ID: 908719544

View in Genome Browser
Species Human (GRCh38)
Location 1:67109606-67109628
Sequence ATGAGCATGAATCAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908719544 Original CRISPR ATGAGCATGAATCAAACTGC TGG Intronic
902911771 1:19603806-19603828 ATGAGAATGAATCAGAGGGCTGG + Intronic
904937215 1:34140177-34140199 ATGAGAATGATTTAGACTGCGGG + Intronic
908719544 1:67109606-67109628 ATGAGCATGAATCAAACTGCTGG + Intronic
909588397 1:77317548-77317570 ATGAGCAAGAAACAAAATGAAGG - Intronic
909789147 1:79651905-79651927 ATGAGAGTGAATCAAACAGTGGG + Intergenic
910543133 1:88383792-88383814 ATGTGCATGACTCAGACTTCTGG + Intergenic
915150117 1:153824024-153824046 ATAAGAATGAACAAAACTGCTGG - Intronic
919576867 1:199321145-199321167 AAAAACATGAATGAAACTGCAGG + Intergenic
920018209 1:202930852-202930874 AGCAACATGAATCAAACTGAAGG - Intergenic
920765917 1:208833473-208833495 CTGAGCATGAAACAAAAAGCAGG - Intergenic
922961768 1:229653013-229653035 ATGAGCATGCATTAAATTGGTGG + Intronic
923986104 1:239384437-239384459 CTGAGAATGAACCAAACTGGAGG - Intergenic
924357542 1:243197853-243197875 ATGGGCATGAAGAAAACTGCTGG + Intronic
1063151485 10:3340704-3340726 AATAGCATAAATCAAACTGAAGG + Intergenic
1063833217 10:9980836-9980858 ATGATTATGAATAAAGCTGCTGG - Intergenic
1068389591 10:56377365-56377387 ATGTGTATGAACCAAACTCCAGG - Intergenic
1069370828 10:67746369-67746391 ATGCACATGAATGAAACTGAGGG + Intergenic
1070319151 10:75342015-75342037 ATCAGCTAGAATCAAACTCCAGG + Intergenic
1072797530 10:98367338-98367360 ATGAGAAAGACTCAACCTGCGGG - Intergenic
1073380044 10:103071399-103071421 AAGAGCCTGACTCAAACCGCTGG - Intronic
1074024311 10:109617911-109617933 CTAAGCATGAATCAAAGTGCTGG + Intergenic
1074641639 10:115390621-115390643 ATGAGCAAGAATAAAACTGAAGG - Intronic
1076247977 10:128962259-128962281 ATGAGCCTGAGTCAAGGTGCGGG + Intergenic
1076263128 10:129087397-129087419 ATGATCAAGAATTCAACTGCTGG - Intergenic
1079192912 11:18296551-18296573 TTGATCATGCATCAAAATGCTGG - Intronic
1079357426 11:19741589-19741611 ATCAACATGGATGAAACTGCAGG - Intronic
1079905420 11:26240514-26240536 ATGAGGATGAAACACATTGCTGG - Intergenic
1082958807 11:58899736-58899758 ATGAAGATGAATCTAAATGCTGG - Intronic
1085439227 11:76543218-76543240 ATGATGATGAATCTAACTGTAGG + Intronic
1085517074 11:77117926-77117948 ATGAGGCTGAATCTAACAGCAGG - Intronic
1086055228 11:82638852-82638874 ATAAGCATGAATCAAAGTTTAGG - Intergenic
1086596405 11:88576921-88576943 ATGAGTCTGACTAAAACTGCAGG - Intronic
1088427581 11:109721525-109721547 ATGAGCAAAATCCAAACTGCAGG - Intergenic
1091707780 12:2711062-2711084 CTGACCATGAACCAAACTGCTGG + Intergenic
1095558816 12:43540718-43540740 TTTATCATGAATCAAATTGCAGG - Intronic
1101201305 12:102439220-102439242 TTGAGCATGAAAAAAAATGCAGG - Intronic
1104823701 12:131693611-131693633 AGGAGCAGGAAGCAAACTGGAGG + Intergenic
1105677541 13:22688767-22688789 AAGAACAAAAATCAAACTGCAGG + Intergenic
