATGGAGG + Intergenic
1017436394 6:154419570-154419592 CATTATGGAAAACACTACGGAGG + Intronic
1017568834 6:155719584-155719606 TATTATGGAAAACAGTATGGAGG + Intergenic
1018034484 6:159870029-159870051 CATTATGGAAAACAGTATTGAGG - Intergenic
1018070956 6:160164049-160164071 CATGGAGGAAAACTGAAGGTCGG + Intergenic
1018150675 6:160934605-160934627 CATTATGGAAAACAGAATGGAGG - Intergenic
1018210129 6:161473065-161473087 CTTTATGGAAAACAGTACGAAGG + Intronic
1018263598 6:161995823-161995845 CATTCTGGAAAACAGTATGCAGG + Intronic
1018377331 6:163225630-163225652 CATTATGGAAAACAGTATGGAGG + Intronic
1018443650 6:163835181-163835203 CATTATGGAAAACAGTGTGGAGG + Intergenic
1018550677 6:164994743-164994765 CATTATAGAAAACAGTATGGAGG - Intergenic
1018555070 6:165040639-165040661 CATTATGGAAAATAGTATGGAGG - Intergenic
1018600695 6:165536867-165536889 CATTATGGAAAACAGTATGGAGG + Intronic
1019090331 6:169525664-169525686 CACTAAGGAAAACTGTATGGAGG + Intronic
1019208166 6:170380421-170380443 CATTATAGAAAACAGTATGGAGG - Intronic
1019844608 7:3485072-3485094 TATTATGGAAAACAGTATGGAGG - Intronic
1020394173 7:7694956-7694978 CACTATGGAGAACAGTAGGGAGG - Intronic
1020527959 7:9288065-9288087 CATTATGGAAAACAGTATGGAGG - Intergenic
1020580865 7:9999409-9999431 CATTATGGAAACCAGTATGGGGG + Intergenic
1020612349 7:10415043-10415065 CATTATAGAAAACAGTATGGAGG + Intergenic
1020627948 7:10606189-10606211 CATTATGGAAAACAGTATGGAGG - Intergenic
1020702763 7:11503881-11503903 CATTGTGGAAAACAGTATGGTGG + Intronic
1020744332 7:12062834-12062856 CATGATGGAAAACAGTATGTGGG + Intergenic
1020916048 7:14194119-14194141 CATTATGGAAAACAGTATGGAGG + Intronic
1020975857 7:15005705-15005727 CATCATAGAAAAATGTAGCTTGG - Intergenic
1021052669 7:16008068-16008090 CATTAGGGATTAATGTAGGTTGG + Intergenic
1021061961 7:16124132-16124154 CATTATGGAAAACAGTATGGAGG - Intronic
1021198892 7:17704630-17704652 CACTATGGAAAACAGTATGGAGG + Intergenic
1021340979 7:19462267-19462289 CACTATGGAAAACAGTATTTTGG - Intergenic
1021369648 7:19827301-19827323 CATTATGGAAAACAGTATAGAGG + Intergenic
1021383609 7:20000663-20000685 CATTATGGAAATCAGTATGGAGG + Intergenic
1021538384 7:21730051-21730073 CATTATGGAAAACAGTATGGAGG + Intronic
1021630260 7:22638023-22638045 CATTATGGAAAACTGTATGGAGG - Intergenic
1021693743 7:23255621-23255643 CACTATGGAAAACAGTATGGAGG - Intronic
1021768505 7:23973497-23973519 CATTATGGAAAACAGTATGAAGG - Intergenic
1021866061 7:24959147-24959169 CATTTTGGAAAACTGTTTGGGGG + Intronic
1021956316 7:25828409-25828431 CACTATGGAGAACTGTATGGAGG + Intergenic
1022209140 7:28191484-28191506 CATTATGGAAAACAGTGTGGAGG - Intergenic
1022625241 7:32029265-32029287 CATTATGGAAAACTATACAGAGG + Intronic
1022743242 7:33143291-33143313 TACTATGGAAAACAGTGGGTAGG - Intronic
1022780070 7:33572511-33572533 CACTATGGAAAACGGTATGGAGG - Intronic
1023448742 7:40258754-40258776 CATTATGGAAAGCAGTATGGAGG + Intronic
1023450895 7:40283743-40283765 CGTTATGGAAAACAGTATGGGGG + Intronic
1024127325 7:46313061-46313083 CATTATGTAAAACAGTATGGAGG - Intergenic
1024155286 7:46615931-46615953 CATTATGGAAAAAAGTATGGAGG - Intergenic
1024424944 7:49214687-49214709 CATTATGGAAAAAAGTATGGAGG - Intergenic
1024464542 7:49698324-49698346 CAATATGGAAAACTGTATGGAGG + Intergenic
1024502577 7:50127885-50127907 CACTATGGAAAACAGTATGGAGG + Intronic
1024625532 7:51206110-51206132 CATTATGGAAAACAGTCTGGTGG + Intronic
1024949801 7:54848491-54848513 CATTAGGGAAAACTATATGAAGG - Intergenic
1025018111 7:55457530-55457552 CATTATGGAAAACAGTATAGAGG - Intronic
1025116224 7:56260753-56260775 CATTATGGAAAACAGTGTGGTGG + Intergenic
1025194516 7:56922519-56922541 CATTATGGGAAACAGTACGGAGG - Intergenic
1025288561 7:57690152-57690174 CACTATGGAAAACAGTATGGAGG - Intergenic
1025677436 7:63654430-63654452 CATTATGGGAAACAGTACGGAGG + Intergenic
1026260551 7:68751581-68751603 CATTATGGAAAACAGTATGGAGG - Intergenic
1026460455 7:70610322-70610344 CATTATGGAAAACAACAGGGAGG - Intronic
1026531580 7:71203217-71203239 CACTATGGAAAACAGTATGGAGG - Intronic
1026686716 7:72516513-72516535 CATTATGGAAAACAGTATAGGGG - Intergenic
1027442949 7:78239828-78239850 CATTATGGAAAACAGCATGGAGG + Intronic
