ID: 908715723

View in Genome Browser
Species Human (GRCh38)
Location 1:67067659-67067681
Sequence GCACCAGCCTTGGCTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908715714_908715723 27 Left 908715714 1:67067609-67067631 CCTACTGTGTACAGCCTTGGGAT No data
Right 908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG No data
908715717_908715723 -2 Left 908715717 1:67067638-67067660 CCCTGCATCCCAAATGCTTCCGC No data
Right 908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG No data
908715716_908715723 13 Left 908715716 1:67067623-67067645 CCTTGGGATATGGTGCCCTGCAT No data
Right 908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG No data
908715718_908715723 -3 Left 908715718 1:67067639-67067661 CCTGCATCCCAAATGCTTCCGCA No data
Right 908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG No data
908715713_908715723 28 Left 908715713 1:67067608-67067630 CCCTACTGTGTACAGCCTTGGGA No data
Right 908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG No data
908715719_908715723 -10 Left 908715719 1:67067646-67067668 CCCAAATGCTTCCGCACCAGCCT No data
Right 908715723 1:67067659-67067681 GCACCAGCCTTGGCTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908715723 Original CRISPR GCACCAGCCTTGGCTAAAAG AGG Intergenic
No off target data available for this crispr