ID: 908711446

View in Genome Browser
Species Human (GRCh38)
Location 1:67019996-67020018
Sequence CTGAGGTCTGGCTGTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908711446_908711451 9 Left 908711446 1:67019996-67020018 CCTACAAAACAGCCAGACCTCAG 0: 1
1: 0
2: 1
3: 14
4: 222
Right 908711451 1:67020028-67020050 GAACACAGCAGTTCTCATTAGGG No data
908711446_908711455 23 Left 908711446 1:67019996-67020018 CCTACAAAACAGCCAGACCTCAG 0: 1
1: 0
2: 1
3: 14
4: 222
Right 908711455 1:67020042-67020064 TCATTAGGGGTTAAAGGGACAGG No data
908711446_908711450 8 Left 908711446 1:67019996-67020018 CCTACAAAACAGCCAGACCTCAG 0: 1
1: 0
2: 1
3: 14
4: 222
Right 908711450 1:67020027-67020049 AGAACACAGCAGTTCTCATTAGG No data
908711446_908711453 17 Left 908711446 1:67019996-67020018 CCTACAAAACAGCCAGACCTCAG 0: 1
1: 0
2: 1
3: 14
4: 222
Right 908711453 1:67020036-67020058 CAGTTCTCATTAGGGGTTAAAGG 0: 1
1: 0
2: 1
3: 9
4: 87
908711446_908711454 18 Left 908711446 1:67019996-67020018 CCTACAAAACAGCCAGACCTCAG 0: 1
1: 0
2: 1
3: 14
4: 222
Right 908711454 1:67020037-67020059 AGTTCTCATTAGGGGTTAAAGGG No data
908711446_908711452 10 Left 908711446 1:67019996-67020018 CCTACAAAACAGCCAGACCTCAG 0: 1
1: 0
2: 1
3: 14
4: 222
Right 908711452 1:67020029-67020051 AACACAGCAGTTCTCATTAGGGG 0: 1
1: 0
2: 3
3: 17
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908711446 Original CRISPR CTGAGGTCTGGCTGTTTTGT AGG (reversed) Intronic
900679813 1:3910596-3910618 CTGAGGGCTGCATGTTTTGAGGG + Intergenic
901917010 1:12507652-12507674 TAGAGGGCTGGCTGTCTTGTGGG + Intronic
902825349 1:18969603-18969625 CTGAAGTCAGGCAGTTTTGGGGG + Intergenic
906254881 1:44340802-44340824 CTGAGTTTTGGCTGTATTTTTGG - Intronic
907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG + Intronic
907410378 1:54279414-54279436 CTCAGGTCTGCCTGATCTGTGGG - Intronic
908711446 1:67019996-67020018 CTGAGGTCTGGCTGTTTTGTAGG - Intronic
910124681 1:83827430-83827452 CTGAGGTTTTGCTGATTTGGGGG + Intergenic
916484307 1:165244423-165244445 GTGGGGTCTGGCAGTCTTGTGGG + Intronic
916512333 1:165483301-165483323 CTGAGGTCAGGTTGTGATGTAGG - Intergenic
918230344 1:182524583-182524605 CTGAGGTTTGGTAGTTTTCTTGG - Intronic
918617514 1:186563074-186563096 CTGAGTTTTTGTTGTTTTGTTGG + Intergenic
920613024 1:207460398-207460420 CTAAGGTCTGGCTGTGTTTTGGG + Intronic
921024666 1:211266612-211266634 CTAAGGCATGGTTGTTTTGTTGG + Intronic
921407139 1:214792566-214792588 CTTGGGTTTGGCTTTTTTGTTGG + Intergenic
922689719 1:227678576-227678598 CTGATGTCTGGTGGTATTGTGGG + Intergenic
923104379 1:230843263-230843285 CTGTGGCCTGCCTGCTTTGTGGG + Intronic
