ID: 908703899

View in Genome Browser
Species Human (GRCh38)
Location 1:66930302-66930324
Sequence GAGACTCAGCAACGGGACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908703899_908703906 9 Left 908703899 1:66930302-66930324 CCGGAGTCCCGTTGCTGAGTCTC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 908703906 1:66930334-66930356 TTCTGGCCGTGACCCAGCTGCGG 0: 1
1: 0
2: 11
3: 18
4: 122
908703899_908703904 -8 Left 908703899 1:66930302-66930324 CCGGAGTCCCGTTGCTGAGTCTC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 908703904 1:66930317-66930339 TGAGTCTCACATCCGGGTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 68
908703899_908703908 18 Left 908703899 1:66930302-66930324 CCGGAGTCCCGTTGCTGAGTCTC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 908703908 1:66930343-66930365 TGACCCAGCTGCGGCCGCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908703899 Original CRISPR GAGACTCAGCAACGGGACTC CGG (reversed) Intronic
900882463 1:5391992-5392014 GAGACTCAGGAGCTGGACTCTGG - Intergenic
902168003 1:14588008-14588030 GAGACTCAGCCACAGGCCACAGG - Intergenic
902458745 1:16554963-16554985 GAGACTGAGCAAGGGGACCAGGG + Intergenic
902493412 1:16852953-16852975 GAGACTGAGCAAGGGGACCAGGG - Intronic
903151935 1:21415722-21415744 GAGACTGAGCAAGGGGACCAGGG + Intergenic
903549344 1:24146950-24146972 GAGACTGAGCCACTGCACTCTGG + Intergenic
908703899 1:66930302-66930324 GAGACTCAGCAACGGGACTCCGG - Intronic
913988441 1:143586187-143586209 GAGACTGAGCAAGGGGACCAGGG + Intergenic
914209530 1:145564725-145564747 GAGACTGAGCAAGGGGACCAGGG + Intergenic
914268447 1:146057093-146057115 GAGACTGAGCAAGGGGACCAGGG + Intergenic
914368645 1:147003771-147003793 GAGACTGAGCAAGGGGACCAGGG - Intergenic
914584289 1:149046419-149046441 GAGACTGAGCAAGGGGACCAGGG + Intronic
917502742 1:175600065-175600087 CAGACTCTGGAACTGGACTCGGG + Intronic
921166548 1:212512144-212512166 GAGGCTCACCAACGGGACACAGG - Intergenic
923956763 1:239031145-239031167 GAGAGTCAGCAAAGGGAGACAGG - Intergenic
924743723 1:246813491-246813513 GAGAATCAGCAAAGGGAGACAGG - Intergenic
1066791176 10:39065495-39065517 GAGAATCTGCAAAGGGACACTGG - Intergenic
1071187801 10:83063247-83063269 GAGAGTCAGCAAAGGGAGACAGG - Intergenic
1086504887 11:87494768-87494790 GAGAGTCAGCAAAGGGAGTTAGG + Intergenic
1086893720 11:92288481-92288503 GAGATGCAACAAGGGGACTCAGG - Intergenic
1088691553 11:112332916-112332938 GAGAGGCAGCAAAGGGACTCAGG + Intergenic
1089781626 11:120877092-120877114 GAGAGTCAGCAGCAGGACTCTGG - Intronic
1091007815 11:131969520-131969542 GAGACTGAGCAAGGGGAGGCAGG + Intronic
1093633485 12:21437676-21437698 GCGGCGGAGCAACGGGACTCTGG - Exonic
1094478206 12:30858845-30858867 GAGAATCAGCAAGAGGACTTTGG + Intergenic
1099523248 12:83689698-83689720 TGGACTCAGCAACTGGACTTGGG + Intergenic
1102509535 12:113404843-113404865 GAGACTCATGAAAGGGACCCTGG + Intronic
1105896052 13:24718314-24718336 GGGACACACCAACGGGCCTCAGG - Intergenic
1107394017 13:39996631-39996653 GGTTCTCAGCAATGGGACTCTGG - Intergenic
1112214071 13:97412006-97412028 GGGACTCAGGACCAGGACTCAGG - Intergenic
1114682650 14:24499302-24499324 CAGACCCAGCCACGGGCCTCAGG + Intergenic
1117457271 14:55911034-55911056 GAGCCTCAGCAAAGGCCCTCCGG - Intergenic
1120250875 14:82060998-82061020 GAGAATCAGCAAAGGGAGACAGG + Intergenic
1122352448 14:101103886-101103908 GAGACTGAGGCACGAGACTCAGG - Intergenic
1122724226 14:103739895-103739917 GGGCCTCAGCCACAGGACTCGGG + Exonic
