ID: 908717432

View in Genome Browser
Species Human (GRCh38)
Location 1:67085252-67085274
Sequence TGTTTTGCTTAGGACCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908717432_908717434 8 Left 908717432 1:67085252-67085274 CCTCTGAGGTCCTAAGCAAAACA No data
Right 908717434 1:67085283-67085305 ATAAAAAGAGCAAGATAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908717432 Original CRISPR TGTTTTGCTTAGGACCTCAG AGG (reversed) Intergenic
No off target data available for this crispr