ID: 908712708

View in Genome Browser
Species Human (GRCh38)
Location 1:67034985-67035007
Sequence TAGGGATGCAAGGATGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908712708_908712712 -6 Left 908712708 1:67034985-67035007 CCTGAACCATCCTTGCATCCCTA 0: 1
1: 0
2: 1
3: 13
4: 175
Right 908712712 1:67035002-67035024 TCCCTAGGATAAATCCCACTTGG 0: 15
1: 188
2: 588
3: 1092
4: 1704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908712708 Original CRISPR TAGGGATGCAAGGATGGTTC AGG (reversed) Intronic
900832666 1:4976419-4976441 AAGAGATGCAGGCATGGTTCGGG + Intergenic
901346081 1:8544173-8544195 CAGGAATGCAAGGTTGGTTCAGG - Intronic
901951520 1:12752281-12752303 CTGGAATGCAAGAATGGTTCAGG + Intronic
903063603 1:20686171-20686193 GAGGGAGTAAAGGATGGTTCTGG - Intronic
903785743 1:25860079-25860101 TAGGGACGGAAGGATGGGTGGGG - Intergenic
905946249 1:41903824-41903846 TAGGGATGCAAAGATGCTGATGG - Intronic
907821437 1:57973825-57973847 TAGGGAGGCAAGAATGGTGATGG - Intronic
908443964 1:64183720-64183742 GAGGGATCCAAGGGAGGTTCTGG + Intergenic
908712708 1:67034985-67035007 TAGGGATGCAAGGATGGTTCAGG - Intronic
909824222 1:80105890-80105912 CAGGGATGCCAGCATGGTTGGGG + Intergenic
911057543 1:93721378-93721400 AAGGGATGCCAGGATTCTTCTGG - Intronic
911862582 1:102971708-102971730 TAAGGGAGCAAAGATGGTTCTGG - Intronic
912189700 1:107323609-107323631 TAGAGATAAAAGGATTGTTCAGG - Intronic
915080075 1:153345912-153345934 TTGGGATGGAAGGCTGGTGCTGG - Intronic
916993746 1:170273668-170273690 TAGGGATGAAAGAATGATGCAGG - Intergenic
917100064 1:171436144-171436166 TTGGGATGCAAAGAGGGTACAGG - Intergenic
920335297 1:205241298-205241320 TCGGAATGAAAGGATGGGTCTGG + Intronic
923213147 1:231824522-231824544 TAGTGATGCAAGGATGTAACTGG - Intronic
923613075 1:235512401-235512423 AAAGGAGGCCAGGATGGTTCTGG - Intergenic
924212096 1:241780410-241780432 TAGGTTTGCAAGGAAGGTTATGG - Intronic
1064517779 10:16169233-16169255 TAGGGATGCAATGTTGTTTATGG + Intergenic
1068303320 10:55174712-55174734 TAGGGAGGACAGGATGGATCAGG - Intronic
1072742279 10:97916583-97916605 TGGGGCTGGAAGGATGGTTGAGG - Intronic
1072998861 10:100270569-100270591 TAGGGATGGGGGGATGGTTTGGG - Intergenic
1073094965 10:100973660-100973682 CAGGGATGCCAGGATTGTTGGGG + Intronic
1073223521 10:101896406-101896428 TAGGGCTACAAGGAGGGTTAGGG + Intronic
1074154215 10:110784188-110784210 TAGGGCTGCTAGGAAGGTTTGGG + Intronic
1077033745 11:483631-483653 CAGGAATGTAAGGTTGGTTCAGG - Intronic
1077238059 11:1492710-1492732 CAGGGATCCAAGGAAGCTTCTGG + Intronic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1079972661 11:27055904-27055926 TAGAGATACAAGGCTTGTTCTGG + Intronic
1080949256 11:37009881-37009903 TAGTGATGGAAGAATGTTTCTGG + Intergenic