924266862 1:242291360-242291382 GTGAGGGCAGGATGTTTTGTTGG + Intronic
924743717 1:246813472-246813494 CAGGGGTGGGGCTGTTTTGTAGG - Intergenic
1063363665 10:5476877-5476899 ATGGGGTGGGGCTGTTTTGTAGG - Intergenic
1063522736 10:6755834-6755856 CCGAGGGCTGGCTGTTCTTTAGG - Intergenic
1063963270 10:11324937-11324959 ATGAGGGCTGGCTGTTTCTTGGG - Intronic
1066717958 10:38307143-38307165 GTGAGGGCAGGATGTTTTGTTGG - Intergenic
1069654135 10:70075371-70075393 TTGAGGTCAGGCTGCTTTGGTGG + Intronic
1069923385 10:71831352-71831374 CTGAGGGCTGGCTGTTTTCCAGG - Intronic
1074697336 10:116061663-116061685 CTGAGGTTTGGGTGTCTTGCAGG - Intronic
1076329508 10:129654207-129654229 CTGAGGTCTTGCCGTCTTCTCGG - Intronic
1076875401 10:133213323-133213345 CTGAGGGCTGGCTGTGGTGGCGG - Intronic
1077033860 11:484394-484416 CTGAGGCCTGGGTGTTGGGTGGG + Intronic
1078590761 11:12638793-12638815 CTGATGTCTGAGTGTTGTGTAGG + Intergenic
1078619546 11:12894314-12894336 CTGAGGACTAGCAGATTTGTAGG + Intronic
1079485864 11:20935462-20935484 TGGAGGTGTGGATGTTTTGTAGG + Intronic
1083873169 11:65504354-65504376 TTCAGGTCTGTCTGTTCTGTTGG + Intergenic
1084902408 11:72319475-72319497 CTGAGGTTTGGCTCTTCTTTTGG + Intronic
1085894922 11:80627600-80627622 CTGAGGTCTGGCACTTTTCAGGG - Intergenic
1085940511 11:81201187-81201209 CTGATGTCTGGTGGTATTGTGGG + Intergenic
1086003150 11:82003668-82003690 CAGAGGTCTAGCTGTCATGTGGG - Intergenic
1086630671 11:89015381-89015403 CTGTTGGCTGGCTGTTTTATTGG + Intronic
1088889775 11:114035457-114035479 CTGATGTCTGACTGTGGTGTGGG - Intergenic
1092625733 12:10326362-10326384 CTGAGGTGAGGCTGTGTTATGGG - Intergenic
1093017242 12:14166924-14166946 CTGATGTGTGGCTGGGTTGTGGG - Intergenic
1096596313 12:52697972-52697994 CTGAGGTCTGGATGTGTTGAGGG - Intronic
1097750555 12:63347801-63347823 CTGAGCTCTGGCTCTTAGGTAGG - Intergenic
1098232776 12:68389964-68389986 CTGAGGTCTTGCTGTGTCCTTGG - Intergenic
1100219459 12:92488831-92488853 ATGAGGTCTTTCTGTTTTCTAGG + Intergenic
1103077997 12:118000333-118000355 CTGGGTTCTGGCTGTTATCTGGG + Intergenic
1103740116 12:123085360-123085382 TTGAGGTTTGTCTGTGTTGTAGG - Intronic
1103911485 12:124354778-124354800 CTGGGCTCTGGCTGTCCTGTGGG - Intronic
1105424577 13:20283589-20283611 CAGAGGTCTAGCTATTGTGTGGG + Intergenic
1107183673 13:37492320-37492342 CTGAGATCAGGCTGATTTTTAGG + Intergenic
1107294367 13:38894141-38894163 CTGAGGTCTGGGGTTTATGTGGG - Intergenic
1107599476 13:41998691-41998713 CTGAGGTCTGGTTTTCTTGTTGG - Intergenic
1107615114 13:42158722-42158744 ATGATGCCTGGCTGTCTTGTTGG + Intronic