1110178171 13:72582941-72582963 ATGAGTAAGGATCCAACTGCAGG - Intergenic
1111005320 13:82240173-82240195 ATGAGAGTGAAAAAAACTGCTGG + Intergenic
1113372724 13:109737754-109737776 CTGAGCATGAAGCAAAATGCAGG + Intergenic
1113593498 13:111516400-111516422 ATGAGCATCACTGAAAGTGCCGG - Intergenic
1114641502 14:24225213-24225235 ATCAGCAAAATTCAAACTGCAGG + Intronic
1114954663 14:27803174-27803196 ATCAGCATGAAACAACATGCTGG - Intergenic
1117237529 14:53794384-53794406 CAGAGCAGGAATCAAACTGATGG + Intergenic
1118289946 14:64510551-64510573 ATCGGCATGAGTAAAACTGCAGG + Intronic
1125445302 15:39748031-39748053 ATGAGCATAATTAAGACTGCAGG - Intronic
1127159965 15:56172059-56172081 ATGAGAATGTACCAAACTGGGGG + Intronic
1130009474 15:80138696-80138718 AAGAGTATAATTCAAACTGCAGG + Intergenic
1130024659 15:80260805-80260827 AAGGGCATGAATCAGCCTGCAGG - Intergenic
1130559691 15:84948178-84948200 ATGAGCTTGAATTAAATTGAGGG - Intergenic
1130728831 15:86468454-86468476 ATTAGCCTGAATCAAAATGAGGG - Intronic
1131210110 15:90487690-90487712 GTGAGCATGAATGTAACTGGGGG + Intronic
1134629025 16:15743619-15743641 AAGTGCATGAAGCAAGCTGCTGG - Intronic
1138868932 16:60857204-60857226 ATGTGCAAGAAGGAAACTGCAGG + Intergenic
1139120908 16:64015310-64015332 ATGAGAGTGAAGCAAACAGCAGG + Intergenic
1143705416 17:8694518-8694540 AGGAGCATGAATCAGAAAGCTGG - Intergenic
1144657030 17:17043188-17043210 AAAAGCATGAATCACACAGCCGG - Intronic
1147437654 17:40427403-40427425 AAGAGGATGCAGCAAACTGCTGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148651355 17:49252350-49252372 AGGAGCATCAGTGAAACTGCTGG - Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1203173123 17_GL000205v2_random:169801-169823 ATGAGCAAGAACCAAACTCTTGG + Intergenic
1157785323 18:50476708-50476730 ATGGGAATGAATCAAACCTCTGG - Intergenic
1157933734 18:51851664-51851686 ATGAGCATGAGTCAAACACCAGG - Intergenic
1158153386 18:54397986-54398008 ATGAGTATGAATCAAAATCATGG - Intergenic
1161287873 19:3478181-3478203 ATAAGCATGAATCAGACTTGGGG + Intronic
1161569355 19:5022077-5022099 TTGAGCTTGGATCAAACTGTTGG + Intronic
1164636021 19:29792107-29792129 TTTAGCATGACCCAAACTGCAGG + Intergenic
1164736430 19:30544710-30544732 ATGTGTGTGAATCAAACTGAAGG + Intronic
1166875155 19:45892421-45892443 ATGAGCATGAATGAGACCCCAGG - Intronic
1168362924 19:55757753-55757775 ATGAGCATGAATGCAATTCCAGG + Intergenic
1168363880 19:55767753-55767775 ATGAGCATGAATGCAATTCCAGG + Intergenic
1168481645 19:56724957-56724979 ATGGACAGGAATCTAACTGCAGG - Intergenic
925235981 2:2277510-2277532 ATGAGCATGTATGTAACTGTGGG - Intronic
925827902 2:7868337-7868359 ATGAGTATGAACCCAACTACAGG - Intergenic
927289163 2:21388116-21388138 ATGAGAAGGAATAAAACTTCAGG + Intergenic
928686256 2:33752971-33752993 ATGAGCAAGAAGAAAACTGAGGG + Intergenic
931411510 2:62036839-62036861 ATGAGCAGTAATCAAAAAGCAGG - Intronic
932206311 2:69886324-69886346 AAAAACATGAATCAAACTGGAGG - Intergenic
