ID: 908725366

View in Genome Browser
Species Human (GRCh38)
Location 1:67170339-67170361
Sequence GATTAGGAACAGAGGACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908725366 Original CRISPR GATTAGGAACAGAGGACTGT AGG (reversed) Intronic
901568846 1:10142750-10142772 GATAAGGAGCAGAGGAACGTAGG - Intronic
901674186 1:10873290-10873312 GAATAGGAACAGGGGAACGTTGG + Intergenic
903041473 1:20533767-20533789 GAGTAGGAACAAGGGAGTGTGGG + Intergenic
906002227 1:42436502-42436524 CATTTGGAACAGAGGACATTAGG - Exonic
908231228 1:62106978-62107000 GATTAGAAACAGAGGTCTATGGG - Intronic
908725366 1:67170339-67170361 GATTAGGAACAGAGGACTGTAGG - Intronic
909834158 1:80232386-80232408 GAGTTGGAGCAGGGGACTGTTGG - Intergenic
910852729 1:91664681-91664703 GATTAAGGACTGAGGACTGGTGG - Intergenic
911973123 1:104461990-104462012 GATTAAGAACTGAGGACTGGTGG - Intergenic
912643315 1:111368420-111368442 TATTAGGAAGAGTGGAGTGTAGG + Intergenic
913204407 1:116523456-116523478 TATTAGGAACACAGGTGTGTTGG + Intronic
913363591 1:118010415-118010437 GTTTAAGATCAGATGACTGTAGG - Intronic
914364236 1:146963944-146963966 CATGACGAATAGAGGACTGTGGG + Intronic
914365005 1:146970234-146970256 CATGACGAATAGAGGACTGTGGG + Intronic
915541716 1:156571614-156571636 AGTTATGAACTGAGGACTGTGGG + Intronic
917563575 1:176186635-176186657 GATTTGGAAAAGAGGAGTGATGG + Intronic
920494261 1:206443131-206443153 GGTTAGGAACAGAGGCTTTTTGG - Intronic
920581088 1:207108691-207108713 AATTAGGCCCAGAGGTCTGTGGG + Intronic
922680522 1:227591612-227591634 GATTAAGAACTGAAGACTGGTGG - Intronic
922694044 1:227718456-227718478 GATTAAGAACTGAAGACTGGTGG + Intergenic
924276064 1:242388481-242388503 AAGTAGGAACAGAAGACTGAAGG + Intronic
924858836 1:247900555-247900577 GATTAAGGACTGAGGACTGGTGG - Intergenic
1067720925 10:48727221-48727243 AATTAGGGACAGAGGGCTGAGGG + Intronic
1067734056 10:48835399-48835421 GATCAGGCAGAGAGGACAGTTGG + Intronic
1068671567 10:59728708-59728730 GATTAAGGACTGAGGACTGGTGG - Intronic
1068675564 10:59766175-59766197 GATTAAGAACTGAAGACTGGTGG - Intergenic
1070593728 10:77818245-77818267 GACAAGGCACAGAGGACTTTGGG + Intronic
1072335042 10:94390370-94390392 GATTAAGGACTGAGGACTGGTGG + Intergenic
1073917784 10:108426774-108426796 GAGTAGGGACAGAGGACTAAAGG - Intergenic
1078526657 11:12106622-12106644 GATTGTGTTCAGAGGACTGTGGG - Intronic
1079236524 11:18694684-18694706 GCTAAGGAACAGAGGACAATTGG + Intronic
1079274691 11:19024159-19024181 CATTTGGAGCAAAGGACTGTGGG - Intergenic
1079305602 11:19318732-19318754 AATTTGGAACAAAAGACTGTTGG + Intergenic
1083854381 11:65385465-65385487 GATCAGGAACAGAGGGCAGTGGG - Intergenic
1084871901 11:72103988-72104010 GGTTAGGAAAAGAGAACTGATGG - Intronic
1084999592 11:73018617-73018639 CATTAGAAACAGAGTAATGTAGG - Intronic
1086134118 11:83429881-83429903 TATTAGGAAGAGAGGAATGGAGG + Intergenic
1086253602 11:84847778-84847800 GATTAGAATCTGAGGTCTGTGGG - Intronic
1086973224 11:93105756-93105778 GATTAAGGACTGAGGACTGGTGG - Intergenic
1087673939 11:101137300-101137322 CATTAGGAACACTGGCCTGTTGG + Intergenic