1110198940 13:72825534-72825556 CAGAGGACTGACTGTTTGGTGGG + Intronic
1110404471 13:75134360-75134382 CTGAATTCAGGCTGTTTGGTTGG - Intergenic
1112131758 13:96532430-96532452 TTGAGGTCTGGGGGTTTTATCGG + Intronic
1112501619 13:99947379-99947401 GAGGGGTCTGGCTGTTGTGTGGG - Intergenic
1112501794 13:99948579-99948601 GTGAGGACAGGCTATTTTGTTGG - Intergenic
1113480451 13:110616150-110616172 CTGCGGGCTTGCTGTTTGGTCGG + Intronic
1114393872 14:22339048-22339070 CTGGCTTCTGGGTGTTTTGTTGG - Intergenic
1116750772 14:48880853-48880875 CTTAGCTCTTGCTGTTTTTTAGG - Intergenic
1117405356 14:55396850-55396872 CTGAGGTTTGTTTTTTTTGTGGG - Intronic
1119621838 14:76137311-76137333 GTCAGGTCTGACTGTTGTGTGGG + Intergenic
1122066840 14:99179739-99179761 CTGAGGGCTGGGTGATTTTTAGG - Intronic
1123120487 14:105914083-105914105 CTGAGGTCTGGCTGACCTATGGG + Intergenic
1124266341 15:28238005-28238027 CTGATATCTGGGTCTTTTGTGGG - Intronic
1124311855 15:28633382-28633404 CTGATATCTGGGTCTTTTGTGGG + Intergenic
1124824954 15:33084440-33084462 CTGAGGTGTGGCAGTTTTGTGGG + Intronic
1125562975 15:40652887-40652909 CAGAGGCCCAGCTGTTTTGTTGG + Intronic
1126639211 15:50807641-50807663 CTGAGGTCTGGTTTTGTTGATGG + Intergenic
1127102372 15:55580238-55580260 CTGAGGTTTCACCGTTTTGTTGG - Intronic
1127700881 15:61499343-61499365 TTGAGGTCTGGCTAGCTTGTGGG - Intergenic
1128361459 15:66964686-66964708 CTGGGGTCTGTCTGCTCTGTGGG - Intergenic
1129799119 15:78400247-78400269 ATGGGGTCTCGCTGTGTTGTGGG - Intergenic
1130322114 15:82850163-82850185 CTGCGTTCTGCCTGCTTTGTTGG - Intronic
1133072557 16:3256255-3256277 CTGAGTGCTGGCTGCTTTGTGGG - Intronic
1134408623 16:13984409-13984431 CAGAGGTTTGTCTGTTTTATTGG + Intergenic
1136486899 16:30578980-30579002 ATGAGGTCTTGCTGTTTTCCAGG + Intronic
1138054166 16:53814981-53815003 CTGAGGCTTTGCTGTTCTGTAGG - Intronic
1138366996 16:56488313-56488335 CTGAAGTCAGGCAGTCTTGTGGG - Intronic
1139348239 16:66318344-66318366 CTGAGGTCCAGCTGTATTCTTGG + Intergenic
1141547950 16:84784865-84784887 CTGAGGGGTGCCTGTGTTGTTGG + Intergenic
1141728934 16:85809100-85809122 CTGAGGTCTGACTGAGGTGTGGG + Intergenic
1142770557 17:2093808-2093830 ATGAGGTCTTGCTATATTGTTGG + Intronic
1145998763 17:29119093-29119115 CTGGGGCCTGGCTGTATTGGAGG - Intronic
1150943255 17:69716462-69716484 CTGTGTTCTAGCTGTTTAGTTGG + Intergenic
1151965553 17:77429437-77429459 CTGAGGGCTGATTGTGTTGTGGG + Intronic
1152181253 17:78823061-78823083 CTGAGGTGTGCATGTTCTGTGGG - Intronic
1155346137 18:24859315-24859337 CTGAAGACTGTATGTTTTGTGGG + Intergenic
1157731693 18:50009812-50009834 TTCAGGCCTGGCTGTCTTGTTGG - Intronic