1027488826 7:78796557-78796579 CATTATCGAAAACGGTATGGAGG + Intronic
1027807201 7:82842974-82842996 CATAATGGAAAACAGTATGGAGG + Intronic
1027920871 7:84392630-84392652 CATTATGGAAAATTGTATGAAGG - Intronic
1027998405 7:85457844-85457866 CATTATTCAAATCTATAGGTGGG + Intergenic
1028004525 7:85547044-85547066 CAATTTGGAATAGTGTAGGTTGG - Intergenic
1028161455 7:87490703-87490725 CACTATGGAAAACAGTATGGAGG + Intergenic
1028177749 7:87677048-87677070 CATTATGGAAAACAGTATGGAGG + Intronic
1028187169 7:87800562-87800584 CATTATGGAAAACTGCATGGTGG - Intronic
1028225396 7:88245962-88245984 CATTACGGAAAACAGTATGGAGG - Intergenic
1028272694 7:88812435-88812457 CACCATGGAAAACTGTATGGAGG + Intronic
1028288395 7:89033530-89033552 AATTATGGAAAACTGTGTGTAGG - Intronic
1028288698 7:89038235-89038257 CATTATGGAAAAGAGTATGGAGG - Intronic
1028524308 7:91766498-91766520 AATTATGGAAAACAGTACGGAGG + Intronic
1028543017 7:91965602-91965624 CACTATGGAAAACTGTATGGAGG - Intronic
1028564294 7:92211102-92211124 CATTATGGAAAACAGTATAGAGG + Intronic
1029672538 7:102043769-102043791 CATTATGGGAAACAGTACGGAGG - Intronic
1029793423 7:102869049-102869071 CATTATGGAAAACATTAGCGAGG - Intronic
1030054617 7:105572591-105572613 CATTATGGAAAACAATATGGTGG - Intronic
1030241233 7:107327870-107327892 CACTATGGAAAACATTAGGGAGG + Intronic
1030364825 7:108633586-108633608 CATTACGGAAAACAGTATGCAGG - Intergenic
1030391710 7:108936507-108936529 CATTATGGAAAAGAGTATGGAGG + Intergenic
1030450603 7:109705513-109705535 CATTATGGAAAACAGTGTGGAGG - Intergenic
1030478380 7:110068781-110068803 CATTATGGAAAACAGTGTGGAGG - Intergenic
1030480585 7:110098787-110098809 CACTATGGAAAACAGTATTTTGG + Intergenic
1030660948 7:112219036-112219058 CATTATGGAAAACAGCATGGAGG - Intronic
1030697167 7:112598390-112598412 CATTATGGAAAACAATATGGAGG - Intergenic
1030731435 7:112994174-112994196 CAATATGGAAAACAGTATGGTGG + Intergenic
1030790786 7:113725530-113725552 CATTGTGGAAAACAGTATGGAGG + Intergenic
1030821636 7:114099443-114099465 CATTATGGAAAACAGTATGGAGG + Intronic
1030880835 7:114876932-114876954 CACTATGGAAAACAGTTTGTAGG - Intergenic
1031251911 7:119394551-119394573 CATTTTGGAAAACAATAAGTAGG + Intergenic
1031270064 7:119637036-119637058 CATTATGAAAAACAGTATGGAGG - Intergenic
1031271736 7:119658234-119658256 CATTATGGAAAACTATAAGGAGG - Intergenic
1031433603 7:121705043-121705065 CATTATGGAGAACAGTATGAAGG + Intergenic
1031525156 7:122816602-122816624 TATTATGGAAAACAGTATGGAGG - Intronic
1031549998 7:123098167-123098189 CATTACGGAAAACAGTATGGAGG + Intergenic
1031590528 7:123586147-123586169 CATTATGGAAAACAGTTTGGTGG - Intronic
1031623294 7:123962100-123962122 CATTATGAAAAACAGTATGGAGG - Intronic
1031779524 7:125943572-125943594 CATTATGGAATACAGTTTGTAGG + Intergenic
1031838531 7:126708299-126708321 CATTACAGAAAACAGTAGGGAGG + Intronic
1031909249 7:127497192-127497214 CATTATGAAAAACGGTATGAAGG + Intergenic
1032416630 7:131740457-131740479 CATTATGGAAAACAGTATGGAGG - Intergenic
1032585029 7:133138504-133138526 CATCATGAAAAACTGTAGGAAGG - Intergenic
1032822948 7:135541407-135541429 CACTATGGAAAACTGTATAAAGG + Intergenic
1033091758 7:138392609-138392631 CATTATGGAAATCAGTATGGAGG + Intergenic
1033266011 7:139887841-139887863 CACTATGGAAAACAGTATGACGG - Intronic
1033412994 7:141137133-141137155 CATTATGGAAAACAGTATGGAGG + Intronic
1033638166 7:143232556-143232578 CATTATGGAAAACAGTATGGAGG - Intergenic
1033832162 7:145267791-145267813 CATTATAGAAAACAGTATGAAGG - Intergenic
1033869881 7:145739190-145739212 CACTATGGAAAACAGTATGGAGG - Intergenic
1034145895 7:148871265-148871287 CATTATGGAAAACAGTACTGAGG + Intronic
1034287235 7:149894808-149894830 CATTATGGAAAACAGTATAGAGG + Intergenic
1034397045 7:150834877-150834899 CATTATGGAAAACAGTATAGAGG + Intronic
1034647252 7:152659040-152659062 CATTATGGAAAACAGTATGGAGG - Intronic
1034663889 7:152798105-152798127 CATTATGGAAAACAGTATAGAGG - Intronic
1035086218 7:156260680-156260702 CATTATGAAAAACAGTACGGCGG + Intergenic
1035091031 7:156310579-156310601 CGTTATGGAAAACAGTATGGAGG - Intergenic
1035128014 7:156624314-156624336 CATTATGGAAAATAGTATGGAGG + Intergenic