1087735674 11:101830127-101830149 GTTCAGGATCAGATGACTGTAGG - Intronic
1093150598 12:15616770-15616792 GAGTAGAAACAAAGGAATGTGGG - Intergenic
1093347215 12:18053088-18053110 GAGTAGGAAAAGAGAACTGGAGG - Intergenic
1093363688 12:18265573-18265595 TATTAGTAACAGAAAACTGTAGG - Intronic
1094116521 12:26920272-26920294 CAATAGGAACAGAGTGCTGTGGG - Intronic
1095259630 12:40083297-40083319 GATTTGGAAAAGAGGACCCTAGG - Intronic
1096207958 12:49739261-49739283 GATTAAGGACTGAGGACTGGTGG + Intronic
1098609050 12:72432461-72432483 GAGTAGGTACAAGGGACTGTGGG - Intronic
1101876110 12:108597896-108597918 GCTTAGGGACTGGGGACTGTTGG - Intronic
1105658824 13:22470664-22470686 GATTAGGAAGAGTGGGCTTTGGG - Intergenic
1105810411 13:23990409-23990431 TATTGGGAACAGTGGAGTGTAGG - Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107377077 13:39815623-39815645 GATTGGGAACACTGGACTCTTGG + Intergenic
1109923450 13:69102076-69102098 CACAAGGAACAGAGGACTGGTGG - Intergenic
1110234136 13:73198566-73198588 GATCATGAACAGAGGACAGATGG - Intergenic
1110662895 13:78078900-78078922 TTTTAGGAACAGAGAACTGCAGG - Intergenic
1110924996 13:81140056-81140078 GCTTAGGAAAATAGGAATGTTGG + Intergenic
1111853124 13:93601916-93601938 GATTAGGCAAAGAGGACCTTAGG - Intronic
1113510401 13:110849975-110849997 GATTGGGAACAGAGGAGTGGGGG - Intergenic
1114330131 14:21628353-21628375 CATGAGGAATAGAGGACTCTTGG + Intergenic
1114672434 14:24418392-24418414 TAGAAGGAGCAGAGGACTGTAGG - Exonic
1116250491 14:42475588-42475610 GATTAGATACAAAGGAATGTGGG - Intergenic
1117422251 14:55558286-55558308 GAGTAGGCACAGAGTATTGTTGG + Intergenic
1117969219 14:61235790-61235812 GATTAGGTTCAGATGACTCTGGG + Intronic
1118765468 14:68906692-68906714 GAATAGGGACAGAGGGCTGAGGG - Intronic
1121380588 14:93462622-93462644 GATAAGGAACAGAAGACAGTTGG + Intronic
1122102083 14:99420775-99420797 CATTTGGTACAGAGGACTGGTGG - Intronic
1125089975 15:35778977-35778999 GAATAGGAACAGTGTTCTGTAGG + Intergenic
1125172501 15:36781732-36781754 GATTAGGAATACTGGTCTGTTGG + Intronic
1125747930 15:42009907-42009929 GGAGAGGAACAGAGGACTCTGGG - Intronic
1126022819 15:44419057-44419079 GAGTAAGAGCAGAGGACAGTGGG + Intergenic
1127124423 15:55798351-55798373 GAATGGGAGCAGATGACTGTGGG - Intergenic
1129688305 15:77698753-77698775 CATTAGGCCCAGCGGACTGTGGG + Intronic
1130459146 15:84146334-84146356 GATTCCGAAAACAGGACTGTGGG + Intergenic
1137061829 16:35797901-35797923 GAGTAGAAACAAAGGAATGTGGG + Intergenic
1137539768 16:49354263-49354285 GATTAGGAAGTGGGGCCTGTGGG + Intergenic
1137952171 16:52794106-52794128 GATTACTAAAAGAGGATTGTTGG - Intergenic
1138235683 16:55380356-55380378 GATGAGGCACTGAGGACTGAGGG + Intergenic
1139011142 16:62635924-62635946 GATTAGGAAGTGGGGACTTTGGG - Intergenic
1146764391 17:35506114-35506136 GATTAAGTACTGAGGACTGGTGG + Intronic
1147624104 17:41888182-41888204 GATTACGAGCAGAGGCCTGTGGG - Intronic
1147715102 17:42501089-42501111 GATTAGTAAGAAAGTACTGTTGG + Intronic
1147810076 17:43162429-43162451 GATTAAGGACTGAGGACTGGTGG - Intergenic
1149085490 17:52710405-52710427 GAGGATGAACAGAGGACTGGAGG + Intergenic