1084335871 11:68457630-68457652 TAGGGATGCAAGGGTCGGTGGGG + Intergenic
1084680967 11:70666128-70666150 TAGGAATCCAGGGATTGTTCTGG - Intronic
1085057160 11:73411731-73411753 CAGGGCTGCATGGATGATTCTGG + Intronic
1085599639 11:77843709-77843731 TTAGGATGCCAGCATGGTTCTGG + Intronic
1087223425 11:95571080-95571102 TATGCATGCACGGATGGTTTGGG - Intergenic
1087381475 11:97409378-97409400 TAGGTATTCATGGGTGGTTCTGG - Intergenic
1088933623 11:114377403-114377425 TAGGGATGGATGGATGCTCCAGG + Intergenic
1089297324 11:117477998-117478020 TAGGAATGCCAGGATGGGTGGGG - Intronic
1095716904 12:45356027-45356049 TAGGAATGAAGAGATGGTTCAGG - Intronic
1097185656 12:57195016-57195038 TGGAGATGCAGCGATGGTTCTGG - Exonic
1098360310 12:69648128-69648150 TAGAGATGCAAGGACACTTCTGG + Intronic
1098776883 12:74631608-74631630 CTAGGATGCAAGGCTGGTTCAGG + Intergenic
1100889034 12:99103123-99103145 GAGGGAAGCAAGGATGGGTGAGG + Intronic
1109865715 13:68260678-68260700 CAGGGATGCAAGGATGGAAAAGG + Intergenic
1111503632 13:89158358-89158380 CAGGGATCCAAGGATCCTTCAGG - Intergenic
1113889745 13:113729826-113729848 TCGGGATGGAAGGACGGGTCTGG - Intronic
1113889770 13:113729912-113729934 TTGGGATGGAGGGATGGGTCTGG - Intronic
1115458476 14:33632903-33632925 TAGGGATGGAATGATGATTTGGG - Intronic
1117950625 14:61079732-61079754 TAGGGATGGGAGGCAGGTTCTGG - Intronic
1118385427 14:65252038-65252060 TAGGGGTGGAGGGATGGTTTCGG - Intergenic
1120273091 14:82339203-82339225 GGGTGATGCAAAGATGGTTCAGG + Intergenic
1121233299 14:92374151-92374173 TAGAGATCGAAGCATGGTTCTGG + Intronic
1121925773 14:97926061-97926083 CAGGGTTGCAAGGATGAGTCAGG - Exonic
1122309071 14:100783293-100783315 CAGGGAACCACGGATGGTTCAGG + Intergenic
1122640458 14:103156338-103156360 AAGCGATCCAAGGATTGTTCTGG + Intergenic
1124014566 15:25864126-25864148 TGGGGAGGCGAGGATGGTTGTGG + Intronic
1124885015 15:33677242-33677264 TAGGGAAGCATGGATGTTTAGGG + Intronic
1126670430 15:51110798-51110820 AAGGGATGGGAGGATGGTTGTGG - Intergenic
1128349342 15:66878433-66878455 TGGGGATGCAAGGAAGGCACTGG + Intergenic
1131320857 15:91389383-91389405 CAGGGATGCAAGAGTGGTTCAGG - Intergenic
1135876561 16:26206011-26206033 TAAGGATGCAAGGAAGTTACAGG + Intergenic
1137589849 16:49686892-49686914 TGGGGATGCGAGGCTGGTGCAGG - Intronic
1143563051 17:7706352-7706374 AAGGGAAGGAAGGAGGGTTCAGG - Intronic
1144036160 17:11367771-11367793 TAAGGAGGCAAGGAAGGCTCAGG + Intronic
1147212429 17:38879692-38879714 TAAGGAAGCAAGGAAGGTTTGGG - Intronic
1147412326 17:40262620-40262642 GTGGGAGCCAAGGATGGTTCAGG + Exonic
1147860819 17:43521921-43521943 TAGGGCTGGAAGGAAGGTCCTGG + Intronic
1149026192 17:52030196-52030218 TAGAAATGCATGAATGGTTCTGG + Intronic