1160507221 18:79433996-79434018 CTGTGGTGTGGATGTTTTGGGGG + Intronic
1161264721 19:3358964-3358986 CTGAGGTCTGGGTGTCTTTCTGG + Intergenic
1162574328 19:11490044-11490066 CTGAAGTCCGGCGGTCTTGTGGG - Intronic
1163213128 19:15856593-15856615 CTGAGGGGTGGCTGAATTGTTGG - Intergenic
1163541112 19:17911179-17911201 CTCAAGGCGGGCTGTTTTGTGGG - Intergenic
1166654545 19:44600862-44600884 CTGAAGTCTGGGTGTCTTATAGG - Intergenic
1167268856 19:48497342-48497364 CTGAGGTCCGGCTGTTTCCGAGG - Intronic
925147507 2:1591080-1591102 CTGAATTCTGCCTGTTGTGTTGG + Intergenic
925370184 2:3339409-3339431 CTGAGGCCTGGGTGATGTGTAGG - Intronic
925706223 2:6686508-6686530 CAGAGGTCTAGCTGTCATGTGGG - Intergenic
927172995 2:20386316-20386338 TTGATGTCTGTCTGTCTTGTGGG - Intergenic
927927825 2:27025608-27025630 CAGAGGTCTGCATGTTTTTTGGG - Exonic
930868941 2:56150420-56150442 CTTAGGTCTGGCTTTGTTCTGGG + Intergenic
931308515 2:61056143-61056165 CTGGGGGCTCTCTGTTTTGTTGG + Intergenic
931976887 2:67653064-67653086 CTGAGGTCTGACTGATGAGTTGG - Intergenic
932278936 2:70472877-70472899 ATGACGTCTGGCTTTTTAGTAGG + Intronic
932588026 2:73044439-73044461 CTGAGGCCTGGCTGTTCTAGTGG + Intronic
933181842 2:79235896-79235918 CTGCTGTCTGGATGTTTTCTGGG + Intronic
933243802 2:79952661-79952683 CTGAGGACTGGCAGTTTTTGTGG + Intronic
935621977 2:105138110-105138132 CTGAGTTCTGGCAGAGTTGTGGG - Intergenic
938564974 2:132510414-132510436 CTGAGGGCAGGCTGCTTTCTGGG - Intronic
943953116 2:194156109-194156131 CTGATGTCTGGTGGTATTGTGGG - Intergenic
944265015 2:197714364-197714386 CTGAAGTGTAGCTATTTTGTTGG + Intronic
944720463 2:202418268-202418290 CTGAGTTCTGGCTATTATATTGG - Intronic
944869061 2:203891834-203891856 CTGAGGTCTTGCTCTCTTCTAGG + Intergenic
945165125 2:206935200-206935222 CTGGGATCTGGCTGGTGTGTTGG + Intergenic
947475462 2:230443836-230443858 TTGATGAGTGGCTGTTTTGTTGG - Intronic
949018621 2:241727841-241727863 CTGAGGTCTCGCTGCTTTTTGGG + Exonic
1169223204 20:3839075-3839097 CTGATGTCTGTCTGTTCTGAAGG + Intergenic
1170028963 20:11924076-11924098 CTGAGGTTTATCTGTTTTGGGGG - Exonic
1170069501 20:12350125-12350147 CTGAGGTCAGACTGTTCTGAAGG - Intergenic
1171384543 20:24761389-24761411 CAGAGGTGTGGGTGTTGTGTAGG + Intergenic
1173437569 20:43046606-43046628 CTGAGGTCGGGCTGTGGTGGGGG + Intronic
1175262543 20:57683907-57683929 CTGTGGGCTGTCTGTTTTGGGGG + Intronic
1176172257 20:63701329-63701351 CTGAGTTCTAGCTGTTCTCTTGG - Intronic
1179180504 21:39040848-39040870 CTGAAGTCTGGCTGTGATCTTGG - Intergenic
1180048873 21:45322290-45322312 CTGAGGTCTGGCCGCCTTGTTGG - Intergenic
1181491280 22:23262348-23262370 CTGAGGTGTGGCTTTCCTGTAGG + Intronic