1129190885 15:73937016-73937038 GAGCCTCAGAAAGGGGACTGGGG + Intronic
1135221849 16:20621078-20621100 GAGGCTCAGGAGCAGGACTCTGG + Intronic
1139301878 16:65952093-65952115 GTAAATCAGCAACTGGACTCTGG - Intergenic
1139687500 16:68615849-68615871 GAGAATCAGCTAAGGGACTTAGG + Intergenic
1142267238 16:89070338-89070360 GAGACTCAACAACTGGAATCTGG + Intergenic
1144097536 17:11915173-11915195 GAGATTTAGCAACATGACTCTGG - Intronic
1147141179 17:38461402-38461424 GAGCCACAGCAAGGGGAGTCAGG - Intronic
1149083491 17:52685911-52685933 AAAACTCAGCAACAGGAGTCTGG + Intergenic
1149814636 17:59711377-59711399 GAGACACAGCAAGGGCACTTGGG - Intronic
1151497224 17:74466215-74466237 GGGACTCAGGGAAGGGACTCAGG + Intergenic
1151583249 17:74992131-74992153 GAGACTCAGCAAAGGGAGAGGGG - Intronic
1156579281 18:38356385-38356407 GAGCCTCATCAACAGGACTATGG - Intergenic
1157072353 18:44422731-44422753 GAGACTGAGCAACTGTACACTGG + Intergenic
1158540431 18:58348645-58348667 GAGAGTCAGCTCCTGGACTCTGG + Intronic
1163838644 19:19592238-19592260 GGGTCTCAGCAAAGGGACTGTGG + Intronic
1167053393 19:47094099-47094121 GAGACTCAGCAACCTGCCACAGG + Intronic
1167290829 19:48624496-48624518 GAGACTCAGGCCCGGGACTGGGG + Intronic
1167516268 19:49924791-49924813 CAGACTTAGCAGCTGGACTCAGG - Intronic
1202708795 1_KI270714v1_random:5166-5188 GAGACTGAGCAAGGGGACCAGGG - Intergenic
930112203 2:47688228-47688250 GAGAGTCAGCAAAGGGACTTAGG - Intergenic
933447299 2:82398370-82398392 GAGAGTCAGCAAAGGGAGACAGG + Intergenic
934678332 2:96265602-96265624 GAGACTCCGGAATGGGACTGCGG + Intronic
935812825 2:106816931-106816953 GAGACTTTGCAATGGAACTCGGG + Intronic
936926126 2:117738642-117738664 GAGAGTCAGCATTGAGACTCAGG - Intergenic
940003929 2:148994302-148994324 GGCACTCAGAAAAGGGACTCAGG + Intronic
940182685 2:150953622-150953644 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
945554443 2:211262063-211262085 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
946396852 2:219447718-219447740 CAGACTCAGCCCCAGGACTCGGG - Intronic
949067139 2:241998979-241999001 CAGCCTCAGGAACAGGACTCGGG - Intergenic
1171251141 20:23648750-23648772 GAGACTCAGAAATGGGAGGCTGG - Intergenic
1172250988 20:33479047-33479069 GAGACTGAGAAAGGGGACTGCGG - Intergenic
1173869493 20:46332568-46332590 CAGAGGCAGCAGCGGGACTCAGG + Intergenic
1175578088 20:60077841-60077863 GTGCCTCAGCAATGTGACTCTGG + Intergenic
1175721648 20:61291150-61291172 GAGACTCAGAGACAGGACTTGGG - Intronic
1177218816 21:18164145-18164167 CAGACACAGCAACAGGACCCAGG + Intronic
1182035713 22:27196728-27196750 GAAACTCAGCTATGGGATTCTGG - Intergenic
1182732765 22:32508384-32508406 GAGAGTCAGCAAAGGGAGTAGGG - Intergenic
1183264356 22:36816435-36816457 GAGATTCAGCAACGGACCTGCGG - Intronic
1183971684 22:41482213-41482235 TAGACTCAGCAAAGGCACTTAGG + Intronic
950115036 3:10445326-10445348 GACACTCAGGAATGGAACTCAGG + Intronic
950418059 3:12879903-12879925 GAGGCTCAGCACCAGAACTCAGG + Intergenic
952161636 3:30699646-30699668 GAGACTTAGTAACAGGACTTGGG - Intergenic
953599697 3:44350123-44350145 GAGAGTCAGCAAAGGGAGTTAGG + Intronic
961136175 3:124513398-124513420 GTGACTCAGCATGGGGACACGGG + Intronic
961441221 3:126954471-126954493 GAGGCTCAGCCACATGACTCAGG + Intronic
961710278 3:128823223-128823245 GAGGCTCAGCGCCAGGACTCAGG - Intergenic
965458336 3:168931010-168931032 GAGAGTCAGCAAAGGGAGTTAGG + Intergenic
966055236 3:175678948-175678970 GAGAGTCAGCAAAGGGAGACAGG + Intronic
970905028 4:21205718-21205740 GAGACTCAGCAACTTGCCTGAGG + Intronic