934482655 2:94666116-94666138 ATCAGCATGAAACAACATGCTGG + Intergenic
937790648 2:125957627-125957649 ATGGGCATGATTCCAAATGCTGG + Intergenic
938198298 2:129352259-129352281 ATGAGCAAGAATAAAATTGGAGG + Intergenic
940835257 2:158514151-158514173 GGGAGCATGAAACAAACTGAGGG - Intronic
941395495 2:164968463-164968485 ATGTGTATGAACCATACTGCAGG - Intergenic
946973372 2:225120442-225120464 ATTAGCATGACTCAAACTTTTGG + Intergenic
948286661 2:236791426-236791448 ATGATCATAAATCAAAGTGAAGG - Intergenic
948312551 2:236999620-236999642 GTGAGCATGAATCAGGCCGCGGG - Intergenic
1170194588 20:13676937-13676959 ATGAACATAAATAACACTGCAGG + Intergenic
1171153620 20:22850720-22850742 ATGAGCAAGAATGAAGCTGAAGG + Intergenic
1172910384 20:38404751-38404773 ATGAATATGAATCAAAGGGCTGG + Intergenic
1174261725 20:49300907-49300929 CTTAGCATGAATCAAAGTGGTGG - Intergenic
1175102237 20:56587537-56587559 ATGAGCATGAAGCAAGGGGCAGG - Intergenic
1176329106 21:5531443-5531465 ATGAGCAAGAACCAAACTCTTGG + Intergenic
1176398651 21:6289508-6289530 ATGAGCAAGAACCAAACTCTTGG - Intergenic
1176438506 21:6699596-6699618 ATGAGCAAGAACCAAACTCTTGG + Intergenic
1176462768 21:7026666-7026688 ATGAGCAAGAACCAAACTCTTGG + Intergenic
1176486329 21:7408444-7408466 ATGAGCAAGAACCAAACTCTTGG + Intergenic
1177261128 21:18731962-18731984 AACAGCATGAATGGAACTGCAGG - Intergenic
1177575244 21:22946145-22946167 AAGAGTGTGAATGAAACTGCAGG + Intergenic
1178047346 21:28710271-28710293 ATAATAATGAATTAAACTGCTGG + Intergenic
1178816009 21:35930034-35930056 GTGTGCATGGATCAAAGTGCTGG - Intronic
1178869415 21:36360430-36360452 ATAAGCATGAAATAAACAGCAGG - Intronic
1180063389 21:45399556-45399578 ATGAGCATGTACCAAACAACAGG - Intergenic
1182458196 22:30465983-30466005 ATGAGCACAAATAAAACAGCTGG + Intronic
1182478102 22:30587771-30587793 ATCAGCATGAAACAAGCTGTGGG + Intronic
1182954635 22:34410784-34410806 ATAAGCAATAACCAAACTGCTGG - Intergenic
1183402737 22:37614137-37614159 AAGAGCAGGAATCCCACTGCCGG + Intronic
1184344645 22:43905585-43905607 ATGAGCATGACACAAAATCCAGG + Intergenic
949271058 3:2217147-2217169 AGGAGCATCAATCAAAGTCCCGG - Intronic
952045065 3:29309117-29309139 ATGCCCATGAATCAAAGTACTGG - Intronic
954574284 3:51666926-51666948 AGGAGCAGGAAGCAAAGTGCTGG + Exonic
957720548 3:83992214-83992236 AAAAGCATGAATGAAACTGGAGG - Intergenic
959384938 3:105692386-105692408 ATGAGTAGGAAATAAACTGCAGG + Intronic
960728534 3:120697527-120697549 ATGACCATGACTGAAATTGCTGG + Intronic
965274177 3:166659447-166659469 AACAGCATGAATGAAACTGGGGG + Intergenic
965398922 3:168194765-168194787 ATGAGCAGGACTGAAACTGGTGG - Intergenic
966804451 3:183795759-183795781 ATGAGCATGCATAAAAATACGGG + Intronic
966907949 3:184541371-184541393 GTGAGGAGGAATCAAGCTGCTGG + Intronic
971047782 4:22824907-22824929 AGCAGCATTAATCAAACTGCAGG - Intergenic
972977325 4:44652392-44652414 ATCAGCATGAAGCAAACCACAGG - Intronic
974317437 4:60300088-60300110 AGGAGCATGCATCAAAATTCAGG - Intergenic