1149441304 17:56676740-56676762 GATGAGGAGCAGAGGACTGGGGG - Intergenic
1150261782 17:63798959-63798981 GATTAGAAACAGATGGTTGTGGG + Intronic
1152985578 18:317806-317828 GTTTAGGCCCAGAGGACTGTGGG + Intergenic
1153529165 18:6026527-6026549 GATTAAAAACATATGACTGTGGG + Intronic
1155015464 18:21834335-21834357 GATTAAGATGAGAGGGCTGTAGG + Intronic
1156887729 18:42155163-42155185 AATTAGGAAAAGAAGATTGTTGG - Intergenic
1158178050 18:54679797-54679819 GATTAGCCACAGATGTCTGTGGG + Intergenic
1159127105 18:64236532-64236554 GTTTAGGGAGAGAGGAATGTAGG - Intergenic
1162282121 19:9707319-9707341 GAGTAAGAACTGAGGACTGGTGG + Intergenic
1164216676 19:23156746-23156768 GATTAAGGACTGAGGACTGGTGG - Intergenic
1164242670 19:23403648-23403670 GAGTAGGTACAGTGGAGTGTAGG + Intergenic
1166458761 19:42967519-42967541 AATTAGGAACTGAGGAGTGGTGG - Intronic
925752459 2:7101437-7101459 GATAAGGAACAAAAAACTGTAGG - Intergenic
926491210 2:13528191-13528213 GATTAAGGACTGAGGACTGATGG - Intergenic
928305544 2:30167413-30167435 GATTAGAAAAAGAGGTATGTCGG - Intergenic
930303651 2:49649829-49649851 GAGGAGGAAAAGAGGACTATGGG + Intergenic
932769845 2:74494585-74494607 CAATAGGAAGAGAGGAGTGTGGG + Exonic
934971237 2:98766194-98766216 GATGAGGAAGGGAGGACAGTGGG + Intergenic
935851690 2:107228648-107228670 GAATAGGAACAGAAGAATGGTGG - Intergenic
935970819 2:108529209-108529231 GATTAAGGACTGAGGACTGGTGG + Intergenic
936419364 2:112348676-112348698 GATTAAGGACTGAGGACTGGTGG - Intergenic
937789587 2:125944231-125944253 GAGTAGAAACAGAGGAATGTGGG - Intergenic
937789652 2:125944801-125944823 GAGTAGAAACAGAGGAATGTGGG - Intergenic
939077053 2:137616140-137616162 GAGTAGGAAAAGTTGACTGTGGG - Intronic
939921972 2:148126928-148126950 TATTAGTAACAAAGTACTGTTGG + Intronic
942594421 2:177579479-177579501 GAATAGGTACAGAGTACAGTGGG - Intergenic
943948090 2:194093164-194093186 GAGTAGAAACAAAGGAATGTAGG - Intergenic
944136825 2:196408795-196408817 GATTAGGATCTGAGGAATGCTGG + Intronic
945624458 2:212184938-212184960 TGTTATGAACAGAGGACCGTGGG - Intronic
946879250 2:224160949-224160971 GGTGAGGAGGAGAGGACTGTGGG + Intergenic
947852408 2:233299019-233299041 AATTAGGAACATTGGACTGGAGG - Intergenic
948016210 2:234692824-234692846 GACTAGGAACAAAGGCCTTTTGG + Intergenic
948543834 2:238711372-238711394 TGTTAGAAACAGAGCACTGTGGG + Intergenic
949079028 2:242081980-242082002 TATTATGAACAGAGTAGTGTGGG - Intergenic
1170306503 20:14944576-14944598 TATTAAGAAAAGAGGACTCTGGG - Intronic
1170871599 20:20211327-20211349 GATTGAGAACTGAGGACTGTGGG - Intronic
1172814003 20:37672107-37672129 GTTTAGGAACAGGTGACTGAAGG + Intergenic
1172923216 20:38505408-38505430 CATTAGAAACTGAGGACTGCTGG + Intronic
1173082204 20:39879037-39879059 GATTAGGAACTGATGCCTGTTGG - Intergenic
1173441048 20:43076682-43076704 GATAAGGACCAGAGGACAGTGGG - Intronic
1174509205 20:51038244-51038266 GATATGGAACAGGGGATTGTGGG - Intergenic
1175332050 20:58171920-58171942 GATGAGGAGCAGAGGTGTGTTGG - Intergenic
1177856918 21:26410107-26410129 GATTAGGGACAGAGGACAGAGGG - Intergenic
951107470 3:18761790-18761812 GGTGAGGAACAGAGGAGAGTTGG + Intergenic