1035365457 7:158346680-158346702 CATTATGGAGAACTGTATGGAGG - Intronic
1035479155 7:159168262-159168284 CATTGTGGAAAACAGTATGGAGG + Intergenic
1036038063 8:5041937-5041959 CATTTTGAAAAAATTTAGGTTGG - Intergenic
1036040722 8:5077299-5077321 CACTATGGAAAACTGTATGGAGG - Intergenic
1036481428 8:9143077-9143099 CATTATGGAAAATAGTAGGGAGG - Intronic
1036582477 8:10088254-10088276 CATTATGGAAAACAGCATGAAGG + Intronic
1036582859 8:10091935-10091957 CATTATGGAAAACAGTATGGAGG - Intronic
1036597003 8:10222426-10222448 CATTATGGAAAACAGTGTGGAGG + Intronic
1036913425 8:12780218-12780240 CATTATGGAAAACAGTATGGAGG - Intergenic
1036941115 8:13053470-13053492 CATTGTGGAAAACAGTATGGTGG - Intergenic
1037100539 8:15039050-15039072 CACTATGGAAAACAGTATGGAGG + Intronic
1037383005 8:18308311-18308333 CACTACGGAAAACAGTAGGATGG + Intergenic
1037523722 8:19704496-19704518 CATTATGGAAAACAGTATTGAGG + Intronic
1037962929 8:23112887-23112909 CATTATGGAAAACAGTATGGAGG - Intronic
1037968543 8:23153792-23153814 CATTATGGAAAACAGTATGGAGG + Intronic
1038449550 8:27631125-27631147 CATTGTGGAAAACAGTATGGAGG - Intergenic
1038897207 8:31797532-31797554 CATTATGGAAAATAGTAGAGAGG + Intronic
1039019805 8:33192459-33192481 CATTGTGAAATACTGTAGGTAGG - Intergenic
1039209186 8:35192576-35192598 CATTATGGAAAACATTATGTAGG - Intergenic
1039267024 8:35836875-35836897 AATTATGGAAAACAGTATGGAGG + Intergenic
1039378819 8:37065439-37065461 CATTATGGAAAATGGTATGAAGG + Intergenic
1039391969 8:37188654-37188676 CATTTTGGAAAACTGTTGAGTGG - Intergenic
1039680145 8:39725921-39725943 CATTATGGAAAACAGTATGACGG - Intronic
1039681439 8:39741598-39741620 CATTATAGAAAACAGTATGGAGG - Intergenic
1039755814 8:40520891-40520913 CATTATGGTAAACAGTATGTAGG - Intergenic
1039964793 8:42276162-42276184 CATTATGGAAAATAGTATGGAGG - Intronic
1040061378 8:43106063-43106085 CATTATGGAAAACAGTATGGAGG - Intronic
1040457498 8:47613567-47613589 CACTGTGGAAAACAGTAGGGTGG - Intronic
1040642931 8:49361470-49361492 CATTATGGAAAACAGTATGGAGG - Intergenic
1040643052 8:49363071-49363093 CATTATGGAAAACAGTATGGAGG - Intergenic
1040740429 8:50568412-50568434 CACTGTGAAAAACTGTAGGGAGG - Intronic
1040742611 8:50597624-50597646 CATTATGGAAAACAGTATGGTGG - Intronic
1040898944 8:52397052-52397074 CATTATGAAAAACAGTATGGAGG - Intronic
1040988260 8:53319899-53319921 CACTATGGAAAACAGTATGAAGG + Intergenic
1041078894 8:54195759-54195781 CACTATGGAAAACAGTATGGAGG - Intergenic
1041154431 8:54970606-54970628 CATTTTGGAAAACAGTATGTAGG + Intergenic
1041332665 8:56744361-56744383 CAGTATGGAAAACAGTATGGAGG + Intergenic
1041759396 8:61347844-61347866 CATTATGGAAAACAGTAGGTAGG - Intronic
1041787986 8:61657127-61657149 CATTAGGGAAAAGTGGGGGTGGG + Intronic
1041817360 8:61989407-61989429 CATTATGGAAAACAGTATGGAGG + Intergenic
1042006893 8:64191001-64191023 CATTATAGAAAACAGTATGGAGG + Intergenic
1042352378 8:67790341-67790363 CATTATGGAAAACAGTATAGAGG + Intergenic
1042471828 8:69198785-69198807 TATTATGGAAAACAGTATGGAGG + Intergenic
1042530936 8:69814576-69814598 CATTATGGAAAGCTGTATGGAGG + Intronic
1042690910 8:71497639-71497661 CATTATGGAAAACACTAAGGAGG + Intronic
1042740731 8:72042485-72042507 CATTATGGAAAACAGTATTGGGG + Intronic
1042981205 8:74530972-74530994 CATTATGGAAAAAGGTATGGAGG + Intergenic
1043032793 8:75158893-75158915 CACTATGGAAAACTGTATGGAGG - Intergenic
1043133564 8:76492304-76492326 CATTATGGAGAACAGTATGAAGG - Intergenic
1043321022 8:78987041-78987063 CATTATGAAAAACAGTATGGAGG + Intergenic
1043371397 8:79597905-79597927 CATTGTGGAAAACAGTATGAAGG + Intergenic
1043374130 8:79628481-79628503 CATTATGGAAAGCAGTATGGAGG - Intronic
1043427558 8:80163047-80163069 TATTATGGAAAACAGTATGAAGG + Intronic
1043696811 8:83230319-83230341 CATTATAGAAAACTGTATGGAGG - Intergenic
1043828479 8:84959008-84959030 CATTATGCAAAAATGTATGGAGG + Intergenic
1043840388 8:85095673-85095695 CACTATGGAAAACAGTATGAAGG + Intergenic
1044130156 8:88512504-88512526 TATTATAGAAAACTGTATGGAGG + Intergenic
1044152471 8:88798648-88798670 CGTTATGGAAAACAGTATGAAGG - Intergenic
1044214566 8:89593780-89593802 CATTATGGGAAACAGTATGGAGG + Intergenic