1182234666 22:28865900-28865922 CTGTGGTATCCCTGTTTTGTAGG - Intergenic
1185111110 22:48900863-48900885 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111120 22:48900897-48900919 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111138 22:48900965-48900987 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111148 22:48900999-48901021 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111165 22:48901067-48901089 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111180 22:48901137-48901159 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111189 22:48901171-48901193 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
1185111198 22:48901205-48901227 CTCAGGGCTGGGTGTTTTGGGGG - Intergenic
949500010 3:4670806-4670828 AAGAGGTGTGGCTGTTTTGGAGG + Exonic
950407043 3:12811171-12811193 CTGAGGGCTGGCTGCTGTTTGGG - Intronic
951847789 3:27103314-27103336 CTGAGGTTTGTCTGTTTGCTTGG + Intergenic
952310006 3:32180105-32180127 ATCAGGTCTGGCTGTTCAGTGGG - Intergenic
953080048 3:39608463-39608485 CTGACATCTGGGTGTTTTCTGGG + Intergenic
953211603 3:40880146-40880168 CTGAGGTATGCCTGTATTGAAGG - Intergenic
953584394 3:44186677-44186699 CTGAGGTCTGGCTGCTTCTCAGG - Intergenic
954146820 3:48638693-48638715 TTGGGGTCTGGCTGTTTGGGAGG - Intronic
955502618 3:59599957-59599979 CTGAGGCCTGGCTGCATTCTTGG + Intergenic
955992185 3:64640394-64640416 CTCAGGTCTGGCTGATTGTTCGG - Intronic
960585814 3:119320649-119320671 GTGAGGACTTGCTGGTTTGTGGG - Intronic
961147774 3:124609669-124609691 ATGAGGGCTGGCTGTCTTGCAGG + Intronic
962223368 3:133583494-133583516 CTGGGGTCTTGCTCTTATGTGGG + Intronic
962607575 3:137045258-137045280 CTGGAGTCTTGCTGTTTTGTGGG + Intergenic
962630919 3:137274654-137274676 TTGAGGTCTTGCTTTTTTGGTGG - Intergenic
963860735 3:150307813-150307835 CTGGTTTCTGGCTGTTTTGGTGG + Intergenic
964009642 3:151876147-151876169 CTGAGCTCTTGTTATTTTGTGGG - Intronic
964550098 3:157876066-157876088 CTTCCGTCTGGCTGTTGTGTGGG - Intergenic
965125621 3:164625868-164625890 CTGAGGTCTAGTTTTCTTGTTGG + Intergenic
965582471 3:170283817-170283839 CTGATGTATGGCTGCTTTGGTGG - Intronic
967922462 3:194623367-194623389 CTGAGCTTTGGCTGTTTCTTGGG - Intronic
968561282 4:1284170-1284192 TTGAGCACTGACTGTTTTGTTGG - Intergenic
970177691 4:13355782-13355804 GTGAGGTCTGGCTGTATTCAAGG - Intergenic
971005454 4:22369831-22369853 CTGAGTTCTGGGGATTTTGTAGG - Intronic
972748275 4:41962788-41962810 ATGAGGTCTTGCTGTTTTCCAGG - Intergenic
973578444 4:52316207-52316229 CTGAGCTCTGGCATGTTTGTAGG - Intergenic