951248315 3:20366207-20366229 GATTAAGGACTGAGGACTGGTGG - Intergenic
951753212 3:26060225-26060247 AACTAACAACAGAGGACTGTTGG - Intergenic
951985655 3:28617583-28617605 GATTAGGAACAGGCGACTCTTGG + Intergenic
952688573 3:36176911-36176933 GTTTAAGCACAGAGGGCTGTAGG + Intergenic
955141908 3:56277926-56277948 GATTGGGAGCACAGGACTGTTGG + Intronic
955634192 3:61008079-61008101 GATTAGTAAGAGAGGGCTCTTGG - Intronic
956337757 3:68183525-68183547 TATTATGATCAGAAGACTGTTGG + Intronic
957242274 3:77674511-77674533 GATTAGAAAGAGAGGCCTTTGGG + Intergenic
957946916 3:87075912-87075934 GATTAGGATCACAGGAGTTTTGG - Intergenic
959591180 3:108083783-108083805 AAATAGGGAGAGAGGACTGTTGG - Intronic
961350082 3:126294411-126294433 GATGAGCACCAGAGGACTGCAGG - Intergenic
962096519 3:132298309-132298331 GATTAAGAACTGAAGACTGGTGG - Intergenic
962603555 3:137013136-137013158 GACTAAGAACAGGGCACTGTTGG + Intergenic
962942974 3:140142359-140142381 GATGAGGCTCAGAGGACTGTGGG + Intronic
964058285 3:152488749-152488771 GATTAAGAAAAGAGGCATGTGGG + Intergenic
964932778 3:162046762-162046784 GATTAAGGACTGAGGACTGGTGG - Intergenic
974706370 4:65521697-65521719 GATTAGGACCAGAGTAGTTTAGG - Intronic
976800314 4:88983108-88983130 TATAAGGAACAGAGGAAGGTAGG - Intronic
977043325 4:92040658-92040680 GATTAAGGACTGAGGACTGGTGG - Intergenic
977170609 4:93757406-93757428 GATTGGGAAAAGAGTACTCTAGG - Intronic
977486782 4:97658914-97658936 TAATAGGGACAGAGAACTGTAGG - Intronic
978944523 4:114479654-114479676 GAGTAGTAACAAAGGAATGTGGG + Intergenic
980780381 4:137484794-137484816 GATTAAGGACAGAAGACTGGTGG + Intergenic
981427284 4:144618018-144618040 GATTAAGAACATAAGACTGATGG + Intergenic
983552106 4:169028051-169028073 GATTATGAACAGCGGACAGAGGG + Intergenic
983898205 4:173104009-173104031 GATTAAGGACTGAGGACTGGTGG + Intergenic
987087123 5:14481318-14481340 GATTAGGAAAAGAGGCTGGTGGG - Intronic
988005159 5:25401249-25401271 GAGTAGAAACAAAGGAATGTGGG + Intergenic
989095809 5:37780289-37780311 GATTAAGGACTGAGGACTGGTGG - Intergenic
989495676 5:42109241-42109263 GAGTAGAAACAAAGGAATGTGGG + Intergenic
990196880 5:53327509-53327531 GAACAGAAATAGAGGACTGTTGG - Intergenic
991306319 5:65179393-65179415 GATTAAGGACTGAGGACTGGTGG + Intronic
992001575 5:72441502-72441524 GATTGTGAAGAGAAGACTGTGGG - Intergenic
993215098 5:85011809-85011831 TTTTAGGGACAGAGGACTTTAGG + Intergenic
995867647 5:116708447-116708469 GATTAAGGACTGAGGACTGGTGG + Intergenic
998052506 5:139047638-139047660 GAATAGGAACAGAGGCCTAAGGG - Intronic
998770082 5:145533228-145533250 CATTAGGAACAGAGGAAAATAGG - Intronic
1001729717 5:173942487-173942509 GATTAGGCATAGGGAACTGTTGG + Intronic
1001904070 5:175456319-175456341 GAGTCTGAACAGAGTACTGTGGG - Intergenic
1002270700 5:178070095-178070117 GATGAGGAAGAGAGGATTGGTGG - Intergenic
1003785465 6:9480920-9480942 GATAAGGACCATATGACTGTGGG - Intergenic
1003787859 6:9507078-9507100 GATTAGCAACACAGGAATTTTGG + Intergenic
1005877058 6:30019025-30019047 GATTAGGAACATAGGATTGTGGG - Intergenic
1005877073 6:30019129-30019151 CAATAGGAACAGAAGACTATGGG - Intergenic