1044360598 8:91279366-91279388 CATTATGGAAAACAGTATGGAGG - Intronic
1044431712 8:92115244-92115266 CATTAAGGAAAACAGTATGAAGG - Intergenic
1044450084 8:92325600-92325622 CATTGTGGAAAACAGTATGGAGG - Intergenic
1044498300 8:92918292-92918314 CATTATGGAAAACAATATGGAGG - Intronic
1044617088 8:94153432-94153454 CATTGTGGAAAACAGTATGGAGG + Intronic
1044826719 8:96205622-96205644 CATTATGGAAAAATGTATGAAGG - Intergenic
1045145797 8:99342814-99342836 CATTATGGAAAACGGTATGGAGG - Intronic
1045337430 8:101220652-101220674 CATTATGGAAAACAGAAAGGAGG + Intergenic
1045432914 8:102130027-102130049 CACTATGGAAAACTGCATGGAGG + Intergenic
1045455180 8:102371172-102371194 CATTATGGAAAACAGTATGGAGG - Intronic
1045532535 8:102998477-102998499 CACTATGGAAAACAGTATGGAGG - Intergenic
1045812176 8:106234670-106234692 CATTATGGATAACAGTATGGAGG + Intergenic
1045851796 8:106708841-106708863 CACTATGGAAAACAGTACGGAGG - Intronic
1045856899 8:106774732-106774754 CATTATGGAAAACAGTATGGAGG - Intergenic
1046190017 8:110782403-110782425 CATTATGGAAAACAGTATGGTGG - Intergenic
1046672430 8:117071115-117071137 CATTATGGACAACAGTATGGAGG - Intronic
1046796137 8:118374550-118374572 CATTATGGAAAACAGTATTGAGG - Intronic
1046926164 8:119791429-119791451 CTTTATTGAAAAGTGTAGATGGG + Exonic
1047030690 8:120876489-120876511 CATTATGGAAAACTGTACGAAGG - Intergenic
1047090112 8:121565287-121565309 CATTATGAAAAACAGTATGGAGG + Intergenic
1047465766 8:125112317-125112339 CATTATGGAAAACAGTATGGAGG + Intronic
1047634857 8:126750124-126750146 CATTATGGAAAACAGTACAGAGG - Intergenic
1047664711 8:127078355-127078377 CATTATGGAAAACTGTATGGAGG - Intergenic
1047667786 8:127111096-127111118 CACTATGGAAAACTGCATGGAGG + Intergenic
1047935602 8:129774986-129775008 CCATATGGAAAACAGTATGTTGG + Intronic
1048011573 8:130461089-130461111 CATTATGGAAAACAGTACAGAGG + Intergenic
1048148997 8:131874843-131874865 TATTTTGGAAAACAGTATGTAGG - Intergenic
1048417978 8:134248405-134248427 CATTATGGAGAACAGTATGGAGG + Intergenic
1050403581 9:5283150-5283172 CATTATGGAAAACAGTATAGAGG + Intergenic
1050762923 9:9095674-9095696 CATTATGGAAAACAGTATGGAGG + Intronic
1050777878 9:9290027-9290049 CATCATGGAAAACAGTATGAAGG - Intronic
1050822592 9:9899620-9899642 TATTATGGAAAACAGTATGGAGG + Intronic
1051106264 9:13584394-13584416 CATCATGGAAAACAGTATGGAGG - Intergenic
1051234808 9:14988231-14988253 CATTATGAAAAACAGTATGGAGG + Intergenic
1051373853 9:16383922-16383944 CATTATGGAGAACAGTATGGAGG - Intergenic
1051573587 9:18588042-18588064 CATTATAGAAAACAGTATGGAGG - Intronic
1051983613 9:23055488-23055510 CATTATGGAAAATAGTATGAAGG + Intergenic
1052072656 9:24101526-24101548 CATTATGGAAAACTGTATGAAGG - Intergenic
1052152925 9:25141784-25141806 CATTATGGAAAACAGTATGGAGG + Intergenic
1052264559 9:26556810-26556832 CATTATTGAAAACAGTATGATGG - Intergenic
1052446578 9:28569209-28569231 CATTATAGAAAACAGTATGGAGG + Intronic
1052454659 9:28680530-28680552 CATTATGGAATACAGTATGATGG - Intergenic
1052477957 9:28985433-28985455 CATTATGGAAAATTGTATAGTGG - Intergenic
1052528380 9:29650749-29650771 CATTATGAAAAACAGTATGTAGG + Intergenic
1052541110 9:29812458-29812480 CATTATGAAAAACAGTATGGAGG + Intergenic
1052594281 9:30538339-30538361 CATTATGGAAAACATAATGTAGG - Intergenic
1052662430 9:31451697-31451719 TACTATGGAAAACTGTATGAAGG + Intergenic
1052681241 9:31695845-31695867 CATTATGGAAGACAATATGTAGG + Intergenic
1052686127 9:31758550-31758572 CATTATGGAAAATAGTATGCAGG - Intergenic
1052717786 9:32138353-32138375 CATTATGAAAAACAGTATGGAGG + Intergenic
1053046203 9:34920125-34920147 CACTATGGAGAACTGTATGGAGG - Intergenic
1053086054 9:35223263-35223285 CCTTATGGAAAACAGTATGGGGG - Intronic
1053193699 9:36097599-36097621 CATTATGGGAAACAGTATGGGGG + Intronic
1053333264 9:37236120-37236142 CATTATGGAAAACAGTGTGGAGG - Intronic
1053403553 9:37850200-37850222 AATTATGGAAGACAGTAGGGAGG + Intronic
1053467821 9:38323967-38323989 CATTATGAAAAACAGTATGGAGG + Intergenic
1053563382 9:39220362-39220384 CATTATGGAAAGCAGTAGGGAGG - Intronic
1053676909 9:40440530-40440552 CATTAGTGAAAACTGTGGATTGG + Intergenic
1053781506 9:41613228-41613250 CATTATATTAAACTGTAGTTAGG + Intergenic