1153115222 18:1646638-1646660 TAGGAATGCAAAGGTGATTCAGG - Intergenic
1153534936 18:6091371-6091393 TTGGAATGCAAGGATGGCTTTGG + Intronic
1154298239 18:13169657-13169679 CAGGGATGCAGGGATGGTTTAGG + Intergenic
1155605909 18:27605975-27605997 GATTGATTCAAGGATGGTTCTGG - Intergenic
1157749103 18:50162273-50162295 GAGGGAGGGAGGGATGGTTCAGG - Intronic
1158769722 18:60500187-60500209 CAGGGATGCTAGGTTGGATCAGG + Intergenic
1159013270 18:63079801-63079823 CTAGAATGCAAGGATGGTTCAGG - Intergenic
1159095936 18:63901777-63901799 TGGGGATACCAGGATGGTCCTGG + Exonic
1159550471 18:69890384-69890406 TGGGGTTTCAAGGATGGTCCTGG - Intronic
1159851783 18:73534036-73534058 TAAGAATGCAAGGAAGGTTTTGG - Intergenic
1162269751 19:9604554-9604576 CAGGAATGTAAGGTTGGTTCTGG + Intergenic
1162524068 19:11197440-11197462 TAGGGGTTCAAGTCTGGTTCGGG - Intronic
1162895751 19:13764023-13764045 GATGGATGCAAGGCTGTTTCTGG - Intergenic
1163505035 19:17700563-17700585 TAGGGGAGCAAGGATGGCTGGGG + Intergenic
1163593335 19:18206305-18206327 TAGGGATGCAGGGAAGCCTCTGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167421568 19:49407082-49407104 TAGGGATGCCTGGGTGGTCCTGG - Intronic
1167686321 19:50958982-50959004 CAGTGATGCAAGGATGGAGCTGG + Exonic
1168445498 19:56408772-56408794 TAGGAAGGCAATGAAGGTTCTGG - Intronic
1168668225 19:58220526-58220548 CAGGAATGCAAGAATGCTTCAGG + Intergenic
927414612 2:22865832-22865854 TGGGGGTGCAGGGATGGTGCAGG + Intergenic
929044127 2:37773982-37774004 TAGGGATGCAAGGCCTGGTCAGG - Intergenic
929727424 2:44445276-44445298 CAGGGATGCAAGGATGGAAGAGG + Intronic
931215691 2:60242108-60242130 AGGGGATAAAAGGATGGTTCTGG - Intergenic
933199701 2:79434974-79434996 TAGGGATGAAAGAATGGTTATGG - Intronic
937034514 2:118769748-118769770 TAGGAATGGAAGGAAGGTTGGGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938946831 2:136220070-136220092 TAGAGAGGGAAGGAAGGTTCTGG + Intergenic
940089537 2:149900089-149900111 TAGGGATGTCATGATGATTCAGG + Intergenic
940681240 2:156787700-156787722 TAGAGGTGCCAGGATGGTTCAGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942520963 2:176803537-176803559 TAGAGATGCAATCAGGGTTCTGG - Intergenic
944402909 2:199348835-199348857 TGGGGATGGGTGGATGGTTCAGG + Exonic
946297259 2:218794952-218794974 CAGGGATGCAAGGATGGAAGAGG - Intronic
948087672 2:235265139-235265161 TAGGGGGACAAGGATGGTTTTGG - Intergenic
948792828 2:240388163-240388185 GAGGGAGGCCAGGATGGGTCAGG - Intergenic
949068924 2:242011706-242011728 TGTGGATGCAAGGTTGGTACGGG + Intergenic
1170874240 20:20235513-20235535 TGGGGATGGGAGGATGGTGCAGG - Intronic
1176296148 21:5074456-5074478 TAGAAATGCAAAGATGGTTCAGG + Intergenic
