ID: 908703821

View in Genome Browser
Species Human (GRCh38)
Location 1:66930019-66930041
Sequence TCCAGCTGATCCGCCACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908703821_908703822 -1 Left 908703821 1:66930019-66930041 CCTGGAGTGGCGGATCAGCTGGA 0: 1
1: 0
2: 1
3: 3
4: 132
Right 908703822 1:66930041-66930063 AGCCAGCGAAGCGCCCCGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908703821 Original CRISPR TCCAGCTGATCCGCCACTCC AGG (reversed) Intronic
903978219 1:27165907-27165929 TTCAGGTGATCCGCCCATCCTGG - Intronic
904339232 1:29823230-29823252 TCAAGCTGATCTCCAACTCCTGG + Intergenic
904833609 1:33320937-33320959 ACCAGCTGAGCCTCCAGTCCTGG - Intronic
908303301 1:62784064-62784086 TCCAACAGATCAGCCACTTCCGG - Intergenic
908703821 1:66930019-66930041 TCCAGCTGATCCGCCACTCCAGG - Intronic
909743611 1:79064991-79065013 CCCAGCTGTTCATCCACTCCTGG - Intergenic
912714571 1:111973799-111973821 TCAAGCTGTTCTGCCACTCATGG + Intronic
914402773 1:147338806-147338828 TCCAGTTGATCTGAAACTCCGGG - Intergenic
915368622 1:155329719-155329741 TTCAGGTGATCCACCACGCCCGG - Intronic
923094188 1:230761508-230761530 TCCAGCTGGACCTCCCCTCCAGG - Intronic
923245054 1:232122392-232122414 TAAAGCTAATCCGCCAGTCCTGG - Intergenic
1064270652 10:13862969-13862991 TCCAGCTGTTCAGACACTACGGG + Intronic
1069949220 10:72007921-72007943 TCCAGCTGGTGCGCGACCCCCGG + Exonic
1070592702 10:77811929-77811951 ACCAGCTCAGCAGCCACTCCCGG - Exonic
1074771697 10:116739149-116739171 TCAAGCTGAACAGCCTCTCCTGG - Intronic
1075705076 10:124495580-124495602 TCCTCCAGCTCCGCCACTCCTGG - Intronic
1076999766 11:316660-316682 TCGAGCTGAGTCGCCCCTCCCGG + Intergenic
1077251952 11:1564660-1564682 GCCAGCTGAGCCGCCAACCCTGG + Intronic
1079208652 11:18440717-18440739 CCCAGCTGATCTGAAACTCCTGG - Intronic
1080418696 11:32091838-32091860 TCTCTCTGATCCCCCACTCCCGG + Intronic
1082187257 11:49198821-49198843 TCAAGCTGGTCTGCAACTCCTGG + Intronic
1082280894 11:50270257-50270279 TCAGGCTGATCTGCAACTCCTGG - Intergenic
1083545958 11:63549594-63549616 GCCAGCTGTCCCGTCACTCCTGG - Intergenic
1084636223 11:70394667-70394689 TCCAGCTGGTCTTGCACTCCTGG + Intergenic
1085526272 11:77166098-77166120 TCCAGCTGGTCCACTCCTCCAGG + Exonic
1086679081 11:89646602-89646624 TCAAGCTGGTCTGCAACTCCTGG - Intergenic
1097283889 12:57863094-57863116 TCCAGCTGCTCTGTCATTCCTGG - Intergenic
1098389744 12:69956955-69956977 TCAAGGTGATCTGCCACTTCAGG - Intronic
1102271747 12:111542451-111542473 CTCAGGTGATCCGCCACGCCTGG + Intronic
1103073423 12:117963388-117963410 TCCAGCTGATCTTGAACTCCTGG - Intronic
1104871854 12:132005072-132005094 TGCAGCTGAGCTGCCCCTCCTGG + Exonic
1107134143 13:36925666-36925688 TCCAGGTGATCCGCCCGTCTCGG + Intergenic
1112675762 13:101699756-101699778 TCCAACAGTTCCACCACTCCTGG + Intronic
1113492708 13:110705198-110705220 TCCTGCTGATCAGTCATTCCTGG - Intronic
1114168640 14:20248410-20248432 TCCAGCTGGTCTCCAACTCCTGG - Intergenic
1121054057 14:90838662-90838684 TCCAGCAGATCCCAAACTCCAGG - Intergenic
1121709255 14:96025246-96025268 TTCAGCTGATCCTTCATTCCAGG + Intergenic
1122684431 14:103493998-103494020 CCCAGGTGATCCGCCCCTCTTGG - Intronic
1124199477 15:27665983-27666005 TCCAGCTCAGGCCCCACTCCTGG - Intergenic
1127884794 15:63189656-63189678 TCCTGCTGATCGGCGACTCGGGG + Exonic
1132099614 15:99014553-99014575 CCCACCTGATTCGCCACCCCAGG - Intergenic