980467564 4:133204799-133204821 GAGAATCTGCAACTGGACACTGG + Intronic
982753754 4:159194089-159194111 GAGCCTCAGCAAAGGGGCTGTGG + Intronic
986210373 5:5665888-5665910 GAGAGTCAGCAACCAGACCCTGG - Intergenic
986725040 5:10589112-10589134 GAGACTCAGCACAGGAACTCGGG - Intronic
988706714 5:33733767-33733789 GAGACTCATCAGCGAGACACGGG + Intronic
992961347 5:81959118-81959140 GAGACTCAGCAAAGGGAGATAGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994583753 5:101680029-101680051 ATGACTCAGCAACTGTACTCAGG - Intergenic
997608152 5:135191486-135191508 GAGACCCAGCCGCGGGCCTCAGG + Intronic
997907494 5:137833585-137833607 GTGACTCAGCATCTGGCCTCTGG - Intergenic
999231427 5:150064483-150064505 GAGAGTCTGAAACGGGACCCAGG + Intronic
1002442668 5:179272536-179272558 GAGACGCAGGCACTGGACTCAGG + Intronic
1003132857 6:3410597-3410619 TAGACTCAGCAACAGGAATTGGG - Intronic
1005930725 6:30481883-30481905 GAGACTCATCTAGGGGATTCCGG + Intergenic
1006021918 6:31122367-31122389 GAGACTCAGGAAAGGGAGCCTGG - Intronic
1014773028 6:125478441-125478463 CAGACTCTGCAACTGAACTCTGG - Intergenic
1016114456 6:140262765-140262787 GAGAGTCAGCAAAGGGACATAGG + Intergenic
1017943974 6:159078562-159078584 AAGACTCAGCAAGGTGACCCAGG + Intergenic
1018618107 6:165707212-165707234 GAGCCGCAGCAGCTGGACTCTGG - Intronic
1018795412 6:167181573-167181595 GACAGTCAGCACCGGGACTTTGG - Intronic
1018820911 6:167373490-167373512 GACAGTCAGCACCGGGACTTTGG + Intronic
1019324697 7:432363-432385 GAGGCTCAGCCTCGGGACACAGG + Intergenic
1019748169 7:2712329-2712351 GAGACTCTACACCTGGACTCAGG + Exonic
1021661139 7:22918810-22918832 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
1022229775 7:28403227-28403249 AAGACTCAAAAACTGGACTCAGG + Intronic
1022447954 7:30485165-30485187 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
1025187963 7:56875657-56875679 GATCCTCAGCAAGGGAACTCTGG + Intergenic
1025683959 7:63701267-63701289 GATCCTCAGCAAGGGAACTCTGG - Intergenic
1027850403 7:83444717-83444739 GAGACTGAGCCACTGCACTCTGG - Intronic
1029379549 7:100204094-100204116 GAGGCTCAGCAGCAGGATTCGGG - Exonic
1029883219 7:103838560-103838582 GAGACTCAATAGCGTGACTCAGG + Intronic
1030446032 7:109647259-109647281 GAGAGTCAGCAAAGGGAGACAGG + Intergenic
1036157038 8:6352057-6352079 CAGAATCAGCAATGGAACTCAGG - Intergenic
1036550230 8:9809179-9809201 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
1039009049 8:33073270-33073292 GAGAGTCAGAAACAGGAGTCTGG + Intergenic
1044587139 8:93878450-93878472 GAGAGTCAGCAAAGGGAGTTAGG + Intronic
1048097085 8:131308521-131308543 GAGAGTCAGCAATGGGAGTTAGG - Intergenic
1048425887 8:134323172-134323194 GAGATCCAGCATCAGGACTCAGG + Intergenic
1049316113 8:141969278-141969300 GAGACACGGCAAGGGGCCTCTGG - Intergenic
1056672407 9:88641830-88641852 GAGACACAGCAAGAGGACCCAGG - Intergenic
1058592200 9:106576743-106576765 GAGACTCAGGAATTTGACTCAGG - Intergenic
1060026233 9:120174358-120174380 CAGACTCAGCACCGGGACCTTGG + Intergenic
1062427663 9:136513313-136513335 GAGACACAGGATCGGGACCCAGG - Intronic
1185457482 X:318208-318230 GAGATTCAGGGGCGGGACTCGGG - Intronic
1197153955 X:123249778-123249800 GTGACTCAGACAAGGGACTCAGG - Intronic
1197793763 X:130280075-130280097 GAGAGTCAGCAAAGGGAGTTAGG - Intergenic
1201640177 Y:16169694-16169716 GTGATTCAGCAACAGGACTGAGG - Intergenic
1201662637 Y:16415631-16415653 GTGATTCAGCAACAGGACTGAGG + Intergenic
1201725155 Y:17142603-17142625 GAGAGTCAGCAAAGGGATTTAGG + Intergenic