1054133765 9:61398704-61398726 CATTATGGAAAGCAGTAGGGAGG + Intergenic
1054169453 9:61823380-61823402 CATTATATTAAACTGTAGTTAGG + Intergenic
1054172061 9:61850113-61850135 TATTATGAAAAACTGTATGGTGG - Intergenic
1054286807 9:63184377-63184399 CATTAGTGAAAACTGTGGATTGG - Intergenic
1054289979 9:63276053-63276075 CATTAGTGAAAACTGTGGATTGG + Intergenic
1054388010 9:64580597-64580619 CATTAGTGAAAACTGTGGATTGG + Intergenic
1054446923 9:65379136-65379158 TATTATGAAAAACTGTATGGTGG - Intergenic
1054507713 9:65935772-65935794 CATTAGTGAAAACTGTGGATTGG - Intergenic
1054601392 9:67129164-67129186 CATTATGGAAAGCAGTAGGGAGG + Intergenic
1054665476 9:67730694-67730716 TATTATGAAAAACTGTATGGTGG + Intergenic
1054668084 9:67757435-67757457 CATTATATTAAACTGTAGTTAGG - Intergenic
1054748942 9:68884880-68884902 CATTTTGGAAAACAGTAGGGAGG + Intronic
1055211577 9:73801284-73801306 TATTATGGAAAACAGTATGGAGG + Intergenic
1055802638 9:80056899-80056921 CATTATGGAAAACAGTATGGAGG + Intergenic
1055847003 9:80577482-80577504 CATTATGGAAAACAGTATAGAGG + Intergenic
1055910764 9:81348188-81348210 CATTATGGAAAACAGTATGGAGG - Intergenic
1056288484 9:85115558-85115580 CATTATGGAAAACAGTATGGAGG - Intergenic
1056344441 9:85676609-85676631 CACTATGGAAAACAGTATGGGGG + Intronic
1056429929 9:86516954-86516976 CATTATGGAAAACAGTATAAAGG - Intergenic
1056485730 9:87055490-87055512 CATTATGGAAAACAATATGGAGG - Intergenic
1056507720 9:87273157-87273179 CATTGTGGAAAACAGTACGGTGG + Intergenic
1056510488 9:87300041-87300063 CATTATGGAAAAATGTATGGAGG - Intergenic
1057015857 9:91650913-91650935 CATTATGGAAAACAGCAGACAGG + Intronic
1057117821 9:92542167-92542189 CATTATAGAATACTGTATGGAGG - Intronic
1057295654 9:93837196-93837218 CACTATGGAAAACTGTATGAAGG - Intergenic
1057475455 9:95397313-95397335 CATTATGAAAAACAGTATGGAGG + Intergenic
1057749190 9:97777407-97777429 CATTATGGAAAACAGAATGGAGG + Intergenic
1057997933 9:99836779-99836801 CATTATGGAAAACAGTATGGGGG - Intronic
1058050926 9:100405836-100405858 CATTTTGGAAAACTGTTTGGTGG + Intergenic
1058113693 9:101059886-101059908 CATTATGGAAAACAGTATGAAGG + Intronic
1058124985 9:101181384-101181406 CATTCTGGAAAACAGTATGGAGG + Intronic
1058323587 9:103666078-103666100 CATAATGGAAAACAGTATGGTGG + Intergenic
1058352855 9:104047020-104047042 CATTATGGAAAACAGTATGAAGG + Intergenic
1058403150 9:104640356-104640378 CATTATGGAAAACAGTATGAAGG + Intergenic
1058652251 9:107187519-107187541 CATTATGGAAAACAGTATGGTGG + Intergenic
1058728757 9:107829154-107829176 CATTATGAAAAACAGTATGGGGG - Intergenic
1058920941 9:109614163-109614185 CATTATGGAAAAGAGTATGGAGG + Intergenic
1059018232 9:110545336-110545358 CATTATGGAAAACAGTATGGAGG - Intronic
1059028435 9:110662859-110662881 CATTATGGAAAGCAGTGGGGAGG - Intergenic
1059034141 9:110735130-110735152 CACTATGGAAAACAGTATGGCGG + Intronic
1059235497 9:112757570-112757592 CATTATGGAAAACAGTATGGAGG - Intronic
1059466962 9:114475072-114475094 CACTAGGGAAAACTGTATGGTGG + Intronic
1059614712 9:115936592-115936614 CATTATGGAAAACAGTATGTAGG + Intergenic
1060326559 9:122621753-122621775 CATTATGGAAAACAGTATGGAGG + Intergenic
1060327891 9:122634950-122634972 CATTATGGAAAACAGTACAGAGG + Intergenic
1060746550 9:126137624-126137646 CACTATGGAAAACAGTATGGTGG + Intergenic
1061640035 9:131946318-131946340 CATTATGGAAAATAGTATGGCGG - Intronic
1061979950 9:134096564-134096586 CATTATGGAAAACAGTATGGAGG + Intergenic
1203611984 Un_KI270749v1:16839-16861 CACTATGGAAAACAGTATGGAGG + Intergenic
1185985799 X:4831628-4831650 CATTATGAAAAACAGTATGGAGG + Intergenic
1186017219 X:5211607-5211629 CATTCTGGAAAACAGTATGCAGG - Intergenic
1186031609 X:5375087-5375109 CATTGTGGAAAACAGTATGGAGG - Intergenic
1186229775 X:7440608-7440630 CATTATGGAAAACAGAATGGAGG + Intergenic
1186259278 X:7759036-7759058 CATTATGGAAAACAGTATGGAGG - Intergenic
1186264745 X:7820071-7820093 CATTATGGAAAACCATATGGAGG - Intergenic
1186380247 X:9050460-9050482 CATTTTGGAAAACTGTTAGGCGG + Intronic
1186381014 X:9059065-9059087 CATTATGGAAAACAGTATGGAGG + Intronic
1186586165 X:10875389-10875411 CAAGCTGGAAAGCTGTAGGTGGG + Intergenic