973712161 4:53640963-53640985 CTGAGGCCTGGCCGTTGTTTGGG + Intronic
974360549 4:60872842-60872864 CTGTGGTCTGGGTGATTTGTTGG + Intergenic
974728880 4:65835390-65835412 CTGAGCTCTGGCTGACCTGTAGG - Intergenic
975667257 4:76744429-76744451 CTAAGGTCTGGCTGCTGTGCAGG - Intronic
979677952 4:123430189-123430211 CTGAGTTCTGGCTGTTTAAGAGG - Intergenic
981172931 4:141645813-141645835 CTCAGTTCTGGCTGTTGTCTGGG + Intronic
981656540 4:147118320-147118342 CTGGGGTATGGCTGTTTAGGAGG + Intergenic
983221702 4:165049998-165050020 CTGAGGGCTGACTGTATTTTTGG + Intergenic
984426026 4:179586642-179586664 CTGAGAGCTGGCTGTTTTAAAGG - Intergenic
984832153 4:183985949-183985971 TTTAAGTCTGGCTGTGTTGTTGG - Intronic
984920813 4:184762722-184762744 CTCAGCTCTGGCCGATTTGTAGG + Intronic
986345181 5:6828008-6828030 CAGAGGTCTGGCTCTCCTGTGGG - Intergenic
986471671 5:8082430-8082452 CTGAAATCTGGCTGTTTTCCTGG + Intergenic
987222927 5:15808961-15808983 CTGGGGTTTGGATGGTTTGTTGG - Intronic
990092106 5:52064412-52064434 CTGGGGTATGTCTGTTTTGTGGG + Intronic
992445811 5:76832476-76832498 CTGTGGCCTGGCTGTTTAGGAGG + Intronic
993541836 5:89161332-89161354 CTAAGAACTTGCTGTTTTGTAGG - Intergenic
994564927 5:101431554-101431576 CTCAGGTCTTGCATTTTTGTGGG - Intergenic
997530158 5:134577055-134577077 CTGAGATCTGTCTCCTTTGTGGG - Intronic
999327274 5:150651007-150651029 CTGAGGCCTGGCTCTGTTTTAGG + Exonic
1000848340 5:166309373-166309395 CTGTGGCCTGGCTGATTTCTAGG - Intergenic
1001050733 5:168412018-168412040 CAGATGTCTTGCTGTTTTGCTGG - Intronic
1002956009 6:1865587-1865609 CTGAGGTCTCCTTGTTTGGTAGG - Intronic
1003052180 6:2790013-2790035 CTCAGGTTTGGCTGTTATGAGGG - Intergenic
1003117430 6:3292662-3292684 CTGAGGTCTGGGTGCTGTGAGGG + Intronic
1007857059 6:44868701-44868723 CTTAGCTCTGCCTGTTTTCTTGG + Intronic
1008248206 6:49204996-49205018 CTGAGGTCTGACAGTGTTTTTGG + Intergenic
1009754314 6:67916456-67916478 CTTAGGGCTGGTTGTTTTGCTGG + Intergenic
1010520927 6:76835755-76835777 CTGAAGTATGACTGTTTTCTTGG + Intergenic
1015127368 6:129769660-129769682 CTAAGGTGGGGCTGTTTTATAGG + Intergenic
1018556775 6:165058910-165058932 CAGAGGTCTGGGGGTATTGTGGG - Intergenic
1019740806 7:2672078-2672100 ATGAGGTCTCGCTGTTTCCTAGG + Intergenic
1020761257 7:12270011-12270033 CTGAGGTCTGGGGCTTTTATGGG - Intergenic
1021787501 7:24165923-24165945 ATGAGATCTGGTTGTTTGGTAGG + Intergenic
1023882168 7:44326614-44326636 CTCAGGGAAGGCTGTTTTGTGGG - Intronic
1024524528 7:50336876-50336898 CTGTGGTCCTGCTGTTTTGTTGG - Intronic
1028872318 7:95782981-95783003 CTGAGGTTTGGGGTTTTTGTGGG + Intronic
1030493816 7:110272129-110272151 CTGGGATGTGGCTATTTTGTTGG + Intergenic