975236510 4:72003345-72003367 AAGAGAAGGAATCACACTGCAGG + Intergenic
979244267 4:118481627-118481649 ATGGGCATGAAGAAAACTGCTGG - Intergenic
979405105 4:120300137-120300159 ATGATCATTAATCAAAGTGCTGG - Intergenic
984951580 4:185011664-185011686 ATGGGCAGGAGTCAAGCTGCAGG - Intergenic
985376083 4:189340052-189340074 AAGAGCGAGAATCAAACTGGAGG + Intergenic
989488526 5:42021855-42021877 AAAAGCATGAATCAAATAGCAGG + Intergenic
990231325 5:53716059-53716081 CTGAGCAGGCACCAAACTGCAGG + Intergenic
993139108 5:84007975-84007997 ATTAGCATGGATAAAACTGGAGG + Intronic
993379033 5:87184702-87184724 ATCAGAATGAAGCAAACTGGTGG - Intergenic
995220620 5:109643567-109643589 ATGAGGATCAATCAATCTGCAGG - Intergenic
997550574 5:134748687-134748709 AGGAGCATGAAAGAAACTCCTGG - Intronic
998605859 5:143633900-143633922 ATGAGCATGTGTCACACTTCTGG + Intergenic
999374557 5:151077755-151077777 ATGAGCATGCATCACAATCCTGG - Intronic
999875040 5:155795366-155795388 ATGAGTATAAATCAAATTGATGG + Intergenic
1000470536 5:161634677-161634699 ATGAGCTTGAATTAATTTGCTGG + Intronic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1012722429 6:102762694-102762716 ATGAGGAACAATAAAACTGCAGG + Intergenic
1015213518 6:130723395-130723417 ATACTCATGCATCAAACTGCTGG + Intergenic
1015280845 6:131432436-131432458 AGGAGCATGAATAAAACTCATGG - Intergenic
1017031385 6:150226071-150226093 ATGAATATGAATCAAAATGGGGG - Intronic
1017388176 6:153909482-153909504 ATGACCAGGAATCCCACTGCGGG + Intergenic
1017442897 6:154480240-154480262 ATGAGCATTAATGAAACAGCAGG - Intronic
1017587350 6:155941616-155941638 ATGAGCATTAAAAAATCTGCAGG - Intergenic
1022485595 7:30775183-30775205 ATGAGCGTGACTTAACCTGCAGG - Intronic
1022496443 7:30855871-30855893 AAAAACATGAATTAAACTGCAGG - Intronic
1023734274 7:43220970-43220992 ATGATCATGACTCCTACTGCTGG + Intronic
1024429106 7:49264953-49264975 ACGAGCAAGAATCAAACTCACGG + Intergenic
1026204960 7:68248897-68248919 AAGAGCATGCAGCAAAATGCAGG - Intergenic
1029716038 7:102326620-102326642 ATGAGCATGAATGATACTTTGGG + Intergenic
1030455703 7:109771669-109771691 ATGAGCAAGTATCAGACAGCAGG - Intergenic
1034324731 7:150220288-150220310 CTGGACATGAATCAAACCGCAGG - Intergenic
1034768460 7:153748943-153748965 CTGGACATGAATCAAACCGCAGG + Intergenic
1035666421 8:1383769-1383791 AGAAGCATGAATTAAACTCCTGG + Intergenic
1036421296 8:8598423-8598445 ATTTGCATGAATGAAACTGGAGG - Intergenic
1036734460 8:11298672-11298694 ATTAGCATAATTCAAACTGCAGG - Intronic
1036974355 8:13394318-13394340 ATAAGCATAAAGCAAAGTGCTGG + Intronic
1037288224 8:17323406-17323428 ATGAACAGGAACCAAACTGAAGG + Intronic
1037423244 8:18726565-18726587 ATGAGCATGAATTAAAGTCATGG - Intronic
1041621786 8:59978738-59978760 AAGACCAAGAATCAGACTGCAGG + Intergenic
1042068839 8:64908089-64908111 AACAACATGAATGAAACTGCAGG + Intergenic
1043067214 8:75590084-75590106 ATCAGCATGAATGAAGCTGGAGG - Intergenic