1186674547 X:11802669-11802691 CATTATGGAAAACAATATGGAGG + Intergenic
1186900315 X:14047944-14047966 CATTATGGAAAACAGTATGGTGG - Intergenic
1186985272 X:15006523-15006545 CATTATGGAAAACAGCATGGAGG + Intergenic
1187024819 X:15423990-15424012 CATTATGGAAAGCAGTATGAAGG + Intronic
1187178732 X:16921909-16921931 CATTATGGAAAACAGTGTGGTGG + Intergenic
1187214270 X:17260909-17260931 CTTTATGGAAAACAGTATGGAGG + Intergenic
1187621165 X:21056920-21056942 CATTGTGGAAAACAGTATGGAGG - Intergenic
1187633483 X:21201326-21201348 CATTATGGAAAAGAGTATGGAGG + Intergenic
1187654605 X:21456785-21456807 CACTATGGAAAACAGTATGGAGG - Intronic
1187771035 X:22696257-22696279 CATTATGGAAAATAGTAAGGAGG + Intergenic
1187780189 X:22812870-22812892 CATTATGGAAAACAGTATGGAGG + Intergenic
1187856506 X:23641668-23641690 CATTATGGAAAGCAGTATGGAGG + Intergenic
1187961352 X:24569366-24569388 CACTATGGAAAACAGTAAGGCGG + Intronic
1187983599 X:24786240-24786262 CATTATGGAAAACAGTATGGAGG - Intronic
1188089594 X:25947274-25947296 CATTATTGAAAACTATATGGAGG + Intergenic
1188120510 X:26300376-26300398 CATTATGGAAAACAGTGTGGAGG - Intergenic
1188248514 X:27862931-27862953 CATTATGGAAAACAGTATGAAGG + Intergenic
1188321912 X:28749332-28749354 CATTATGAAAAACAGTATGAAGG - Intronic
1188381633 X:29500888-29500910 CATTATGGAAAACTGTATGGAGG - Intronic
1188429999 X:30095853-30095875 CATTATGGAAAATAGTATGGAGG + Intergenic
1188523560 X:31064698-31064720 CATGATGGAAAACAGTATGAAGG + Intergenic
1188649851 X:32618883-32618905 CATCATGGAAAACAGTATGAAGG + Intronic
1188722279 X:33537768-33537790 AATTATGGAAAACAGTATGAAGG + Intergenic
1188724313 X:33562705-33562727 CATTATGGAAAACAGTATGAAGG - Intergenic
1188819436 X:34755661-34755683 CATTATGGAAAACTGTATGGAGG + Intergenic
1188825447 X:34827313-34827335 CATTAAGGAAAACAGTATGGAGG + Intergenic
1188863269 X:35284380-35284402 CATTATGTAAAACTGTATGTAGG + Intergenic
1188902943 X:35757495-35757517 CATTATGGAAAACTGTATAGAGG - Intergenic
1188995130 X:36875163-36875185 CACTATGGAAAACAGTATGGAGG + Intergenic
1189001862 X:36956733-36956755 TATTATGGAAAACAGTATGGAGG + Intergenic
1189128238 X:38471137-38471159 CATTGTGGAAAACAGTATGGAGG + Intronic
1189131395 X:38501528-38501550 TATTATGGAAAACAGTATGGAGG + Intronic
1189157728 X:38775952-38775974 CATTATGGAAAAAAGTATGCTGG - Intergenic
1189215921 X:39323531-39323553 TATTATGGAAAACAGTATGGAGG + Intergenic
1189407496 X:40737904-40737926 CATTTTGGAAAACAGTATGGAGG - Intergenic
1189767698 X:44389000-44389022 CATTACGGAAAACAGTATGGAGG + Intergenic
1189769015 X:44403780-44403802 CACTGTGGAAAACTGTATGGAGG - Intergenic
1189780565 X:44510457-44510479 CATTATGGAAGACAGTATGGAGG - Intergenic
1190067994 X:47255833-47255855 CATTATGGAAAAGTGTATGGAGG - Intergenic
1190401592 X:50041331-50041353 CATTATGGCCAACTTTATGTAGG - Intronic
1190459298 X:50655835-50655857 CATTATGGAAAACAGTAGGGGGG - Intronic
1190475149 X:50819877-50819899 CATTATGGAAAACAGTATGGAGG - Intergenic
1190482914 X:50895404-50895426 CATTATGGAAAACAGTATGGAGG + Intergenic
1190485978 X:50925486-50925508 CATTATGGAAAATAGTATGGTGG - Intergenic
1190486087 X:50926701-50926723 CATTATGGAAAACCGTATGGAGG - Intergenic
1190505609 X:51123117-51123139 CATTTTGGAAAACAGTATGGAGG - Intergenic
1190512542 X:51188348-51188370 CATTATGAAAAACAGTACGACGG + Intergenic
1190535722 X:51425396-51425418 CACTATGGAAAACAGTATGGAGG - Intergenic
1190585683 X:51938589-51938611 CATTTTGGAAAACAGTATGTAGG + Intergenic
1190607457 X:52159880-52159902 AATTATGGAAAACAGTATGGAGG + Intergenic
1190863657 X:54366753-54366775 CATTATGGAAAATGGTAGGGAGG + Intergenic
1190905890 X:54727679-54727701 CATTATGGAAAACAGTATGTAGG + Intergenic
1191067161 X:56361249-56361271 TATTGTGGAAAACAGTACGTTGG + Intergenic
1191647751 X:63501479-63501501 CATTATGGAAATCAGTATGGAGG + Intergenic
1191760709 X:64645295-64645317 CATTACGGAAAACAGTATGGAGG + Intergenic
1191806361 X:65138657-65138679 CATCATGAAAAACTGTATGGAGG - Intergenic
1191961238 X:66704618-66704640 CATTATGGAAAATAGTATGAAGG + Intergenic
1191968238 X:66784922-66784944 CATTATGGAAAACAGCATGGAGG + Intergenic
1192115229 X:68404131-68404153 CATTATGGAAAACAGTATGGTGG + Intronic