1133344424 16:5060411-5060433 TCCAGCTGACCCTCCAGCCCGGG - Exonic
1133617290 16:7489728-7489750 TCCGGCTGATCTTCAACTCCTGG + Intronic
1136022513 16:27449057-27449079 TCCAGGTGACCGGCCACCCCAGG - Exonic
1139008300 16:62600939-62600961 TCCAGGTCAGCCCCCACTCCTGG + Intergenic
1140507989 16:75486437-75486459 TGGGGCTGATCCACCACTCCCGG + Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1142249200 16:88983378-88983400 CCCAGCTCATCAGCCACCCCAGG + Intergenic
1143138666 17:4727478-4727500 CTCAGGTGATCCGCCAGTCCCGG + Intergenic
1143471419 17:7178229-7178251 TCCAGCTGTTCCCACACCCCCGG + Intronic
1145296687 17:21598490-21598512 TCCTGGTGATCAGCTACTCCTGG + Intergenic
1146920067 17:36704278-36704300 TCCACCTCATCCCCTACTCCAGG + Intergenic
1148712668 17:49693087-49693109 TCCAGGTGAGCCACCACGCCTGG - Intergenic
1150679613 17:67274252-67274274 TCCAGCTGGTCTGAAACTCCTGG + Intergenic
1152544812 17:80995128-80995150 TCCAGCTGCACCTGCACTCCAGG - Intronic
1153079004 18:1198313-1198335 TTCAGCTGATCCTGAACTCCTGG + Intergenic
1153444485 18:5156038-5156060 TCCAGCTGCTTCGGAACTCCTGG - Intronic
1159003085 18:62990323-62990345 TCCAGGTGATCCGCCCATCTTGG + Intergenic
1160679386 19:405808-405830 CCCAGCTGCTCCTCCAGTCCTGG + Exonic
1162359070 19:10206736-10206758 GTCAGCTGATCTGCCCCTCCTGG + Intronic
1162760291 19:12884981-12885003 ACGAGCTGACCCGCCACTACCGG - Exonic
1163003091 19:14381353-14381375 TCCAGCTGCACCGCCAGTTCCGG + Intronic
1163063604 19:14776910-14776932 TCCAGCTGCACCGCCAGTTCCGG - Exonic
1163810119 19:19425928-19425950 TACAGGTGCTCCGCCACGCCTGG + Intronic
1164228052 19:23263466-23263488 TCCAGGTGATGCGACTCTCCTGG - Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
927640192 2:24841145-24841167 TCCAGCAGATCCCCCACCCAGGG + Intronic
930117027 2:47726878-47726900 TCAGGCTGATCCGAAACTCCTGG + Intronic
933174113 2:79157514-79157536 TCCATCTCATCCCCCATTCCTGG - Intronic
933716912 2:85368425-85368447 ACCTGGTGATCCCCCACTCCCGG - Intronic
942051435 2:172144636-172144658 TCCAGGTGATCTGCCAAGCCTGG + Intergenic
942103284 2:172607453-172607475 TCCAGTTGTTTTGCCACTCCAGG + Intronic
944662836 2:201935449-201935471 TCCTGCTGATCACCCACTTCAGG + Intergenic
948845064 2:240679182-240679204 TCCTGCGGATCCTTCACTCCGGG - Intronic
948848796 2:240695697-240695719 TCCTGCGGATCCTTCACTCCGGG + Intronic
1168920763 20:1533776-1533798 TCCTCCTCACCCGCCACTCCTGG + Intergenic
1168968561 20:1915095-1915117 TCCTCCTCACCCGCCACTCCTGG - Exonic
1169826518 20:9774385-9774407 TCCAGCGGCTCCCCAACTCCAGG - Intronic
1173664263 20:44753783-44753805 CCCAGCTGCTCCACCCCTCCAGG + Intronic
1177109840 21:17012535-17012557 TCCAGCTCGTCTGCCAGTCCTGG + Intergenic
1177182129 21:17755920-17755942 TCCAGCTGGTCTCCAACTCCTGG + Intergenic
1178260951 21:31099172-31099194 TCCTGCTCATCTCCCACTCCTGG + Intergenic
1178358942 21:31932277-31932299 TACAGGTGATCCCCCACCCCTGG - Intronic
1179249072 21:39657803-39657825 TCCAGCAGATTCTGCACTCCAGG - Intronic
1180051441 21:45333286-45333308 TCCTGCTGAGCCACCCCTCCTGG - Intergenic
1180132879 21:45837820-45837842 TCAGCCTGATCCGCCACTGCTGG + Intronic
1184779513 22:46639964-46639986 TCCAGCAGAGCCACCACTGCAGG - Intronic
952448327 3:33405615-33405637 TCAGGCTGATCCCCAACTCCTGG - Intronic
954145397 3:48631898-48631920 TCCATCTGAGCAGCCACTCTGGG - Exonic
954370485 3:50167415-50167437 TCCTGCTGCTCCGTCACTTCTGG + Intronic
954795755 3:53160839-53160861 GCCAGCTGGCCCGCCTCTCCTGG - Intronic
958712586 3:97735989-97736011 ACCAGCTGATGCTCCACTGCTGG + Exonic
960640363 3:119817258-119817280 GCCCTCTGAGCCGCCACTCCCGG + Exonic
962416288 3:135185137-135185159 TCCAGATGATCATCCATTCCTGG - Intronic
968879575 4:3292342-3292364 TCCAGCGGGTCTGCCCCTCCCGG - Intergenic
969991442 4:11267885-11267907 TCCATCTGATCTGACACTCTAGG + Intergenic
972641206 4:40926684-40926706 CTCAGGTGATCCGCCACGCCTGG + Intronic
974252484 4:59404631-59404653 CCAGGCTGATCTGCCACTCCTGG + Intergenic
977297385 4:95225995-95226017 TCCATCTGATCCGTCTCTCACGG + Intronic
990226083 5:53656021-53656043 TCCAGCTGCTCTGGCAATCCTGG + Intronic
1000082466 5:157860915-157860937 CCCAGCTGATCTGAAACTCCTGG + Intergenic
1003531161 6:6938736-6938758 ACCTGGTGATCCTCCACTCCCGG + Intergenic
1003620741 6:7697139-7697161 CCCAGGTGATCCGCCAGTCTCGG + Intergenic
1005842530 6:29752995-29753017 TCCAGCTGCTCCGCCACCCCAGG + Intergenic
1005871497 6:29977081-29977103 TCCAGCTGCTCCGTCACCCCAGG + Intergenic
1006057988 6:31399964-31399986 TCCTGCTGCTCCGTCACCCCAGG - Intronic
1008894339 6:56535208-56535230 TCCAGCTGAGCAGGGACTCCAGG + Exonic
1017712203 6:157180972-157180994 TCCAGCTCCTCCACCACTACTGG + Exonic
1018649520 6:165981057-165981079 TGCACCTGACCCTCCACTCCAGG - Intronic
1020451718 7:8327042-8327064 TCCAGCTAATCAGTCACCCCAGG - Intergenic
1022349568 7:29554891-29554913 TCCTGCTGCTCTGCCACTCAAGG - Intergenic
1023067851 7:36396753-36396775 GCCAGCTGTTCTGCCACCCCTGG - Intronic
1024621469 7:51161276-51161298 CCCAGCTGATCCGGGTCTCCAGG - Intronic
1026310697 7:69181314-69181336 CCCAGCTGATCTGTAACTCCTGG + Intergenic
1029186861 7:98745479-98745501 TGCAGCTGATCCGCCTTTTCAGG - Intergenic
1031997792 7:128244037-128244059 CCCAGCTGATCTGGAACTCCTGG - Intronic
1034162373 7:149002860-149002882 TCCAGCGGAGCCGCCACCCCAGG + Intergenic
1034564904 7:151905513-151905535 TCCATCCCATCCGCCACGCCAGG - Intergenic
1035032488 7:155870521-155870543 TCCATCTGATCCTCCAAGCCAGG + Intergenic
1036085822 8:5611740-5611762 TCCTTCTGCTCCCCCACTCCAGG + Intergenic
1038274271 8:26107522-26107544 TCCAGTCGATCCCCCAGTCCTGG - Intergenic
1038456815 8:27677395-27677417 TCGAGCTGATCAGTCACTCAAGG - Intergenic
1039869378 8:41532599-41532621 TTCAGGTGATCCGCCCCTCTCGG - Intronic
1040947129 8:52895263-52895285 TCCAGCTTAGCAGCCACTCCGGG + Intergenic
1041167350 8:55102694-55102716 GCCCGCGGAGCCGCCACTCCCGG - Exonic
1045490595 8:102665841-102665863 CTCAGGTGATCCGCCACTCTCGG + Intergenic
1051610584 9:18958082-18958104 TCCAGCTTATACTCCACTCATGG + Intronic
1054902830 9:70387926-70387948 ACGAGCTGACCCGCCACTACCGG - Exonic
1055529308 9:77168007-77168029 TCCAGCTGATCCGCCTGCCTAGG + Intergenic
1057664725 9:97036344-97036366 TACAGGTGATCCACCACGCCTGG + Intronic
1058642996 9:107105313-107105335 TCCAGATGATACGCCAATCATGG - Intergenic
1186496296 X:10015062-10015084 TCCCGCTGCTCCGCCTCCCCCGG - Intergenic
1192144930 X:68675693-68675715 TCCAGCTCCACCTCCACTCCAGG + Intronic
1192538303 X:71947270-71947292 TCCAGCTGATCCTTGACTCTTGG + Intergenic
1192600110 X:72453235-72453257 CCAGGCTGATCTGCCACTCCTGG - Intronic
1194757545 X:97755170-97755192 ACCAGCTGAGCCACCACTACGGG - Intergenic
1199741311 X:150739104-150739126 TCCAGCTGTCCCTGCACTCCTGG + Intronic