1043659593 8:82721166-82721188 ATGAGTCTGATTCAAACTGGTGG + Intergenic
1043671558 8:82891781-82891803 AGGAGCATGAAAAAAACTCCAGG + Intergenic
1044328922 8:90893454-90893476 ATGATCATGAATCAATCACCCGG + Intronic
1044463788 8:92480163-92480185 ATGATCATGTAACTAACTGCTGG + Intergenic
1045829806 8:106445433-106445455 ATGAGCAGTTCTCAAACTGCAGG - Intronic
1046457335 8:114484048-114484070 AAGAGCATTAAACAAACTACAGG - Intergenic
1050910254 9:11059309-11059331 ATGAGGATGAGTCAAAGTTCAGG - Intergenic
1052251209 9:26399381-26399403 ATGGGCATGAAGGATACTGCAGG + Intergenic
1052861457 9:33440311-33440333 ATGAGCGTGAACGCAACTGCGGG + Intergenic
1053187687 9:36032354-36032376 ATCAGAGTGAATCAAATTGCTGG + Intergenic
1053415776 9:37945977-37945999 ATGGACTTCAATCAAACTGCAGG + Intronic
1053675186 9:40418610-40418632 ATCAGCATGAAACAACATGCTGG - Intergenic
1053924972 9:43044951-43044973 ATCAGCATGAAACAACATGCTGG - Intergenic
1054288463 9:63257142-63257164 ATCAGCATGAAACAACATGCTGG - Intergenic
1054386285 9:64558679-64558701 ATCAGCATGAAACAACATGCTGG - Intergenic
1054509434 9:65957683-65957705 ATCAGCATGAAACAACATGCTGG + Intergenic
1054997169 9:71405484-71405506 ATGTGTATGAATCAAATTTCAGG - Intronic
1056621795 9:88221038-88221060 ATGAGAATAAAGCAAACGGCAGG - Intergenic
1057240446 9:93403621-93403643 ATCAGCAAGAATCAAAATGGAGG + Intergenic
1059000151 9:110340296-110340318 ATAAGCATGAATAAAATTTCTGG - Intergenic
1059625320 9:116058485-116058507 ATGTTTATGAATCAAACTCCAGG - Intergenic
1061026356 9:128052192-128052214 GTGAGCATGAATCAGCCTTCCGG - Intergenic
1061987642 9:134139082-134139104 ACGAGCAGGACTCACACTGCAGG - Intronic
1203432989 Un_GL000195v1:108879-108901 ATGAGCAAGAACCAAACTCTTGG - Intergenic
1185929880 X:4190452-4190474 AACAGCATGAATGAAACTGGAGG + Intergenic
1188083790 X:25878533-25878555 ATGAGCATGATGCAAACCACTGG + Intergenic
1188664028 X:32796314-32796336 ACCAACATGAATGAAACTGCAGG + Intronic
1193586023 X:83322556-83322578 AGGAACATGAATGAAACTGGAGG + Intergenic
1194032065 X:88829573-88829595 ATGAGTATGTATTAAACTGATGG - Intergenic
1194036797 X:88884976-88884998 AGCAGCATGGATCAAACTGAAGG - Intergenic
1197350466 X:125375940-125375962 TTGAACATGATTCAAACAGCTGG - Intergenic
1199426648 X:147709600-147709622 ATGAGAATGAACCAGACTTCTGG - Intergenic
1199512447 X:148637857-148637879 AGGAGCATAAAATAAACTGCAGG - Intronic
1200686611 Y:6264757-6264779 ATGCGCATTCATCCAACTGCAGG - Intergenic
1200992159 Y:9356006-9356028 ATGCGCATTCATCCAACTGCAGG - Intergenic
1200994809 Y:9376284-9376306 ATGCGCATTCATCCAACTGCAGG - Intronic
1200997473 Y:9396630-9396652 ATGCGCATTCATCCAACTGCAGG - Intergenic
1200999985 Y:9465166-9465188 ATGCGCATTCATCCAACTGCAGG - Intergenic
1201002646 Y:9485476-9485498 ATGCGCATTCATCCAACTGCAGG - Intronic
1201005301 Y:9505760-9505782 ATGCGCATTCATCCAACTGCAGG - Intergenic
1201007964 Y:9526089-9526111 ATGCGCATTCATCCAACTGCAGG - Intergenic
1201958610 Y:19652798-19652820 AACAACATGAATGAAACTGCCGG - Intergenic