1177319239 21:19498905-19498927 TAGGGATGGAGGGATGGTTTGGG - Intergenic
1178001757 21:28167640-28167662 TAGAGATGCAAGGATTGTGGAGG + Intergenic
1179046156 21:37847101-37847123 TCGGTATGCAAGTATGGTTTGGG + Intronic
1179860901 21:44187665-44187687 TAGAAATGCAAAGATGGTTCAGG - Intergenic
1181431109 22:22882428-22882450 TGAGGAAGCAATGATGGTTCTGG - Intronic
1181658940 22:24326413-24326435 TCTGGAGGCAAGGATGGCTCTGG - Intronic
1184303451 22:43577832-43577854 TAGGGAAGCAAGGTGGGCTCCGG - Intronic
949103524 3:175534-175556 TATGTATGCAAGTATAGTTCTGG + Intergenic
949674703 3:6440253-6440275 GAGGGATGCCTAGATGGTTCAGG + Intergenic
950588942 3:13921415-13921437 GGGGGATGCAGGGATGGTTTGGG + Intergenic
951307919 3:21088122-21088144 CAGGGATGCAAGAATGGTTCAGG + Intergenic
951944210 3:28115672-28115694 TAGGATTGGAAGGATGGTTTTGG - Intergenic
953203727 3:40801282-40801304 CAGGTATGCAAGTAGGGTTCAGG + Intergenic
954279529 3:49566481-49566503 TAGTGATGAAAAGATGGATCAGG + Intronic
955513894 3:59707793-59707815 CGGGGAGGCAAGGCTGGTTCAGG - Intergenic
955676564 3:61454918-61454940 GAGGGATGCCAGGAAGGTTTTGG + Intergenic
957211520 3:77265136-77265158 TAGGGATGTAAGGATGAATCAGG - Intronic
957614964 3:82515518-82515540 TGGGGATGAAAGGATGACTCTGG + Intergenic
957702075 3:83727352-83727374 TAGGGATGACAGGATGGACCAGG - Intergenic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
960570154 3:119177919-119177941 TAGGGAAGGAAGGATAATTCTGG + Intronic
961007112 3:123412467-123412489 CAGGGCTGCAGGGATGGTTTGGG + Intronic
961054302 3:123774936-123774958 TGGGGATGCAAAGAAGGTTAAGG + Intronic
968807779 4:2786772-2786794 TAGGGCTGCCAGCATGGTTTAGG + Intergenic
968938731 4:3626996-3627018 AAGAGATGGAAGGAGGGTTCAGG + Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
970963049 4:21895942-21895964 TAGGGATGTCTGGATGGTTCAGG - Intronic
977936341 4:102810248-102810270 TTGGGGAGGAAGGATGGTTCAGG - Intronic
981255904 4:142660252-142660274 TGGGGATGCAAGGATGGAAGAGG + Intronic
984085832 4:175310240-175310262 TAGGGAAGCTAGGATGTCTCTGG - Intergenic
986213720 5:5698618-5698640 CAGGGATGCAAGGATGGAAGAGG + Intergenic
986909987 5:12544100-12544122 GAGGGATGTGAGGAAGGTTCAGG + Intergenic
994405312 5:99338477-99338499 CTGGAATGAAAGGATGGTTCAGG + Intergenic
995363871 5:111331920-111331942 TGGGAATATAAGGATGGTTCTGG - Intronic
995830011 5:116344872-116344894 TGGGGATGCAAGGATGGAAGAGG - Intronic
996397152 5:123024832-123024854 AAGGGAGACAAGGATGGTCCAGG + Intronic
1003963116 6:11227831-11227853 TAGGGATTATAGGATGGTCCAGG + Intronic
1005831755 6:29676706-29676728 GAAGGATGCCAGGATGGTGCGGG + Intronic
1009907913 6:69891584-69891606 TGGGGATGCAAGGATGGAAGAGG - Intronic
1010772371 6:79846011-79846033 AAGGGAAGGAAGGATGGATCTGG + Intergenic