1192137638 X:68619172-68619194 CAATATGGAAAACAGTATGGAGG - Intergenic
1192285820 X:69734943-69734965 CATTATGGAAAACAGGAAGGGGG + Intronic
1192348852 X:70337837-70337859 CACTATGGAAAACAGTATGGTGG - Intronic
1192399629 X:70821840-70821862 CATTATGCAAAATAGTAGGAAGG + Intronic
1192415578 X:70977282-70977304 CATTATGGAAAACGGTATGGAGG - Intergenic
1192637663 X:72834808-72834830 CATCATGGAAAACAGTACGGAGG + Intronic
1192637846 X:72836662-72836684 CATTATGGAAAACAGTGTGAAGG + Intronic
1192643868 X:72884153-72884175 CATTATGGAAAACAGTGTGAAGG - Intronic
1192644051 X:72886007-72886029 CATCATGGAAAACAGTACGGAGG - Intronic
1192725240 X:73743654-73743676 CATTATGGAAAAAAGTATGGAGG - Intergenic
1192744408 X:73924694-73924716 CATTATGGAAAACAGTATGGAGG - Intergenic
1192771547 X:74197077-74197099 CATTATGGAAGACAGTATGGAGG - Intergenic
1192786142 X:74337568-74337590 CATTATGGAAAACAGTTTGGAGG - Intergenic
1192789052 X:74363002-74363024 CATTATGAAAAACAGTACGGAGG + Intergenic
1193072953 X:77325897-77325919 CATTATGGAAAACAGCATGGAGG + Intergenic
1193344884 X:80394125-80394147 CATTATGGAAAACAGTATTGAGG - Intronic
1193383244 X:80841779-80841801 CATTATGGAAAATTTTATGGAGG + Intergenic
1193442076 X:81554613-81554635 CATTATGAAAAACAGTATGGGGG - Intergenic
1193618517 X:83720804-83720826 CATTATGAAAAACAGTATGCAGG - Intergenic
1193624806 X:83804854-83804876 CACTATGGAATACGGTAGGGAGG + Intergenic
1193648075 X:84092762-84092784 CATTATGGAAAACAGTATAGTGG + Intronic
1193679021 X:84494755-84494777 CATTATGGAAAACAGTATAGAGG + Intronic
1193798008 X:85899986-85900008 CATTACGGAAAACAGTATGGAGG + Intronic
1193806355 X:86000426-86000448 CATTATGGAAAACAGTATGGAGG + Intronic
1193859513 X:86647098-86647120 CAGTATGGAAAACAGTATGTTGG + Intronic
1193869361 X:86778208-86778230 CATTATGGAAAACAGTATGGAGG - Intronic
1193886607 X:86989676-86989698 CATTATGGAAAACTGTATGGAGG + Intergenic
1193894229 X:87092056-87092078 CATTATGGAAAACAGTATGGGGG - Intergenic
1194015891 X:88620462-88620484 CATTATGGAAAACAGTATGAAGG + Intergenic
1194178638 X:90685699-90685721 CATTATGGAAAACAGTATGGAGG - Intergenic
1194301007 X:92185930-92185952 CATTATGGAAAACAGTTTGGAGG + Intronic
1194337169 X:92662558-92662580 TATTATGGAAAACAGTATGGAGG + Intergenic
1194489462 X:94528715-94528737 CATTATAGAAAACAGCATGTTGG - Intergenic
1194511191 X:94796924-94796946 CATTATGGAAAACATTATGGAGG - Intergenic
1194651056 X:96514901-96514923 CATTATAGAAAACAGTATGGAGG + Intergenic
1194747486 X:97644420-97644442 CATTATGGAAAATAGTATGGAGG - Intergenic
1194799784 X:98258570-98258592 CATTGTGGAAAACAGTATGGTGG + Intergenic
1194897608 X:99464522-99464544 CATTATGTAAAACAGTATGGAGG - Intergenic
1195029815 X:100915465-100915487 CATTATGGAAAACAGCATGGAGG + Intronic
1195072669 X:101295615-101295637 CATTATGGAAAACAGTATGGAGG + Intergenic
1195169699 X:102254443-102254465 CATTATGGAAAACAGTATGGAGG - Intergenic
1195189158 X:102432657-102432679 CATTATGGAAAACAGTATGGAGG + Intronic
1195250101 X:103035361-103035383 CATTATGGAAAACACTATGGAGG - Intergenic
1195286258 X:103387441-103387463 CTTTATGGAAAACAGTGGGGAGG - Intergenic
1195313545 X:103656542-103656564 CATGATGGGAAACAGGAGGTTGG - Intergenic
1195368972 X:104154403-104154425 CATTATGGAAAACTGTATGGAGG + Intronic
1195407310 X:104529469-104529491 CATTATGGAAAACAGTATGGAGG + Intergenic
1195501525 X:105606472-105606494 CATTATGGAGAACAGTATGGAGG + Intronic
1195538000 X:106030838-106030860 CATTATGGAAAACAGTATGGAGG - Intergenic
1195612168 X:106880113-106880135 CATTATGGAAAACAGTGGGGAGG + Intronic
1195781655 X:108472840-108472862 CATTTTGGAAAACAGTATGGCGG - Intronic
1195813949 X:108865061-108865083 CATTATGGAAAGCAGTATGGAGG - Intergenic
1195818570 X:108916613-108916635 CATTATGGAAAGCACTATGTAGG + Intergenic
1195953184 X:110300098-110300120 CATTATGGAAAACAGTATAGAGG - Intronic
1196119357 X:112032318-112032340 CATTATGGACAACAGTATGAAGG + Intronic
1196121154 X:112052193-112052215 CACTATGGAAAACAGTATGGTGG - Intronic
1196126503 X:112106592-112106614 CATTATGGAAAACAGTATGGAGG - Intergenic
1196142660 X:112281559-112281581 CATTTTGGAAAACTGTGTGGAGG - Intergenic