1007078478 6:39082787-39082809 GATGAGGAGCAGAGGCCTGTAGG + Intronic
1007085284 6:39140082-39140104 GTCAAGGAACAGAGGACCGTGGG - Intergenic
1007840014 6:44708444-44708466 GATTAAGAACAGAGCATTATGGG - Intergenic
1008123704 6:47645927-47645949 GATTAAGGACTGAGGACTGGTGG + Intergenic
1008142380 6:47846739-47846761 GATGAAAAAGAGAGGACTGTGGG - Intergenic
1011260955 6:85469032-85469054 GATTAGGGTCAAAGAACTGTAGG - Intronic
1011565590 6:88668704-88668726 GATTAAGAACTGAGGACTGGTGG + Intronic
1014497660 6:122146399-122146421 GAATAGTAAGAGAGGAATGTAGG - Intergenic
1015172156 6:130265708-130265730 GATTAAGAACTGAAGACTGGTGG + Intronic
1018362740 6:163087874-163087896 GACCAGGACCAGAGGAGTGTTGG + Intronic
1018560128 6:165093337-165093359 GAGTAGAAACAAAGGAATGTGGG + Intergenic
1018741689 6:166733951-166733973 GTGTGGGAACAGAGGACTGAGGG + Intronic
1020043653 7:5023409-5023431 GATTAAGGACTGAGGACTGGTGG - Intronic
1024621112 7:51158632-51158654 CACTAGGAACAGAGCACGGTGGG + Intronic
1028447941 7:90946056-90946078 GATTAGAAACAGTGGAGTGGAGG + Intronic
1029996408 7:105012646-105012668 GAAGAGGAAGAGATGACTGTTGG - Intergenic
1032565973 7:132944247-132944269 AATTAGGAACACAGTACTGTTGG + Intronic
1035412872 7:158659473-158659495 CAAAAGGAACACAGGACTGTTGG + Intronic
1035537292 8:401987-402009 TATTATGAACAGAGTAGTGTAGG - Intergenic
1035764710 8:2096804-2096826 GTTTAGGAAGAGAGTAATGTTGG + Intronic
1036965422 8:13292234-13292256 GATGTGGACAAGAGGACTGTGGG - Intronic
1041036568 8:53797452-53797474 GATTTGGAACCCAGGACTCTGGG - Intronic
1041515698 8:58696615-58696637 GATTAAGGACTGAGGACTGGTGG + Intergenic
1043224601 8:77709046-77709068 GGTTAGGAAAAGAGGATTCTGGG - Intergenic
1044927524 8:97222229-97222251 GATCAGGGAGAGAGGACTGAGGG - Intergenic
1045360065 8:101424835-101424857 GAGGAGGAACAAAGGCCTGTTGG - Intergenic
1047343558 8:124005727-124005749 GATTGGGTACAGAGTACTATGGG + Intronic
1048236446 8:132695465-132695487 GAGTAGGAACAGATGCCCGTAGG + Intronic
1050429352 9:5546295-5546317 GAACAGGAGCAGAGTACTGTGGG - Intronic
1050576834 9:7005488-7005510 GAGTAGAAACAAAGGAATGTGGG - Intronic
1053375161 9:37600019-37600041 GGTGAGGAAAAGAGGACTGTGGG - Intronic
1055549685 9:77421230-77421252 GATGAGGAACAGAAAAGTGTAGG - Exonic
1057424269 9:94935838-94935860 GATCAGTAAGAGATGACTGTGGG - Intronic
1058555225 9:106159701-106159723 GATTAGGAAGAGAGGGATGGTGG + Intergenic
1059429188 9:114240056-114240078 GTTTTAGAACTGAGGACTGTGGG + Intronic
1185946885 X:4386623-4386645 GCTTAGGAACAGAAGACTAATGG + Intergenic
1186638837 X:11433595-11433617 GATTATGATCAGAGGAATGAAGG - Intronic
1189775591 X:44467876-44467898 GACAAGGAACAGAAGCCTGTGGG + Intergenic
1190270505 X:48859547-48859569 GATTAAGAACTGAGGACTGATGG + Intergenic
1190771470 X:53518214-53518236 GATTAAGAACTGAGGACTGATGG + Intergenic
1191639456 X:63414473-63414495 GATTAAGGACTGAGGACTGCTGG + Intergenic
1193717561 X:84950227-84950249 GATTAAGGACTGAGGACTGCTGG + Intergenic
1199715942 X:150507482-150507504 GCATAGGAGCAGAGGACTGGCGG + Intronic
1201513509 Y:14791486-14791508 GATTAGGATCAAAAGTCTGTGGG - Intronic