1011653338 6:89527012-89527034 TATGTGTGCAAGGATGTTTCTGG - Intronic
1014920046 6:127203238-127203260 TAGGCTTGCAAGGATGTTTATGG - Intergenic
1015858991 6:137656075-137656097 TGGGGATGCAAGGATGGAGGAGG + Intergenic
1015990633 6:138938280-138938302 TAGGCATGCAAACATGGTTGGGG - Intronic
1020677206 7:11196779-11196801 CAGGGATGCAAGGATGGAAGAGG + Intergenic
1021285519 7:18776818-18776840 TGGGGAAGCAAGGAAAGTTCAGG + Intronic
1021477614 7:21080378-21080400 TAGGGATGGAAAGAATGTTCTGG - Intergenic
1021514291 7:21465893-21465915 TAGGGTTGGAAGGATAGATCAGG - Intronic
1023541698 7:41273077-41273099 TTGGGCTGGAAGGATTGTTCAGG + Intergenic
1028051676 7:86195593-86195615 TAGGGATGCATGGGTGGTTTGGG - Intergenic
1028423340 7:90658297-90658319 TCAGGATGCCAGCATGGTTCTGG + Intronic
1029221749 7:98995671-98995693 TGGGGGTGCAAGGATGGAACAGG - Intronic
1029221805 7:98995945-98995967 TGGGGATGCGAGGATGGGACGGG - Intronic
1029420529 7:100469617-100469639 CAGGGGTGCAAGGGTGGGTCGGG - Intronic
1029828147 7:103223034-103223056 TAGGAATCCAAAGATGTTTCTGG - Intergenic
1029902095 7:104052295-104052317 TAGGGCTGCTAGGTGGGTTCCGG - Intergenic
1031417303 7:121509434-121509456 TAGGGCTGCTATGATGGTTTGGG - Intergenic
1037568075 8:20134557-20134579 AAGGGATGGAAGGAGGCTTCTGG + Intergenic
1038275405 8:26116970-26116992 TAGGGATGTCCGGAAGGTTCTGG - Intergenic
1038671872 8:29589415-29589437 TCGGGATGCAGGGCTGGTTGTGG - Intergenic
1040007162 8:42630250-42630272 GAGGTAGGCAAGGTTGGTTCTGG + Intergenic
1040064933 8:43138108-43138130 TGGGGATGCAAGGATGGAAGAGG + Intergenic
1044825805 8:96195697-96195719 CAGGGAGCCAAAGATGGTTCAGG - Intergenic
1045431695 8:102121035-102121057 TAGGAATCCAAGGCTGGGTCTGG - Intronic
1045500546 8:102741160-102741182 AAGGGATGAAAGGATGTTTCTGG - Intergenic
1047051392 8:121117203-121117225 GAGGGATGCAAAGATAGTCCAGG - Intergenic
1048752492 8:137696021-137696043 GAGGGAGGCAAGGAGGTTTCTGG - Intergenic
1050508694 9:6372144-6372166 CAGGGATGCAAGGATGGAAGAGG - Intergenic
1054452011 9:65408339-65408361 AAGAGATGGAAGGAGGGTTCAGG - Intergenic
1054978609 9:71177341-71177363 TAGGGGGGCAGGGATGGTTTTGG - Intronic
1061709167 9:132475880-132475902 TAGGGAGCCAGGGATGGTTGTGG - Intronic
1062389728 9:136329180-136329202 GGGGGATGCAAGGCTGGGTCTGG - Intronic
1187756470 X:22532718-22532740 TGGGGCTGCATGGAAGGTTCTGG - Intergenic
1190491083 X:50983270-50983292 CAGGGATGCAAGGATGGAAGAGG + Intergenic
1191874511 X:65781710-65781732 TAGGAATGCAAGTATGATTTAGG - Intergenic
1195977719 X:110545591-110545613 TAAGGATGCAGTGATGGTCCAGG + Intergenic
1197671177 X:129279766-129279788 CAAGGATGCAGGGATGGTTTAGG - Intergenic
1200929856 Y:8687158-8687180 AAGGAATGCAAGGATGGAGCTGG + Intergenic