1196302302 X:114061289-114061311 CATTATGGAAAAAAGTATGGAGG - Intergenic
1196361174 X:114861562-114861584 CATCATGGAAAACAGTATGGAGG - Intronic
1196361285 X:114863262-114863284 CACTATGGAAAACAGTATGGAGG - Intronic
1196487190 X:116225805-116225827 CATTATGGAAAACAGTATGGAGG + Intergenic
1196557364 X:117104397-117104419 TATTATGGAAAACAGTATGGAGG + Intergenic
1196620690 X:117820260-117820282 CATTATGGAAAACAGTACGGAGG + Intergenic
1196622910 X:117844171-117844193 CATTATGGAAAACAGTATGGAGG + Intergenic
1196727157 X:118906113-118906135 CATTATGGAAAATAGTATGAAGG - Intergenic
1196793529 X:119484855-119484877 CATTATGGAAAATGGTATGAAGG - Intergenic
1197085055 X:122462669-122462691 CATTATGAAAAACAGTATGGGGG - Intergenic
1197122860 X:122912885-122912907 CATTATGGAAAACAGTACGGAGG + Intergenic
1197143721 X:123146950-123146972 CATTATGGAAAACAGTGTGGAGG - Intergenic
1197164742 X:123364540-123364562 CATTATGGAAAACAGTATGGAGG + Intronic
1197180272 X:123527944-123527966 CATTATGGAAAACAGTATGGAGG - Intergenic
1197213500 X:123847314-123847336 CATTATGGAAAGCAGTATGAAGG + Intergenic
1197338585 X:125238332-125238354 CATTATGGAAAACAGTGTGGAGG - Intergenic
1197348726 X:125357049-125357071 CATTATGAAAAACAGTATGAAGG + Intergenic
1197365206 X:125556169-125556191 CATTATGAAAAACTATATGGAGG - Intergenic
1197436935 X:126441241-126441263 CATTATGAAAAACAGTATGGAGG - Intergenic
1197448107 X:126577832-126577854 CATTATGGAAAACAGTATGAAGG - Intergenic
1197451706 X:126628034-126628056 CATTATGGAAAACAGTATGAAGG - Intergenic
1197573026 X:128173041-128173063 CATTATGGACAACAGTATGCAGG + Intergenic
1197670087 X:129267165-129267187 CATTATGGAACACGGTATGGAGG - Intergenic
1197847656 X:130820382-130820404 CATTATGGAAAAGAGTATGGAGG + Intronic
1197881754 X:131173906-131173928 CACTATGGAAAACAGTTTGTTGG + Intergenic
1197950674 X:131892731-131892753 CATTATGGAAAACAGTATGGAGG + Intergenic
1197957592 X:131968910-131968932 CACTATGGAGAACAGTAGGGAGG + Intergenic
1198148798 X:133887242-133887264 CATTATGGAAAACACTATGGAGG - Intronic
1198152896 X:133928504-133928526 CATTATGGAAAACAGTATGGAGG - Intronic
1198164707 X:134043372-134043394 CATTATGAAAAACAGTATGGAGG - Intergenic
1198171588 X:134111235-134111257 CACTGTGGAAAACAGTAGGGAGG - Intergenic
1198192288 X:134320139-134320161 CATTATGGAAAACAGTATGGAGG + Intergenic
1198287260 X:135203475-135203497 CATTATGGAACACAGTATGGAGG - Intergenic
1198542004 X:137649679-137649701 TATTATGGAAAACAGTATGGAGG + Intergenic
1198543227 X:137662685-137662707 CATTATGGAAAATAGTATGAAGG - Intergenic
1198931266 X:141863540-141863562 CAATATGGAAAACTGTGGGGAGG + Intronic
1198940225 X:141946501-141946523 CATTATGGAAAACAGTATGGAGG - Intergenic
1199028944 X:142973504-142973526 CACTATGGAGAACAGTAGGGAGG + Intergenic
1199102004 X:143813285-143813307 CACTATGGAAAACAGTATGGAGG + Intergenic
1199410156 X:147512196-147512218 CATTATGGAAAACAGTATACAGG + Intergenic
1199843018 X:151669963-151669985 CACTATGGAAAACAGTATGGAGG - Intronic
1200259764 X:154607542-154607564 CACTATGGAAAACTGTTTGGCGG + Intergenic
1200273315 X:154708780-154708802 CATTATGGAAAACAGTATGGAGG + Intronic
1200307677 X:155044780-155044802 CATTATGGAAAACAGTATGGAGG + Intronic
1200335291 X:155344588-155344610 CATTATGGAAAACAATACGGAGG - Intergenic
1200351177 X:155496633-155496655 CATTATGGAAAACAATACGGAGG + Intronic
1200354063 X:155529417-155529439 AATTATGGAAAACAGTATGAAGG - Intronic
1200525302 Y:4267861-4267883 CATTATGGAAAACAGTATGGAGG - Intergenic
1200645598 Y:5779292-5779314 TATTATGGAAAACAGTATGGAGG + Intergenic
1200751371 Y:6947037-6947059 CATTAAGGAAAACTCAAGCTGGG - Intronic
1201315122 Y:12637131-12637153 CATTATGGAAAACAGTATAGCGG - Intergenic
1201651015 Y:16286678-16286700 CATTACGGAAAACAGTATGGAGG + Intergenic
1201948089 Y:19534189-19534211 CATTATGAAAAACAGTATGGAGG + Intergenic
1202051590 Y:20786845-20786867 CATTATGGAAAACAGTATGGAGG - Intergenic
1202297289 Y:23373221-23373243 CATTGTGGAAAACAGTATGGAGG - Intergenic
1202299424 Y:23395890-23395912 CATTATGGAAAACAGTATGGAGG + Intergenic
1202571385 Y:26274708-26274730 CATTATGGAAAACAGTATGGAGG - Intergenic
1202573518 Y:26297376-26297398 CATTGTGGAAAACAGTATGGAGG + Intergenic