1031940344 7:127782242-127782264 TTGAGGTCTGGTTGTTTTCCAGG + Intronic
1035436514 7:158863804-158863826 CTTAGCTCTGGGTGTTTGGTGGG + Intronic
1036467844 8:9018221-9018243 CTTAGGTCTGGGTATTTTGTAGG + Intronic
1037394851 8:18430896-18430918 CTGAGGTCTAACTATTTTTTTGG + Intergenic
1042689097 8:71477046-71477068 CTTAGGTCTTGATGTGTTGTAGG - Intronic
1042705812 8:71664892-71664914 ATGGGGTGTGGCTGTTTTATAGG - Intergenic
1043983255 8:86664852-86664874 CTGTGGTTTGGCTGTATTGATGG + Intronic
1046312273 8:112453353-112453375 CAGAGTTCTTGGTGTTTTGTAGG - Intronic
1046772616 8:118131337-118131359 CTGAGGTCTAGTTGCTTTTTAGG + Intergenic
1047507277 8:125489746-125489768 CGGAGGGCTGTCTGTTTTCTTGG - Intergenic
1048311287 8:133324264-133324286 CTGAGGTCTCTCTGGCTTGTAGG + Intergenic
1048342664 8:133552777-133552799 CTGAGGTCTGGCTGCTTCGCTGG + Intronic
1048687313 8:136918918-136918940 AGGAGGTCTAGCTGTTATGTTGG - Intergenic
1048799847 8:138185560-138185582 CTGTGGGCAGCCTGTTTTGTTGG - Intronic
1049234832 8:141507304-141507326 CTAGGGTCTGTCTGTGTTGTGGG + Intergenic
1051195465 9:14558894-14558916 CTGAAGTCTGGCTGCTTGTTTGG + Intergenic
1052189921 9:25648260-25648282 CAGAGGTCTGACTGTTTTTAAGG - Intergenic
1053076721 9:35140032-35140054 CAGAGGTCTAGCTGTTGCGTGGG + Intergenic
1055410611 9:76025353-76025375 ATGAGGTCTTGCTGTTTTCCAGG - Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056330058 9:85513689-85513711 CTTATGTCTGGCTGTATTATGGG + Intergenic
1056591657 9:87969787-87969809 CTCAAGTCTGGCCGGTTTGTAGG - Exonic
1057310406 9:93939367-93939389 CTGAGGCCTGGGATTTTTGTGGG - Intergenic
1059811939 9:117864851-117864873 CTGAGGTCTGGCAGCTCAGTTGG - Intergenic
1061291671 9:129653881-129653903 CTGAGATCTGGGTGATTTGATGG + Intergenic
1062067191 9:134534961-134534983 CTGAGCTGTGTCCGTTTTGTTGG - Intergenic
1062199663 9:135295379-135295401 CTGATGTCTGGTGGTATTGTGGG + Intergenic
1062672664 9:137720724-137720746 CTGAGGCCTTGGTGTTCTGTGGG + Intronic
1062681376 9:137783636-137783658 TGCAGGCCTGGCTGTTTTGTTGG + Intronic
1185650313 X:1642710-1642732 CTGAGGTCTGGCTGTCCTTATGG + Intronic
1186667427 X:11732164-11732186 CTCAGCTCTGGCTGTTTTGCAGG + Intergenic
1187999380 X:24965572-24965594 CTGAGGTCAGGCAGTTTTACTGG - Intronic
1188766025 X:34092180-34092202 TTGATTTCTGGTTGTTTTGTTGG - Intergenic
1189099011 X:38170117-38170139 CTGTGGTCTGGCTAATTTGAAGG - Intronic
1196613508 X:117741416-117741438 CTGTTGTCTGGCCTTTTTGTTGG - Intergenic
1197667517 X:129239826-129239848 CAGAAGTCTGGCTCATTTGTTGG - Intergenic
1197892535 X:131280922-131280944 CTGAGGGCAGGATGGTTTGTGGG + Intronic