ID: 908717659

View in Genome Browser
Species Human (GRCh38)
Location 1:67087517-67087539
Sequence CAGCAAACAGAAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
908717659_908717668 23 Left 908717659 1:67087517-67087539 CCGTCCACCACTTCTGTTTGCTG No data
Right 908717668 1:67087563-67087585 TCCACCCCTCCAGATCTGGCAGG 0: 10
1: 44
2: 86
3: 145
4: 272
908717659_908717670 24 Left 908717659 1:67087517-67087539 CCGTCCACCACTTCTGTTTGCTG No data
Right 908717670 1:67087564-67087586 CCACCCCTCCAGATCTGGCAGGG 0: 10
1: 42
2: 98
3: 150
4: 311
908717659_908717667 19 Left 908717659 1:67087517-67087539 CCGTCCACCACTTCTGTTTGCTG No data
Right 908717667 1:67087559-67087581 GATTTCCACCCCTCCAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908717659 Original CRISPR CAGCAAACAGAAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr